Table Of ContentJBC Papers in Press. Published on June 29, 2005 as Manuscript M505249200
Dominguezet al., 2005
Phenotypical and biochemical analysis of BACE1 and BACE2
deficient mice
Diana Dominguez1*, Jos Tournoy1*, Dieter Hartmann1, Tobias Huth5, Kim Cryns3, Siska
Deforce1, Lutgarde Serneels1, Ira Espuny Camacho1, Els Marjaux1, Katleen Craessaerts1,
Anton J.M. Roebroek1,Michael Schwake2, Rudi D'Hooge4, Patricia Bach6, Ulrich Kalinke6,
Dieder Moechars3, Christian Alzheimer5, Karina Reiss2, Paul Saftig2§, Bart De Strooper1§
Running title: BACE1 and BACE2 deficient mice
* These authors contributed equally to this work
D
§ to whom correspondence should be addressed ow
n
1Center for Human Genetics, K.U. Leuven and Flanders Interuniversity Institute for Biotechnology lo
a
d
VIB 4, Herestraat 49, 3000Leuven, Belgium. e
d
2Department of Biochemistry, University Kiel, Eduard-Buchner-Haus, Otto-Hahn-Platz 9, D-24118 fro
m
Kiel, Germany. h
3Johnson & Johnson Pharmaceutical Research and Development, Turnhoutseweg 30, B-2340 Beerse, ttp
Belgium. ://w
w
4Laboratoryof Biological Psychology, K.U.Leuven, Tiensestraat 102, B-3000 Leuven, Belgium. w
5Departmentof Physiology, UniversityKiel, Olshausenstr. 40, D-24098 Kiel, Germany .jbc
.o
6Divisionof Immunology,Paul Ehrlich Institute, Paul-Ehrlich-Str. 51-59, D-63225 Langen, Germany rg
b/
y
g
u
e
s
t o
n
A
p
ril 2
, 2
0
1
9
1
Copyright 2005 by The American Society for Biochemistry and Molecular Biology, Inc.
Dominguezet al., 2005
(cid:69)-Secretase, or BACE1, is the rate limiting and the C-terminus of A(cid:69), and are the subject of
protease for the generation of the amyloid (cid:69)- intense investigation because of their relevance
peptide in Alzheimer’s disease. Mice in which as candidate therapeutic targets to treat AD.
the BACE1 gene is inactivated are reported to BACE1 and BACE2 are two highly homologous
be healthy. However, the presence of a membrane-bound aspartyl proteases that can
homologous gene encoding BACE2 raises the process APP at the (cid:69)-secretase site (1-8).
possibility of compensatory mechanisms. Although both enzymes exhibit many of the
Therefore, we have generated BACE1, characteristics expected for (cid:69)-secretase, it has
BACE2 and double knock out mice. We report been quite convincingly demonstrated that
here that BACE1 mice display a complex BACE1 is in fact the major (cid:69)-secretase
phenotype. A variable but significant number responsible for A(cid:69) generation in brain (9-11).
of BACE1 offspring dies in the first weeks Contrary to BACE1, BACE2 is more highly
after birth. The surviving mice remain smaller expressed in peripheral tissues, but also to some
than their littermate controls and present a extent in the brain (2,12,8,13) raising the
hyperactive behaviour. Electrophysiologically, question whether BACE2 could contribute to the
subtle alterations in the steady state
generation of the brain A(cid:69) pool. Both BACE1
inactivation of voltage-gated sodium channels
and BACE2 can cleave APP in vitro not only at
in BACE1 deficient neurons are observed. In the Asp1 position (numbering considering the Do
contrast, BACE2 knock out mice display an w
first amino acid of A(cid:69) as position 1) but also at n
overall healthy phenotype. Combined internal sites within the A(cid:69) region. BACE1 load
deficiency of BACE2 and BACE1 enhances, ed
however, the BACE1-/- lethality phenotype. cleaves between amino acids 10 and 11 of A(cid:69) fro
resulting in an N-terminally truncated peptide m
At the biochemical level we confirm that h
that is considered more amyloidogenic and more ttp
BACE1 deficiency results in an almost neurotoxic than full-length A(cid:69) (14) and which ://w
complete block of A(cid:69) generation in neurons, w
has been observed in senile plaques (15,16). The w
but not in glia. As glia are ten times more internal BACE2 cleavage site is between amino .jbc
abundant in brain than neurons, our data .o
acids 19 and 20 (8,17,18) and the resulting A(cid:69) rg
indicate that BACE2 could indeed contribute peptide has thus far not been found in senile by/
to A(cid:69) generation in the brain of AD and in g
plaques. Moreover, BACE2-transfected cells u
e
particular of Down’s syndrome patients. s
produce reduced levels of A(cid:69) (2,8,13,18) and t o
In conclusion, our data challenge the general n
selective knock-down of endogenous BACE2 in A
idea of BACE1 as a safe drug target and call p
for some caution when claiming that no major HEK293 cells by RNAi elevates A(cid:69) secretion ril 2
(19). These observations led to the suggestion , 2
side effects should be expected from blocking 0
1
that BACE2 does not function as a (cid:69)-secretase 9
BACE1 activity.
but rather as an (cid:68)-like secretase that precludes
A(cid:69) formation (17-20). However, this in vitro
Alzheimer’s disease (AD) is the most common observations can not rule out a possible
cause of dementia for which neither a good contribution of BACE2 to the A(cid:69) pool in brain,
diagnostic test nor an effective treatment is and it has even been suggested that BACE2-
available yet. The most widely accepted mediated APP cleavage might play a role in the
hypothesis states that AD is initially triggered by development of AD in individuals carrying the
the abnormal accumulation and possibly Flemish familial AD mutation in APP (8) as well
deposition of a small peptide, amyloid(cid:69) (A(cid:69)(cid:12)(cid:15) in as in the AD-like disease associated with Down’s
different brain regions, which in turn initiates a syndrome (12,21).
