Table Of ContentHindawi Publishing Corporation
BioMed Research International
Volume 2015, Article ID 582938, 12 pages
http://dx.doi.org/10.1155/2015/582938
Research Article
Community Structure of Ammonia-Oxidizing
Archaea and Ammonia-Oxidizing Bacteria in Soil Treated with
the Insecticide Imidacloprid
MariuszCycoN1andZofiaPiotrowska-Seget2
1DepartmentandInstituteofMicrobiologyandVirology,SchoolofPharmacywiththeDivisionofLaboratoryMedicine,
MedicalUniversityofSilesia,Jagiellon´ska4,41-200Sosnowiec,Poland
2DepartmentofMicrobiology,UniversityofSilesia,Jagiellon´ska28,40-032Katowice,Poland
CorrespondenceshouldbeaddressedtoMariuszCycon´;[email protected]
Received18August2014;Revised1December2014;Accepted1December2014
AcademicEditor:QaisarMahmood
Copyright©2015M.Cycon´andZ.Piotrowska-Seget. This is an open access article distributed under the Creative Commons
AttributionLicense,whichpermitsunrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalworkis
properlycited.
The purpose of this experiment was to assess the effect of imidacloprid on the community structure of ammonia-oxidizing
archaea(AOA)andammonia-oxidizingbacteria(AOB)insoilusingthedenaturinggradientgelelectrophoresis(DGGE)approach.
AnalysisshowedthatAOAandAOBcommunitymemberswereaffectedbytheinsecticidetreatment.However,thecalculationof
therichness(S)andtheShannon-Wienerindex(H)valuesforsoiltreatedwiththefieldrate(FR)dosageofimidacloprid(1mg/kg
soil)showednochangesinmeasuredindicesfortheAOAandAOBcommunitymembers.Inturn,the10∗FRdosageofinsecticide
(10mg/kgsoil)negativelyaffectedtheAOAcommunity,whichwasconfirmedbythedecreaseoftheSandHvaluesincomparison
withthevaluesobtainedforthecontrolsoil.InthecaseofAOBcommunity,aninitialdeclinefollowedbytheincreaseoftheS
andHvalueswasobtained.Imidaclopriddecreasedthenitrificationratewhiletheammonificationprocesswasstimulatedbythe
additionofimidacloprid.ChangesinthecommunitystructureofAOAandAOBcouldbeduetoanincreaseintheconcentration
+
ofN-NH4 ,knownasthemostimportantfactorwhichdeterminesthecontributionofthesemicroorganismstosoilnitrification.
1.Introduction with the phospholipid fatty acid (PLFA), the denaturing
gradient gel electrophoresis (DGGE), and the community-
Imidacloprid [1-(6-chloro-3-pyridylmethyl)-N-nitro-imida- level physiological profile (CLPP) approaches showed that
zolidin-2-ylideneamine] is a systemic insecticide used to imidacloprid induced significant changes in the composi-
controltheinsectpestsandanimalparasites[1,2].Thisinsec- tion of microbial communities and their metabolic activity.
ticide has a high affinity to the nicotinic acetylcholine Moreover, the DGGE profiles and results of imidacloprid
receptorofinsectsandactsasaneurotoxin[3].Basedonthe degradationstudysuggestedtheevolutionofspecificbacteria
resultsofmanystudies,theEuropeanFoodSafetystatedthat able to degrade this insecticide among autochthonous soil
neonicotinoids pose an unacceptably high risk to bees and microorganisms[8].Withregardtotheimportanceofnitro-
that the industry-sponsored science upon which regulatory genturnoverforsoilquality,presenceofimidaclopridinsoils
agenciesclaimsofsafetyhavereliedmaybeflawed,oreven mayalsoaffectthenontargetmicroorganismsresponsiblefor
deceptive[4]. theseprocesses.Beingoneofthem,nitrificationplaysacen-
Imidaclopridischaracterisedbyahighpersistenceinsoil tralroleintheglobalnitrogencycleoftheenvironmentandit
with half-life up to 229 days, and its behaviour depends on isverysensitivetovariouscontaminantsincludingpesticides.
differentphysicochemicalandbiologicalparameterssuchas As the first and rate-limiting step of nitrification in soil,
organicmatter,pH,temperature,crops,time,andmicrobial oxidation of ammonia to nitrite is catalysed by the ammo-
activity[5–7].Inourpreviousstudy[8],theresultsobtained nia monooxygenase (AMO) [9, 10]. Previously, autotrophic
2 BioMedResearchInternational
Table1:Characteristicsofthesoilusedintheexperiment.
