ebook img

Rapid Cycle Real-Time PCR — Methods and Applications: Quantification PDF

218 Pages·2004·13.016 MB·English
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Rapid Cycle Real-Time PCR — Methods and Applications: Quantification

CARL WITTWER MEINHARD HAHN KAREN KAUL (Eds.) Rapid Cycle Real-Time PCR - Methods and Applications Quantification EM Springer-Verlag Berlin Heidelberg GmbH Carl Wittwer Meinhard Hahn Karen Kaul (Eds.) Rapid Cycle Real-Time PCR - Methods and Applications Quantification With 78 Figures and 108 Tables Springer EU Professor Dr. CARL WITTWER Director of Flow Cytometry & New Technology Department of Pathology University of Utah School of Medicine Salt Lake City, UT 84132 USA Dr. MEINHARD HAHN Deutsches Krebsforschungszentrum Abt. Molekulare Genetik Im Neuenheimer Feld 280 69120 Heidelberg Germany Dr. KAREN KAUL Evanston Northwestern Healthcare Department of Pathology 2650 Ridge Avenue Evanston, IL 60201 USA ISBN 978-3-642-62317-2 We thank Mr. Olfert Landt, TIB MOLBIOL Syntheselabor, Berlin, Germany, for carefully reviewing the sequence and technical information and for his valuable comments. Cataloging-in-Publication Data applied for Bibliographic information published by Die Deutsche Bibliothek Die Deutsche Bibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data is available in the Internet at <http://dnb.ddb.de>. ISBN 978-3-642-62317-2 ISBN 978-3-642-18840-4 (eBook) DOI 10.1007/978-3-642-18840-4 This work is subject to copyright. All rights are reserved, whether the whole or part of the material is con cerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilm or in any other way, and storage in data banks. Duplication of this publication or parts thereof is permitted only under the provisions of the German copyright Law of September 9, 1965, in its current version, and permission for use must always be obtained from Springer-Verlag. Violations are liable for prosecution under the German Copyright Law. http://www.springer.de/medizin © Springer-Verlag Berlin Heidelberg 2004 Originally published by Springer-Verlag Berlin Heidelberg New York in 2004 Softcover reprint of the hardcover 1st edition 2004 The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protec tive laws and regulations and therefore free for general use. Product liability: The publisher cannot guarantee the accuracy of any information about dosage and application thereof contained in this book. In every individual case the user must check such information by consulting the relevant literature. Cover Design: design & production GmbH, 69121 Heidelberg, Germany Typesetting: TypoStudio Tobias Schaedla, 69120 Heidelberg, Germany Printed on acid free paper SPIN 10921111 18/5141 - 5 4 3 2 1 0 Table ofContents PartI Methods HousekeepingGenes:AGoldStandard? 