pathogenic cascade that ultimately leads to From a therapeutic point of view, there are
neuronal death, AD pathology and dementia. A(cid:69) increasing concerns with using (cid:74)-secretase
is cleaved out from a long, membrane-bound inhibitors to treat AD. (cid:74)-Secretase processes a
precursor, the amyloid precursor protein (APP) growing number of membrane proteins and
by two consecutive cleavages. (cid:69)- and (cid:74)-secretase blocking their cleavages is likely to have toxic
are the enzymes that liberate, respectively, the N- side effects. Indeed, administration of a potent (cid:74)-
2
Dominguezet al., 2005
secretase inhibitor to mice resulted in marked peptides CLRHQHDDFADDISLLK. Rabbit
defects on lymphocyte development and on the antibodies B7/8 against A(cid:69) and B63 raised
intestine villi and mucosa (22), as was also against the C-terminus of human APP, have
observed in presenilin deficient mice (23). On the already been described (25,26, respectively).
contrary, BACE1 appears as a promising drug Anti-flag monoclonal antibody is from Sigma.
target, since genetic ablation of the BACE1 gene The human anti-A(cid:69) antibody N-terminal specific,
in mice does not seem to be associated with any 82E1, is from IBL, Japan.
gross abnormality (9-11). Moreover, BACE1 Plasmid construction- cDNAs to be
deficiency could prevent the learning and expressed in non-neuronal cells were sub-cloned
memory impairments and the cholinergic into a derivative of the eukaryotic expression
dysfunction observed in a transgenic mouse vector pSG5 (Stratagene) that contains a larger
model for AD (24). Whereas BACE1 function polylinker (pSG5**, polylinker: EcoRI,
might still be required under particular conditions SpeI,SacII, HindIII, NotI, XhoI, SmaI, SacI,
that may have escaped detection, these results BamHI, BglII). BACE1 cDNA was amplified
highlight BACE1 as one of the best available from mouse brain RNA using the primers
drug targets for AD. At this point, however, it 5’GGATTCATGGCCCCAGCGCTGCACTGGC
cannot be excluded that BACE1 has important T3’and5’GAGCTCTCACTTGAGCAGGGAG
functions in vivo and that the apparent lack of ATGTCATC 3’ (SacI site underlined) and
phenotype in BACE1 knock out mice is due to directly cloned into pGEM-T (Promega). The D
o
the activation of compensatory mechanisms or to SacI-SacII fragment was subsequently sub- w
n
genetic redundancy. Because of their high cloned into the SacI-SacII sites of pSG5**. loa
d
homology, BACE2 is the best candidate protease BACE2 cDNA was amplified from mouse ed
to compensate for the absence of BACE1 pancreas cDNA using the primer set fro
m
function. Based on this homology, it is also likely 5'ATGGGCGCGCTGCTTCGAGCAC 3' and 5’ h
that active site inhibitors for BACE1 will affect TCATTTCCAGCGATGTCTGAC 3’ and cloned ttp://w
in addition BACE2 protease activity. into the pGEM-T vector. TheXmaIII fragment of w
w
In order to better understand the biological pGEM-T-mBACE2 was subsequently subcloned .jb
functions of BACE1 and BACE2, to analyse into the SmaI site of pSG5**. For the cloning of c.o
possible overlapping functions of these two BACE2 cDNA containing a deletion of exon 6 brg/
proteases and in an attempt to predict the (BACE2(cid:39)E6), two subfragments of the cDNA y g
u
consequences of blocking BACE function in where separately amplified using primers that es
vivo, we generated mice with inactivated BACE1 contain the deletion: the 5’ fragment was t on
A
and/or BACE2 genes. Unexpectedly and in amplified using T7 as forward and 5’ p
contrast to what has been published for BACE1 AGAAAACTCTGGAATCTCTCTGCAGTCCA ril 2
knock out mice, we do observe a phenotype GGTTGAGGTTCTGG 3’ as reverse primer. For , 20
1
associated with BACE1 deficiency, namely a the 3’ fragment, the primer set 5’ 9
higher mortality rate early in life. BACE2 knock CTGGACTGCAGAGAGATTCCAGAGTTTTC
out mice are fertile and viable, with no major TGATGGCTTCTGGAC 3’ and 5’
phenotypic alteration. Most importantly, mice GCTGCAATAAACAAGTTCTGCT 3’ was
with inactivated BACE1 and BACE2 genes are used. Purified 5’ and 3’ sub-fragments were
fertile and viable but present neonatal mortality mixed together and PCR amplified using the T7-
that is even higher than that of the monogenic and 5’ GCTGCAATAAACAAGTTCTGCT 3’
BACE1 line. These results suggest that BACE2 primers. The PCR product was digested with
indeed partially compensates for the absence of EcoRI and BamHI and cloned in the same sites of
BACE1 in BACE1 knock out mice and that
pSG5**. Cloning of BACE2 and BACE2(cid:39)E6
therapeutic inhibition of BACE function may
containing a C-terminal flag epitope was done by
result in adverse side effects.