Parameter Value Methodofdetermination Reference
Origin Pszczyna,Poland — —
Sand(2000–50𝜇m)(%) 86.0±2.7 Sedimentationandsievingmethod ISO11277:2009
Silt(<50–2𝜇m)(%) 11.0±2.4 Sedimentationandsievingmethod ISO11277:2009
Clay(<2𝜇m)(%) 3.0±0.5 Sedimentationandsievingmethod ISO11277:2009
Densityg/cm3 1.2±0.2 Coremethod ISO11272:1998
pH (1:5) 6.6±0.3 Measurementwithglasselectrode ISO10390:2005
(inwater)
Cationexchangecapacity(CEC)(cmol+/kg) 12.9±1.7 ModifiedGillmanmethod ISO11260:1994
Waterholdingcapacity(WHC)(%) 32.4±2.8 Gravimetricmethod ISO14239:1997
C (%) 1.0±0.2 OxidationinthepresenceofH SO ISO14235:1998
org 2 4
N (%) 0.09±0.03 ModifiedKjeldahlmethod ISO11261:1995
tot
Microbialbiomass(mg/kgdryweight) 668.0±34.2 Substrate-inducedrespiration(SIR) ISO14240-1:1997
Thevaluesarethemeansofthreereplicateswiththestandarddeviation,whichwaswithin5%ofthemean.
ammonia-oxidizing bacteria (AOB) of beta- and gamma- rate (FR) of imidacloprid and 10 times the FR (10 ∗ FR).
proteobacteria were considered to be the most important Detailedinformationrelatedtotheexperimentaldesignand
contributors to ammonia oxidation. However, the recent treatments is described in our previous study [8]. Samples
developmentofmoleculartechniqueshasledtothediscovery of control and imidacloprid-treated soils were periodically
ofamoAgenesthatencodethealpha-subunitofAMO,which removed (on days 1, 14, 28, and 56) for determination of
raises questions about the role of AOB. Some studies have the genetic biodiversity of AOA and AOB, the number of
recentlyshownthatammonia-oxidizingarchaea(AOA)that nitrifyingbacteria,andthenitrificationrate.
are distributed in soil ecosystems potentially represent the
most important group of ammonia oxidizers [11–13]. The 2.3.DeterminationofNitrateandAmmoniumConcentrations.
populationsizesandcommunitystructureofAOBandAOA Theprocedureofextractionofsoilsamples(10g)with100mL
areshiftinginresponsetotemperature,pH,fertilizerlevels, of 0.1% K2SO4 for 24h followed by the colorimetric assay
altitude,andcontaminantsincludingpesticides[9,10,14,15]. ofnitrateandammoniumconcentrationsinthefiltrateswas
Nevertheless,thereisnoinformationregardingtheinfluence used. The intensity of the yellow colour that resulted from
of imidacloprid on ammonia oxidizers structure in soil. the reaction of nitrates with phenoldisulphonic acid (25%
Therefore, the aim of this study was to assess the impact in conc. H2SO4) was measured, whereas ammonium was
of this insecticide on the genetic biodiversity of AOA and determinedusingtheBerthelotreaction.Theconcentrations
AOB using DGGE method. In addition, the nitrification ofbothionswereestimatedbyreferencetocalibrationcurves
rate and the number of culturable nitrifying bacteria based andtheblankvaluesobtained,andtheresultswereexpressed
on measurement of nitrate concentration and plate count asmgperkilogramofsoil[16].
methods,respectively,wereestimated.
2.4. Enumeration of Nitrifying Bacteria. Soil samples (10g)
2.MaterialsandMethods in 90mL of 0.85% sterile NaCl medium (pH 7.0) were
shaken at 120rpm/min for 30min. The viable counts of
2.1.SoilSampling. Aloamysandsoilcollectedfromthetop nitrifyingbacteriawereenumeratedusingtheagarmedium
∘
layer (A-horizon) to a maximum depth of 20cm of grass- recommendedbyAaronson[17]afterincubationat22 Cfor
covered field located at the area of Pszczyna, Upper Silesia, 10days.Resultswereexpressedasthelogcfu(colonyforming
in southern Poland (49∘5948N, 18∘5514E) was used. unit)pergramofdrysoil.