3 ONNOBAKKER,DAPHNE C.TIMMER TheChoiceofHouseKeepingGenesinMRD-Quantification ofAMLl-ETOPositiveAcuteMyeloidLeukemia 11 MARTINWEISSER,CLAUDIA SCHOCH,TORSTEN HAFERLACH, WOLFGANG HIDDEMANN,SUSANNE SCHNITTGER QuantificationofmRNAUsinglinearRegressionofLog-linearPCRData-Points asanAlternativefortheStandardCurveApproach 21 CHRISTIANRAMAKERS,DAPHNETIMMER,ONNOBAKKER, RONALD H.LEKANNE DEPREZ,JAN M.RUIJTER,ANTOON EM.MOORMAN MeasuringGenomeSizesbyAbsoluteQuantification 31 JOCHENWILHELM,MEINHARD HAHN Part11 Applications RegulationandDevelopment RelativeQuantificationofInsulinGeneExpressiononthelightCycler UsingSYBRGreenI 45 NICOLE NEUBAUER QuantificationofBRec-'!'JaSignalJointT-CellReceptorExcisionCircleDNA inPatientsafterAutologousandAllogeneicStemCellTransplantation 53 JUERGEN LOEFFLER,HOLGER HEBART,LUTZ LOCHMANN, THOMAS DAIKELER,PETERBADER,RALF BAUER,KATHRINSCHMIDT, HERMANN EINSELE 171 TableofContents ExpressionAnalysisofMitochondrialComponentsinaVarietyofPlantSpecies UsingReal-TimeQuantitativePCR 61 KATHARINEA. HowELL,RYANLISTER,JAMES WHELAN QuantificationofIkarosSpliceVariantsbyReal-TimePCR 73 ELLIVEISTINEN,KALLE-PEKKA NERA,JUKKA ALINIKULA,OLLI LASSILA MethodstoQuantifyCytokineGeneExpressionbyReal-TimePCR 83 PATRICKSTORDEUR Oncology ProfilingBreastCancerUsingReal-TimeQuantitativePCR 95 SCOT G.FRANK,PHILIP S.BERNARD HER-2/neuGeneCopyNumberQuantifiedbyReal-TimePCRinCelllines andBreastCancerTissue 107 MELANIE KONIGSHOFF,JOCHENWILHELM,MEINHARD HAHN QuantificationofSeveralComponentsofFibrinolytic andMatrixMetalloproteinaseSystemsinPrimaryBreastCancer 117 REMEDIOS CASTELLO,FRANCISCOESPANA,JUSTO AZNAR, AMPARO ESTELLES ARapidCycleReal-TimeQuantitativeP-9lobinPCRforQuantification ofHumanDNAinFeces 125 CORNE H.W.KLAASSEN,CLEMENSEM.PRINSEN, FREDERIKB.J.M.THUNNISSEN QuantificationofTumorLoadforFollicularLymphomabyQuantifyingBCL2/IGH UsingReal-TimeQuantitativePCRbylightCycler™ 131 CHUNG-CHE CHANG,BERNARD C.SCHUR,B.S. Real-TimeQuantificationoftheAMLRearrangements,AML1-ETOandTEL-AML1, inAcuteLeukemia 141 EVABARRAGAN,PASCUAL BOLUFER,MIGUELANGELSANZ Genetics RapidDetectionofGeneDuplicationsinCharcot-Marie-Tooth1ADisease bySNPGenotypingUsingReal-TimePCR 159 C.RUIZ-PONTE,A.VEGA,A. CARRACEDO,E BARROS TableofContents QD CytochromeP4S02D6DeletionGenotypingUsingDerivativeCurveAnalysis ontheLightCycler 171 ALISONMILLSON,ELIZABETH L.FRANK,ELAINE LYON Trisomy21 DetectedbySNPAlleleRatios 179 GENEVIEVE PONT-KINGDON,ELAINE LYON QuantitativeChimerismAnalysisbyAllele-SpecificReal-TimePCRofa10bp Insertion/DeletionPolymorphismwithinthePromotorRegionofFactorVllc 187 HENDRIK REUTER,BJORNTEWS,JOCHENWILHELM,MEINHARD HAHN Microbiology DetectionofSARS-CoronavirusintheLightCycler byS'-NucleaseReal-TimeRT-PCR 199 CHRISTIANDROSTEN NormalizedQuantitativeRapid-CycleReal-TimePCRfortheAssessment ofCMV-DNACopies 211 MARKUS STOCHER,JORG BERG Methods HousekeepingGenes:AGoldStandard? 3 ONNOBAKKER,DAPHNE C.TIMMER TheChoiceofHouseKeepingGenesinMRD-Quantification ofAML'-ETOPositiveAcuteMyeloidLeukemia 11 MARTINWEISSER,CLAUDIASCHOCH,TORSTEN HAFERLACH, WOLFGANG HIDDEMANN,SUSANNE SCHNITTGER QuantificationofmRNAUsingLinearRegressionofLog-LinearPCRData-Points asanAlternativefortheStandardCurveApproach 21 CHRISTIAN RAMAKERS,DAPHNETIMMER,ONNO BAKKER, RONALD H.LEKANNE DEPREZ,JAN M.RUIJTER,ANTOON EM.MOORMAN MeasuringGenomeSizesbyAbsoluteQuantification 31 JOCHENWILHELM,MEINHARD HAHN • Housekeeping Genes:AGold Standard? ONNO BAKKER*,DAPHNE C.TIMMER Introduction Geneexpression studies that aim atprecision require normalization to an inter nalcontrol or"housekeeping"gene.Thegreatest