PCR amplification on pSG5**BACE2 and
pSG5**BACE2(cid:39)E6, respectively, using the
EXPERIMENTAL PROCEDURES
primers 5’CGGAATTCCACCATGGGCGCGC
TGCTTCGAGCA 3’ (EcoRI site underlined) and
Antibodies- The C-terminal specific
5’CGGGATCCTCATTTATCGTCGTCATCCTT
antibody for mouse BACE1 (B48) was raised in
New Zealand White rabbits using the synthetic
3
Dominguezet al., 2005
GTAGTCTTTCCAGCGATGTCTGACTAGT 3’ type APP (APPwt), or APP containing the
(BamHI site underlined; flag epitope in italics). Swedish- (APPsw) or the Flemish (APPfl)
PCR products were digested with EcoRI/BamHI familial Alzheimer’s disease mutations was
and cloned into the same sites of the pSG5** added to the cultures and infection proceeded for
vector. All constructs were verified by one hour. Conditioned medium containing the
sequencing. virus was then replaced by fresh medium and
For expression in neuronal and glial cells, cells were further incubated for 2 hours. Cells
cDNAs were cloned into Semliki Forest virus-1 were metabolically labelled with 100 μM/ml
(SFV-1). Cloning of SFV-APPwt, SFV-APPsw [35S]methionine for 4 hours, the conditioned
and SFV-APPfl have already been described medium was collected and the cells were directly
(27,28). lysed in DIPA buffer.
Mouse fibroblasts were plated in 12-well plates
Primary cultures and cell lines- Medium,
one day before infection (~300000 cells/well). A
serum and supplements for maintenance of cells
1:4 dilution of adenovirus encoding APPsw was
were obtained from Invitrogen. COS cells and
added to the medium and cells were further
adult mice fibroblasts were maintained in
incubated for 48 hours. Metabolic labelling was
Dulbecco’s modified Eagle’s medium/F12 (1:1)
subsequentlydone as described above.
supplemented with 10% foetal calf serum.
Primary neuronal cultures were generated from Analysis of APP processing- APP full-
D
trypsinized brains obtained from 14-days-old length and C-terminal fragments (stubs) were o
w
embryos and were maintained in Neurobasal immunoprecipitated from cell extracts using the n
lo
medium (Invitrogen) supplemented with B27 and B63 antibody. A(cid:69) was immunoprecipitated from ad
e
d
0.5 μM L-glutamine. 5 μM cytosine arabinoside the conditioned medium using the B7/8 antibody. fro
wereadded 24 hours after plating to prevent non- Protein G–Sepharose beads (Pharmacia) were m
h
neuronal (glial) cell proliferation. For glial cell added to the mixtures and incubation proceeded ttp
cultures,the Neurobasal medium was replaced by overnight at 4°C with rotation. The ://w
w
MEM-HS medium (MEM medium (Invitrogen) immunoprecipitates were washed five timeswith w
supplemented with 10% horse serum, 0.225% DIPA buffer and once with 0.3 x TBS and then .jb
c
NaHCO3, 2 mM L-glutamine and 0.6% glucose. solubilized with Nu-PAGE LDS loading buffer. .org
Cultures were maintained at 37°C in a humidified Samples were heated for 10 min at 70°C and b/
y
5% CO2 atmosphere. electrophoresed on 4-12% precast gels gue
DNA transfer and metabolic labelling- (NOVEX). Radiolabeled bands were detected by st o
n
COS cells were plated in 6 cm2 plates one day PhosphorImager(Molecular Dynamics, Inc.). A
p
before transfection. Approximately 70-80% Analysis of APP processing using the ril 2
confluent cells were transfected with total 2 μg of 82E1 antibody- Neurons and glia cells were , 2
0
1
DNA (1 μg of APP- and 1-μg of BACE- infected with recombinant SFV virus for one 9
plasmids) and 6 μl of FuGene (Roche). Two days hour as described above. Medium was
after transfection cells were metabolically subsequently replaced by neurobasal medium
labelled with 100 μM/ml [35S]methionine for 4 (neurons) or MEM-HS medium (glia cells) and
hours, the conditioned medium was collected and cells were further incubated for 6 hours. Cells
cells were directly lysed in DIPA buffer (50 mM were lysed in PBS buffer containing protease
Tris/HCl pH 7.8, 150 mM NaCl, 1% Triton X- inhibitors (Trazylol, 1 μg/ml pepstatine, 5mM
100,1% sodium deoxycholate and 0.1% SDS). EDTA) and 1% Triton-X100. Samples of cell
Neurons were maintained in neurobasal medium extracts were resolved by SDS-PAGEand probed
and ~48 hours after the addition of cytosine with B63 antibody. A(cid:69) was immunoprecipitated
arabinoside they were infected with recombinant from the conditioned medium using B7/8
Semliki Forest Virus (SFV). Glial cells were antibody and detected by Western blotting using
maintained for ~1 week in MEM-HS medium, the 82E1 antibody.