No plant protection products with imidacloprid or other
pesticideshavebeenusedonthesamplingplace.Basedonthe 2.5. Analysis of AOA and AOB Community Structure by
FAOSoilClassification,collectedsoilwasclassifiedasOrthic PCR-DGGE Method. To extract the total DNA from soil
Luvisol.Forcollectedsoil,physicalandchemicalparameters samples, a GeneMATRIX Soil DNA Purification Kit (Eur ,
x
wereassessed,andtheirvaluesandmethodsofdetermination Poland) was used according to the manufacturer’s instruc-
areshowninTable1. tion. Next, the DNA was subjected to electrophoresis in a
1.0% (w/v) agarose gel followed by its quantification using
2.2. Soil Treatment. Certified standard of imidacloprid thespectrophotometermethod(Biophotometer,Eppendorf).
(99.8%chemicalpurity)waspurchasedfromSigma-Aldrich Archaeal amoA genes were amplified using primers Arch-
(Germany) and used for the contamination of soil. The amoAF and arch-amoAR, while bacterial amoA genes were
performed experiment had a completely randomized block amplified by amoA-1F and amoA-2R (Table2). For PCR
design that included three replications and the following reactions, a mixture that contained 1 × GoTaq Flexi Buffer
treatments: control and two insecticide dosages (1 and (Promega), 2mM MgCl2, 0.2mM dNTP Mix (Promega),
10mg/kgsoil)whichcorrespondedtotherecommendedfield 0.5𝜇Mofeachprimer(Sigma-Aldrich),0.2𝜇gofDNA,and
BioMedResearchInternational 3
Table2:Primersusedformolecularanalysesinthisstudy.
Targets Primers Sequence(5-3) Lengthofamplicon(bp) References
Arch-amoAF STAATGGTCTGGCTTAGACG
AOA 635 [34]
arch-amoAR GCGGCCATCCATCTGTATGT
amoA-1F GGGGTTTCTACTGGTGGT
AOB 491 [35]
amoA-2R CCCCTCKGSAAAGCCTTCTTC
AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria.Forty-basepairGC-clamp,CGCCCGCCGCGCGCGGCGGGCGGGGCGGGG
GCACGGGGGC[36],wasattachedtothe5 endoftheforwardprimers.
1.5U/𝜇LGoTaqDNAPolymerase(Promega)wasused.The analyseswereperformedusingtheStatistica10.0PLsoftware
amplification procedure was performed using a PTC-118 package.
Thermal Cycler (Bio-Rad, CA, USA) under the following
∘
conditions:(i)aninitialdenaturationstepof95 Cfor3min, 3.Results
(ii) 35 cycles of denaturation, annealing, and extension
∘ ∘ ∘ − +
(95 C for 1min followed by 53 C, AOA, or 55 C, AOB, for 3.1.ConcentrationofN-NO andN-NH . Theobtaineddata
3 4
∘
1min, with an extension step at 72 C for 1min), and (iii) revealedthattheapplicationoftheinsecticideimidacloprid
∘
a final extension at 72 C for 7min. After amplification, the had a significant effect on nitrogen transformation in soil.
products in the mixture were purified using a QIAquick Imidaclopridatbothdosagescausedasignificant(𝑃 < 0.05)
−
PCR Purification Kit (Qiagen, USA) as described in the decrease (by 25–65%) in N-NO3 concentrations and this
manufacturer’sinstruction. effectwasobservedthroughoutthewholeincubationperiod
The PCR products were analyzed in an 8% (w/v) poly- (Figure1(a)).Incontrast,bothimidaclopriddosagescauseda
acrylamidegel(37.5:1acrylamide:bisacrylamide)composed significant(𝑃 < 0.05)increaseoftheN-NH4+concentration
ofalineardenaturinggradientrangingfrom30%to55%and in soils over the experimental period. For example, the
from40%to60%forAOAandAOB,respectively.Denaturant concentration of N-NH4+ in the 10 ∗ FR-treated soil was
solutionswerepreparedbymixingtheappropriatevolumes several times higher than in the controlsoil on days 14, 28,
of two (0–100%) denaturant stock solutions (7mol/L urea and 56 (Figure1(b)). The statistical analysis indicated that
and40%v/vformamide).Electrophoresiswasperformedin concentrationsofbothionsweresignificantlyaffectedbythe
a 1 × TAE buffer with a constant voltage of 80V for 17h at treatment(𝑃 < 0.001)andtheincubationtime(𝑃 < 0.001).