challengeinchoosing an appro priate housekeeping gene is maintaining expression consistency during treat ment. Manygenes can,in principle, be used ashousekeepinggenes [1];however,the two most commonly used are glyceraldehyde-3-phophate dehydrogenase (GAPDH) and ~-actin. Unfortunately, these genes are not as constant in their expression asone would think (or hope) and this particularproblem has result ed in many recent publications [2-10]. ~-actin shows a diurnal rhythm and the expression levelchanges when treating with certain hormones [4].In addition, thepresence ofpseudogenescanbeconfoundingwhen there is,evenalittle,DNA contamination in the RNA preparation [11].Similar difficulties can occur with the well-known housekeeping genes GAPDH,elongation factor 1alpha (EFla), and cyclophilin [11]. Usually,an adequate housekeepinggene can be found in acontrolled system (e.g.,cellculture) using acommercialkit or the"trial anderror"method. How ever, more challenges arise when working with samples from patients who undergo avarietyoftreatments [12],because it isimpossibletomanipulatecon ditions orrepeat the experiment.Similardifficultiesarise whenthe expressionof aspecificgene isstudied in animals throughout the day.Therefore, this chapter focusesontwospecificexperimentaldesigns:(1)the expressionoffour different housekeepinggenes studied in patienttissue samples, and (2) the expression of three housekeepinggenesstudiedduringa12-hlight and a12-hdarkcycleinrat liver. " O.Bakker,Endocrinology&Metabolism,FS-l71,Meibergdreef9,llOSAZAmsterdam, TheNetherlands,E-mail:[email protected] C. Wittwer et al. (eds.), Rapid CycleReal-TimePCR - Methodsand Applications Quantification © Springer-Verlag Berlin Heidelberg 2004 .. Methods Materials Equipment RNase-free glasswareanddisposables MagNAPure LCinstrument (Roche Diagnostics,Mannheim,Germany) LightCycler®instrument(Roche Diagnostics,Mannheim,Germany) Reagents Amplification primers (BioLegio,Nijmegen, The Netherlands) High Pure Tissue mRNAkit (Roche MolecularBiochemicals, Germany) MagNA Pure LCRNAIsolation Kit 11 (tissue) (Roche Molecular Biochemicals, Germany) First StrandcDNASynthesis Kit(Roche MolecularBiochemicals, Germany) LightCycler- FastStart DNAMaster SYBR Green I (Roche Molecular Biochemi cals,Germany) LightCycler- DNAMasterSYBRGreenI(RocheMolecularBiochemicals,Germany) Procedure PrimerDesign The primers are listed in Table 1 and have been previously published. Primer specificitywascheckedbycomparison to the Genbankdatabase. SamplePreparation TotalRNAwaspurified from 58human liver biopsies using the TriPure reagent. From this, cDNAwas prepared using the First Strand cDNASynthesis Kitwith Table lA. Humanprimersequences : I Forward TGA ACGGGAAGCTCA CTGG(728-746) Reverse TCCACCACCCTGTTGCTGTA(1015-1034) MgC1 mM Length:306bp 2:4 Forward GAA CCATCCAGGCCAAAT AA(1059-1078) Rever e CCGTTC TTC CACCACTGA TT (l440-1459) MgC1 mM Length:400bp 2:4 • 11 Forward GGGTCA GAA GGATTC CTATG(202-221) Rever e GGTCTCAAACATGATCTGGG(420-439) MgC1 :5mM Length:237bp 2 .1 Forward GAGACTTCA CCAGGGG(302-317) Reverse CTGTCT GTCTTG GTGCTCTCC(534-554) MgC1 mM Length:252bp 2:4

See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.