passaged at least once and infected with
FRET analysis- COS cells were
recombinant SFV ~48 hours after trypsinization
transfected with 2 μg of either empty vector or
(this treatment ensured the absence of neurons in
with vectors encoding BACE1-, BACE2-Flag- or
the culture). For both neurons and glia cells, a
BACE2(cid:39)E6-Flag, using 6 μl of Fugene. Forty-
10-fold dilution of SFV encoding either wild-
4
Dominguezet al., 2005
eight hours after transfection, cells were scraped recordings were made at room temperature (19-
in buffer B (5 mM Tris pH 7.4, 250mM sucrose, 20° C). Current signals from acutely isolated
1mM EGTA, 1%Triton-X100) and protein pyramidal cell somata recorded in whole-cell
concentration was determined using the Protein voltage-clamp mode were sampled at 20 kHz and
Assay Dye Reagent (500-0006, Biorad filtered at 5 kHz (-3 dB) using an Axopatch 200B
laboratories). ~400 μg of proteins were amplifier in conjunction with a Digidata 1322A
subsequently incubated with B48 antibody interface and pClamp 9 software (all from Axon
(BACE1-transfected cells) or anti-Flag antibody Instruments, Foster City, CA, USA). Access
(BACE2-transfected cells) and proteine G- resistance in the whole-cell configuration was 10
Sepharose beads (Pharmacia) overnight at 4°C. - 15 M(cid:58) before series resistance compensation
The immunoprecipitates were washed three times (75 - 80 %). To improve voltage control, Na+
with TBS containing 0.1% Triton-X100 and currents were investigated in a low Na+ bathing
twice with TBS. BACE activity was solution containing (in mM): NaCl 15, Choline-
subsequently measured in an in vitro assay Cl 115, KCl 3, MgCl 2, CaCl 1.6, CdCl 0.4,
2 2 2
(Panvera, P2985) by Fluorescence Resonance HEPES 10, D-glucose 10 (pH 7.4). Patch pipets
Energy Transfer (FRET), according to the were filled with (in mM): CsF 105, TEA-Cl 20,
manufacturer’s instructions. Briefly, an APP- KCl 3, MgCl 1, HEPES 8, EGTA 9, Na -ATP 2
2 2
based peptide substrate carrying the Swedish (pH 7.2, adjusted with Cs-OH). Data are
mutation was used that contains a fluorescence presented asmean± SEM. Data were statistically D
o
donor and a quencher acceptor at each end. The analyzed (student´s t test, significance set at P < w
n
intact substrate is weakly fluorescent and 0.05) with the use of Origin Pro7 software. loa
d
becomes highly fluorescent upon enzymatic Substances were purchased from Sigma ed
cleavage. BACE immunoprecipitates were (Deisenhofen, Germany). fro
m
directly resuspended in 20 μl assay buffer h
provided with the kit and after substrate addition, Behavioural analysis ttp://w
excitation and emission were measured using Animals- A panel of 69 male mice (25 wild-type, w
w
Victor2 (multilabel counter 1420 Perkin Elmer). 23 heterozygous, and 21 BACE1 knock out .jb
homozygPoutpe - eaxncdh a8n wgeil-d -Aty peto ctaolu polfe s 8w eBreA uCsEed1 laiststeersms aatneximetiyc-er;e laagteedd b3e-h9a vmioorn tihns )t hwe aosp euns efdi eltdo bc.org/
for the experiment. Coupling was synchronized test (OFT) and elevated zero-maze, and y gu
depression-related behavior in the tail suspension e
abnirdth p. uTphs ew neruem ebxecrh aonf gpedu pdsu rwinags tfhoel lfoiwrset dd auyn toifl test (TST) and forced swim test (FST). Animals st on A
weaning. wligehret/ dinadrkiv icdyucallel y(hlioguhstes d oann da kt e6p:t0 u0n dae.mr 1.)2 :i1n2 ha pril 2
Electrophysiological recordings-Acutely temperature- and humidity-controlled room with , 2
0
1
isolated pyramidal cell somata were prepared food and water at libitum. All experiments were 9
from the sensorimotor cortex of anesthetized and conducted during the light phase of the light/dark
then decapitated wild-type and BACE1 -/- mice cycle with one week in-between experiments.
(23 - 30 days of age), using an established Experiments were approved by the animal care
method of combined enzymatic/mechanic and use committee of Johnson & Johnson
dissociation (29). Briefly, freshly prepared Pharmaceutical Research and Development.
neocortical slices were incubated for 30 min in Open field test- Locomotor activity was
warmed (29 oC) artificial cerebrospinal fluid monitored using a Tru-scan(cid:164) system (Coulbourn
(ACSF), and then maintained at room instruments, Allentown, USA). The animal was
temperature. ACSF was constantly gassed with placed in the center of the activity-field arena,
95% O2/5% CO2 and contained (in mM): NaCl which is a transparent plexi cage (W x D x H;
125, KCl 3, CaCl2 2, MgCl2 2, NaH2PO4 1.25, 260 x 260 x 400 mm) equipped with two photo-
NaHCO3 25, D-glucose 10 (pH 7.4). Small pieces beam sensor rings to register horizontal and
of slice tissue (approx. 2 x 2 mm) were incubated vertical activity. Testing lasted 30 minutes.
for 45 min at 29° C in HEPES-buffered saline Elevated zero maze- Elevated zero-maze
(HBS) containing 19 U ml-1 papain. HBS was testing was performed as described by Crawley
composedof (in mM): NaCl 150,KCl 3, CaCl2 2, (2000) (30). The zero-maze consists of an
MgCl2 2, HEPES 10, D-glucose 10 (pH 7.4). All annular platform (diameter: 50 cm, width: 5 cm).
5
Dominguezet al., 2005
The animals were allowed to freely explore the the first 3-6 days of birth. From those remaining,
maze for 5 minutes and their behavior was 44 (~24%) showed growth retardation (see for
recorded and analyzed using the Ethovision Pro example figure 1D) and died by 3-4 weeks of age
video tracking system (Noldus, The from a wasting syndrome. On the contrary,
Netherlands). mortality in the wild-typeand heterozygote group
Tail suspension test- Mice were did not exceed 2% (figure 1B). The high neonatal
suspended by their tail to a hook in a test death observed in BACE1 -/- pups was not
chamber using adhesive tape. Total duration of caused by a nursing defect of BACE1 deficient
immobility was measured over a period of 6 mothers. In a pup exchange experiment, there
minutes using the Videotrack system (Viewpoint, was no reduction in neonatal mortality of BACE1
France). Mice that curled up towards their tail or knock out pups born to BACE1 knock out
that fell off during testing were excluded for parents when they were nursed by a wild-type
analysis. mother (figure 1C). Healthy BACE1 null mice,
Forced swim test-The mouse was placed finally, are ~30% smaller by weight than control
in a cylinder ((cid:135) 10 cm), filled with water to a mice. This was observed in BACE1 heterozygote
height of 10 cm and a temperature of 25(cid:113)C (cid:114) crosses (weight measured by 3 weeks of age, 8.3
1(cid:113)C. The mouse was exposed to swim-stress for +/- 0.9 g for wild-type; 9.1 +/- 0.4 g for BACE1
6 minutes. Total duration of immobility was +/- and 5.8 +/- 0.4 g for BACE1 -/-, not shown)
measured using the Videotrack system and further confirmed in BACE1 and BACE2 D
o
(Viewpoint, France). One animal was excluded heterozygote crosses (figure 1E). The BACE1 wn
for analysis because it had an extremely high fat deficient mice surviving to adulthood are fertile loa
d
mass and tended to drownduring testing. and histological and anatomical examination ed
Statistical analysis- Data were analyzed failed to evidence any gross phenotypic fro
m
using one-way ANOVA or Kruskal-Wallis abnormality (supplementary figure 4 and data not h
ANOVA on ranks in case data were not normally shown). ttp://w
distributed, followed by post hoc Tukey test To exclude the possibility that mortality in our w
w
(one-way ANOVA) or Dunn’s method (Kruskal- colony is due to a defect independent from .jb
Wallis ANOVA on ranks) if appropriate. BACE1 deficiency, a second BACE1 deficient c.o
line was independently generated (BACE1II line, brg/
RESULTS supplementary information). A similar mortality y g
u
rate was observed with those mice (not shown), e
s
A lethal phenotype in BACE1 knock out demonstrating that mortality is directly linked to t on
mice- Several groups have reported the BACE1 deficiency. Ap
generation of BACE1 knock out mice (9-11). We BACE1 is known to cleave PSGL-1 and ST6Gal ril 2
generated an independent line of BACE1 I, both proteins implicated in immune reactions , 20
1
deficient mice (BACE1I line, supplementary (31-33), and therefore we performed a series of 9
information). Briefly, a neomycin expression in vitro and in vivo assays to evaluate the ability
cassette was inserted within the first coding exon of BACE1 deficient animals to mount an
of the BACE1 gene at codon position 49, which efficient immune response. We first tested
results in the introduction of a premature in frame whether BACE1-/- mice could mount an efficient
translational stop codon. Absence of BACE1 immune response to vesicular stomatitis virus
protein was confirmed by Western blotting on (VSV) infection. To this end, BACE1-/- mice,
extracts from embryos’ brains using a BACE1 heterozygous and wild-type littermates were
specific C-terminal antibody (figure 1A). BACE1 intravenously challenged with 2x106 pfu VSV.
deficient mice appeared at first glance viable and On day 4 after infection, all mice analyzed
fertile. However, during expansion of the colony mounted similar VSV neutralizing IgM responses
in two different conventional facilities in Leuven that switched to the IgG isotype by day 8 and
and in Kiel, we observed increased lethality reached plateau levels at later time points
among BACE1 deficient pups in the first weeks (supplementary figure 5). Thus, adaptive
after birth. Mortality was almost exclusively immunity was functional in BACE1-/- mice, i.e.
restricted to the BACE1 -/- group (figure 1B). VSV neutralizing T help-independent IgM and
Out of 180 BACE1 knock out pups born to the T help-dependent switch to the IgG subtype
BACE1 knock out parents, 34 (19%) died within were normally induced. Furthermore, a similar
6
Dominguezet al., 2005
resistance to lethal VSV infection at higher were tested in the tail suspension and forced
infection doses (data not shown) suggested that swim tests, which are both validated models for
the overall quality and quantity of VSV-specific assessing depression-related behaviours. As
immunity was very similar for all genotypes. We shown in figure 2E, there was no significant
further checked (a) the number and type of effect of genotype on immobility in the tail
leukocytes that migrated into the peritoneum in a suspension test (F(2,59)=1.085, P=0.345). In the
model of acute peritonitis induced by forced swim test (figure 2F), homozygous
thioglycolate (34,35), (b) the activation of animals showed a significant decrease in
macrophages in vitro as evaluated by TNF-(cid:68) immobility time compared to heterozygous and
secretion upon stimulation with pathogens wild-type animals (F(2,65)=16.625, P<0.001).
(Mycobacterium avium and Mycobacterium This difference probably reflects a hyperactive
tuberculosis) or with LPS, and (c) the T-cell rather than an anti-depressive phenotype.
responses, as measured by the capacity of Similar data were obtained in independent
activated T-cells isolated from spleen of pre- behavioural analyses of the BACE1I strain (not
immunized mice, to destroy chromium labelled shown).
cells from a different genetic background. All
Na+ currents in cortical neurons of
these experiments were negative (results not
BACE1 knock out mice- BACE1 has been
shown), suggesting that the overall immune
recently shown to cleave (cid:69)2 and (cid:69)4 subunits of
defence of the BACE1 knock out animals is not voltage-gated Na+ channels in the mouse brain Do
dramatically compromised. w
(36). These (cid:69)-subunits are auxiliary subunits nlo
a
Behavioural analysis of BACE1 deficient which associate with the principal, pore-forming d
e
d
mice- We tested BACE1 knock out mice (strain (cid:68)-subunit and regulate the function and fro
BACE1II) in a battery of behavioural tests expression of voltage-gated Na+ channels (37). m
h
(figure 2). In the open field test, BACE1 null We wondered hence whether the genetic ablation ttp
mice displayed hyperactivity and enhanced of BACE1 would influence the properties of the ://w
w
locomotion compared to heterozygous and wild- fast Na+ current. To address this issue, we w
type littermates, as illustrated by a significant performed whole-cell recordings from pyramidal .jbc
increase in total move time (figure 2A; cell somata that were acutely isolated from slices .org
F(2,66)=10.743, P<0.001) and total distance of mouse neocortex. We chose this preparation by/
travelled (figure 2B; H=16.387, P<0.05). The because BACE1 is highly expressed in neurons gu
e
BACE1 genotype had, however, no effect on the of this brain region (36) and because dissociated st o
n
relative time spent in the centre and the relative cells offer the advantage of allowing adequate A
p
dinisdtiacnactees trtahvaetl leBdA iCn Eth1e kcneonctrke (onuott mshiocwe nd).o Tnhoist scpuarrteion-ttse.m Apoftrearl pvhoalrtmagaec olcoognictraol l suopfp refasssito nN oa+f ril 2, 2
show an anxiolytic nor an anxiogenic phenotype, voltage-dependent Ca2+ and K+ currents with 01
9
what was confirmed in the elevated zero maze Cd2+ and Cs+/TEA+, respectively (see
test. In this test BACE1 deficient mice showed a Experimental procedures), fast Na+ currents were
significant increase in the total distance travelled gradually activated by step depolarizations to
(figure 2C; F(2,65)<=21.926, P=<0.001), again command potentials between -60 and 10 mV
pointing to a hyperactive phenotype. One mouse (figure 3A). To determine the current-voltage (I-
with a homozygousgenotype actively jumped off V) relationship of the Na+ current, the peak
of the maze and was excluded from the analysis. current amplitude at each voltage step was
Further, there was a significant effect of genotype normalized to the neuron´s capacitance and
on the relative time spent in the open arms plotted as a function of the command potential
(figure 2D; F(2,65)=4.003, P=0.023). Post hoc (figure 3B). Cortical neurons from BACE1 knock
analysis revealed that BACE1 null mice out mice had a tendency to display lower Na+
exhibited an increase of the relative time spent in current densities than those from wild-type mice,
the open arms compared to heterozygous but this difference did not reach statistical
littermates (P<0.05). This stresses that there is no significance. The activation curve of the Na+
indication of anxiety. No influence of genotype conductance (G) was constructed from the I-V
on the relative distance travelled in the open arms relationship of figure 3B with the use of the
could be detected (not shown). Finally, animals equation
7
Dominguezet al., 2005
G = I / (V - E ) and BACE2, but not BACE2(cid:39)E6, were capable
Na
where I is the peak current amplitude at of cleaving the peptide (figure 4). Western
command potential V and E is the equilibrium blotting confirmed that similar levels of BACE2
Na
potential for Na+ under our experimental and BACE2(cid:39)E6 were tested in the assay (figure
conditions. As shown in figure 3C (open 4). Thus the BACE2(cid:39)E6 protein encoded in
symbols), the activation curve of the Na+ BACE2 knock out mice lacks protease activity.
conductance did not differ between neurons from Mice homozygous for the deficient BACE2 allele
wild-type and BACE1 -/- mice. Steady-state were born at normal frequency, fertile and overall
inactivation of Na+ currents was determined by healthy. No difference in size could be identified
holding the neuron for 1 s at prepulse potentials when compared to littermate controls (figure 1D
between -100 and -20 mV before evoking a Na+ and E). In a standard battery of blood and clinical
current response with a voltage step to 0 mV. chemistry parameters, no abnormality associated
Current amplitudes were expressed as a fraction to the genotype has been detected (not shown).
of the maximum current amplitudeand plotted as Extensive pathological analysis of four BACE2
a function ofthe prepulse potential. In contrast to +/+ and four BACE2 -/- mice with hematoxylin
activation, steady-state inactivation did vary and eosin staining failed to show any abnormality
significantly between neurons from wild-type related to genotype (supplementary information).
mice and from BACE1-deficient mice (figure 3C,
Generation and characterization of
filled symbols). The rightward shift of the steady- D
BACE1-/-BACE2-/- knock out mice- To identify o
state inactivation curve in neurons from BACE1- w
deficient mice (wild-type: V = -65 mV dashed putative major BACE functions that could be nlo
cinudrvicea,t eBs AthCaEt 1a lKarOg:e rV fhr a=ct i-o5nh8 omf VN,a +s oclhiadn ncuelrsv eis) ckonmocpke nosuatt eldinfeosr, wine t hgee nseinragtleed m moincoeg edneifcic iBeAntC iEn aded fro
both BACE1 and BACE2 proteases. m
available at a given potential compared to h
neurons from wild-type mice. Recovery from Innetoenreastatiln mgloyr,t aldiotyubolfe ~ 6k0n%oc, kth eoreufto rme hicieg hehra tdh ana ttp://w
inactivation was studied by gradually increasing w
that observed in the single BACE1 deficient line w
tphuel sienst ertvoa l0 ( 1m mVs. toT 2h es ) pbeeatkw eaemn ptwlitou d1e5 -mofs ttehset (figure 1B). Out of 122 double knock out mice .jbc.o
sreescpoonnds eN aat+ mcauxrirmenutm reinstpeornvsael,, wdaivs idtheedn bpylo ttthede bwoitrhni nto tdhoeu fbilres tk n3o-5c kd oauyts ppaorestnntas,t a5l1ly (. ~A42d%di)ti doineadl by grg/
24 pups (~20%) died within the first 3-4 weeks u
as a function of the interpulse interval. As shown e
s
in figure 3D, recovery from inactivation was not from a wasting syndrome. The surviving animals t on
are fertile and a detailed pathological A
significantlydifferent between the two groups. p
Generation and characterization of e(sxuapmpilneamtieonnt arfya iilnefdo rmtoa trioevne aanl d adnayta anbont osrhmowalnit)y. ril 2, 2
BACE2 knock out mice- To understand the in Like BACE1 knock out mice, healthy double 01
9
vivo function of the (cid:69)-secretase homologue knock out animals remain smaller than their
BACE2, a BACE2 knock out mouse line was control littermates (figure 1D and E).
generated. Two lox P sites were first introduced
Processing of APP in BACE deficient
in the intronsflanking exon 6 that contains one of
cells- We next analysed the processing of APP in
the two enzyme’s active sites. Mice heterozygous
cells derived from knock out animals. We started
for the BACE2 conditional-targeted allele were
with primary neurons because, while BACE1 is
subsequently crossed with mice expressing Cre
expressed at relatively high levels in neurons,
recombinase from the ubiquitous PGK promoter,
BACE2 expression in these cells is still a matter
resulting in the deletion of BACE2 exon 6
of debate (2,13,19). We analysed in parallel
(BACE2(cid:39)E6) (supplementary information). To
APPwt, APPsw and APPfl. APPsw and APPfl
demonstrate that the BACE2(cid:39)E6 protein does not
were chosen because both mutations are known
have (cid:69)-secretase activity, BACE1, BACE2 and
to affect (cid:69)-secretase cleavage (8).
BACE2(cid:39)E6 expressed in COS cells were
We confirmed that BACE1 deficient neurons do
immunoprecipitated from cell extracts and
not process APP at the known (cid:69)-secretase sites,
protease activity was measured in an in vitro
Asp1 and Glu11, as shown by the absence of (cid:69)1-
assay using a synthetic peptide representing the
and (cid:69)11 stubs (figures 5A). However, we
BACE1 cleavage site of APPsw. Only BACE1
8
Dominguezet al., 2005
observed a novel APP C-terminal fragment that out fibroblasts that results in the generation of a
migrates slightly faster than the (cid:69)1 stub (asterisk CTF similar to that observed in neurons. Double
in figure 5A). BACE2 is not responsible for this knock out cells still produce this fragment,
cleavage, since the same fragment is still demonstrating that, like in neurons, BACE2 is
produced in double BACE1/BACE2 deficient not responsible for this compensatory cleavage.
neurons. The fact that BACE1 knock out neurons Interestingly, fibroblasts deficient in the BACE2
do not produce any measurable A(cid:69) and that there enzyme secrete higher levels of A(cid:69) compared to
is no measurable effect on APP processing in wild-type cells. These results indicates that
primary neurons deficient in BACE2 confirms fibroblast endogenous BACE2 has an anti-
that BACE1 is the only(cid:69)-secretase in these cells. amyloidogenic function in vivo.
Glia cells are the most abundant cells in the brain
and we next checked how APP processing is DISCUSSION
affected by the absence of BACE proteases.
Interestingly, BACE1 deficient glia cells secrete We generated mouse lines that are deficient in
measurable levels of A(cid:69), that are more prominent BACE1, BACE2 or both. Previous reports
in APPsw and APPfl transduced cells (figure claimed that genetic ablation of BACE1 does not
5B). Moreover, whereas wild-type cells that result in overt phenotypical alterations (9-11,39).
overexpress APPsw produce about four times One group reported a more timid, more anxious
higher levels of A(cid:69) than APPfl-overexpressing and less exploratory behaviour in these mice D
o
(40). In contrast, we find a complex but w
cells, the situation changes in BACE1 deficient n
cells. In this case, similar amounts of A(cid:69) are significant phenotype in our two independently load
generated from the APPsw and APPfl mutants, gcheanrearcatteerdi zeBdA CbyE 1 inkcnroeacske do unt eostnraatianls , mthoartt alaitrye ed fro
and the amounts generated from these mutants m
affecting up to ~40% of newborn animals. The h
aexrep rselisgshintlgy hgilgiah erc ethllasn. tThohsise pirso dcuocnesdi sbteyn At PwPiwtht surviving mice are healthyand fertile, but display ttp://w
BACE2 being the responsible protease, since it a lower weight. They show also hyperactivity and w
w
has been shown that the Flemishmutation in APP enhanced locomotion in a battery of behavioural .jb
(m8a).r kTehdalty BiAncCreEa2s ecdo nAtr(cid:69)ib uptreosd tuoc Atio(cid:69)n g ebnye rBatAioCnE i2n theasst sn. oTt hbee epnherenpootyrtpeed obfe fBorAe.C WE2e dfienfdic iuenntti l mnoicwe bc.org/
cultured glia cells is also demonstrated by the and under similar breeding conditions as our y gu
fact that in BACE1 deficient glial cells BphAyCsiEo1lo gicsatrl aoinrs ,a nantoom icianl daicbantoiornmsa litioefs . Tahniys est on
significant A(cid:69) generation is observed which is A
is somewhat surprising since BACE2 is p
only reduced to undetectable levels in the ubiquitously expressed in fetal and adult tissues ril 2
combined BACE1/BACE2 deficiency. These (12) and further work is needed to determine , 20
data suggest that BACE2 is expressed in glia 1
more precisely the physiological role of BACE2. 9
cells and might contribute to A(cid:69) production in
The increased neonatal mortality observed in
vivo in these cells.
BACE1/BACE2 double knock out mice
To demonstrate that the A(cid:69) measured in these
compared to BACE1 single deficiency indicates,
experiments was generated by cleavage at the
however, that at least some overlap exists
authentic (cid:69)-secretase site, we made use of the between BACE1 and BACE2 functions. It is
82E1 antibody that specifically recognizes the
unclear at the moment why one group of
neoepitope produced upon BACE cleavage of
BACE1- and double knock out mice die within
APP at the Asp1 position (38). Similar to the
the first weeks after birth while others survive
results described above, BACE1-deficient glia
into adulthood. Possible explanations for this
cells but not neurons continue to generate A(cid:69) diversity include effects of modifier genes, and
detected by 82E1 (figure 6), demonstrating that varying levels of compensatory contributions
the observed cleavage was carried out by a (cid:69)- from other (related) genes. Mortality seems to be
secretase. associated with an environmentally born factor,
Finally, we analysed processing of APPsw in which only in combination with BACE1
fibroblasts derived from BACE deficient mice deficiency triggers death. This probably explains
(figure 5C). Analogous to neuronal cells, there is why other groups did not observe mortality in
compensatory cleavage of APP in BACE1 knock their BACE1-/- strains and is supported by the
9
Dominguezet al., 2005
fact that the BACE1II line only presented currents, BACE might also regulate synaptic
neonatal mortality when the animalswere housed function. Kamenetz et al. (42) recently proposed
in the same facility as the BACE1I line but not in a feedback loop in which the A(cid:69) peptide plays a
the SPF facility where they originally came from prominent role. According to their model, an
(not shown). Since BACE1 is known to cleave increase in neuronal activity induces BACE1,
PSGL-1 and ST6Gal I, both proteins implicated leading to an enhanced production of A(cid:69), which
in immune reactions (31-33), we speculated that in turn depresses excitatory synaptic
the higher mortality rate observed in BACE1 transmission. Thus blockade of BACE1 might be
knock out mice might reflect a deficient immune expected to influence neuronal excitability at
response in a non-pathogen-free environment. both the cellular and neuronal network levels,
The analyses we performed thus far (see result and such alterations might manifest as the subtle
section) failed, however, to reveal any defect of behavioural deficits observed in BACE1
BACE1 knock out mice in their capacity to deficient mice. Again, further work is needed to
mount an efficient immune response. We firmly establish cause-consequence relationships
excluded also the possibility that BACE1 knock in this regard.
out mothers were deficient in milk production or We finally analyzed in detail the role of BACE1
did not care for their pups by performing pup and 2 in APP processing. We confirm that
exchange experiments (figure 1C). Since the BACE1 is the major (cid:69)-secretase in vivo and is
lethality rate did not decrease when the knock out basically the only (cid:69)-secretase that is active in D
o
pups were nursed by wild-type mothersand since w
neurons. Interestingly, cultured glia cells derived n
no lethality was observed when BACE1 deficient lo
from BACE1 knock out mice still secreted in the a
d
mothers nursed wild-type pups, we conclude that conditioned medium measurable amounts of an ed
the lethality problem is linked with BACE1 A(cid:69)(cid:3)like peptide. This peptide is no longer from
ddeisfpiclaieyn cya n in abthneo rmpuapl s. hSyipnecrea cttihvee adbuelhta vmioicuer ddeetmecotnesdt riant iBngA CthEat1 &B2A CdoEu2b lies deexfpicreiesnset dg liina ctheellsse, http://w
(figure 2), it remains an interesting speculation cells and raising the intriguing possibility that w
w
that behavioural alterations in the pups could glia-expressed BACE2 contributes to the total .jb
cboenhtarvibiouutera lt ote sltest haavliatiyla. bTleh eforer naerwe bhoorwn emveicre ntoo ibnr aiDn oAw(cid:69)n ’pso osly. nTdhriosm ceo,u lsdi nbcee p athrteic uBlaArlCyE r2e legveannet bc.org/
evaluate this possibility infurther detail. (like the APP gene) is located on chromosome 21 y g
u
Istu bwuansi trse coefn tlthye s hvoowltna gteh agt aBteAdC Eso1d ciulemav cehs atnhne e(cid:69)ls- (F2l1em). isAh lsoA PsPo meF AmDu tamtiountas tioinn ) APinPc re(aliskee tthhee est on A
(36). The (cid:69)-subunits belong to the p
immomleucnuolegsl ob(uCliAn Msus)p era nfadm ilbye soidfe sc ellt haedirh escieolnl 5aBuBAt hCaenEndt2 i c(d8 e)Ap).e(cid:69)Tn dhpeaentp tt thAide(cid:69)e o pbwespeatrsiv deecd op nprforiodrtmuecientdio bnau ns(fdini ggwu araes ril 2, 201
adhesion function, they play a role in channel 9
highly specific mAb 82E1 (38) that reacts with
gating and cell surface expression of the pore-
the neo-epitope generated by BACE1 cleavage at
forming (cid:68)-subunits (41). Given the prominent
position 1 of the A(cid:69) peptide (figure 6).
expression of BACE1 in the striatum (36), it is
Interestingly, the effects of BACE2 on APP
tempting to speculate that changes in Na+ channel
processing appear to be cell type specific. For
function might contribute to the hyperactive
instance in fibroblast cells, BACE2 appears to
phenotype of BACE1 null mice reported in this
prevent A(cid:69) generation since BACE2 deficient
study. We checked this by performing whole-cell
fibroblasts generate higher levels of A(cid:69)(cid:3)than their
recordings from cortical neurons. We found that
wild-type littermates (figures 5).
the lack of BACE1 was associated with a
In conclusion, the current work addressed the
significant shift of steady-state inactivation of the
important question of the physiological role of
Na+ current towards more depolarized potentials.
BACE1 and BACE2. It is obvious that the
In contrast, the voltage dependence of activation
functions of these two proteases are quite subtle
was not altered. The shift of steady-state
and that the molecular link between the observed
inactivation might be functionally important,
phenotype and BACE1 deficiency remains to be
because it increases the availability of Na+
firmly established. We will now use these mice
channels in the critical voltage range around
for further detailed molecular analysis, hoping
firing threshold. In addition to modulating Na+
10
Description:in addition BACE2 protease activity. In order to . monitored using a Tru-scan system (Coulbourn placed in the center of the activity-field arena,.