∘
60 C using a DCode Mutation Detection System (Bio-Rad, In addition, the interaction between these factors was also
USA).Theobtainedgelswerestainedwithethidiumbromide significant (𝑃 < 0.001). For both ions, the treatment effect
−
(0.5mg/mL) followed by their analysis with Quantity One explainedmostofthevariance(83%forN-NO3 and64%for
+
software (Bio-Rad, USA) to compare the AOA and AOB N-NH4 )(Table3).ValuesofPearson’scorrelationcoefficient
community structures between control and imidacloprid- (𝑟) also indicated that the concentration of N-NO3− was
treated soils. Phylogenic dendrograms that were based on negatively correlated with N-NH4+ (−0.776, 𝑃 < 0.001)
the presence/absence of a band and band weighting (band and 𝐸𝐻-AOA (−0.478, 𝑃 = 0.003) while being positively
density) analyses were constructed by applying the Dice correlatedwiththenumberofculturablenitrifyingbacteria
coefficient and the unweighted pair-group method using (0.866,𝑃<0.001),𝐻-AOA(0.663,𝑃<0.001),𝑆-AOA(0.727,
thearithmeticaverages(UPGMA).Richness(𝑆)valueswere 𝑃 < 0.001), 𝐻-AOB (0.417, 𝑃 = 0.011), and 𝑆-AOB (0.377,
calculated as the number of DNA bands detected in the 𝑃 < 0.023). In contrast, N-NH4+ was negatively correlated
respective line of the DGGE profile, while the Shannon- with the number of culturable nitrifying bacteria, 𝐻-AOA,
Wienerindex(𝐻)andevenness(𝐸𝐻)valueswerecalculated and𝑆-AOA(Table4).
according to the equations 𝐻 = −∑𝑝𝑖(ln𝑝𝑖) and 𝐸𝐻 =
𝐻/𝐻max = 𝐻/ln𝑆, respectively, where 𝑝𝑖 is the ratio 3.2.NumberofCulturableNitrifyingBacteria. Theplatecount
between the specific band intensity and the total intensity resultsshowedthattheapplicationofimidaclopridnegatively
of all bands and 𝑆 is the total number of bands in each affectedthenumberofculturablenitrifyingbacteria.Inthe
sample. case of lower dosage of imidacloprid, this effect lasted up
to 28 days. In contrast, in soil treated with imidacloprid at
2.6.StatisticalAnalyses. Todeterminethepercentageofthe the 10 ∗ FR dosage a negative effect was observed during
variation attributable to the tested factors, that is, treat- thewholeexperimentalperiod,andthenumberofculturable
ment and incubation time, a two-way analysis of variance nitrifying bacteria was significantly (𝑃 < 0.05) lower
(ANOVA)fortheobtainedresultswasapplied.Thestatistical (one or two orders of magnitude) than that in the control
significanceofdifferencesinthedatathatwasmeasuredwas samples(Figure2).TheANOVAshowedthatthenumberof
assessed by a post hoc comparison of the means using the culturablenitrifyingbacteriawassignificantlyaffectedbythe
least significant differences (LSD) test. The obtained results treatment(𝑃 < 0.001)andtheincubationtime(𝑃 < 0.001).
werealsosubjectedtoprincipalcomponentanalysis(PCA). In addition, the interaction between these factors was also
To determine the correlations between measured parame- significant(𝑃 = 0.004).Thetreatmenteffectexplainedmost
ters,Pearson’scorrelationcoefficientwasalsocalculated.All of the variance (74%) whereas the incubation time and the
4 BioMedResearchInternational
45 26
k
24
40 a
a
22 h
35
20
e
−O/kg soil)3 2350 b d f g dg +H/kg soil)4 111468 f j
N 20 N 12 g
mg N– 15 c ce c e mg N– 10 b c e i
( ( 8 a a
d
10 6
4
5
2
0 0
1 14 28 56 1 14 28 56
Day after application Day after application
C C
FR FR
10∗FR 10∗FR
− +
(a) N-NO3 (b) N-NH4
− +
Figure1:Theconcentration(mg/kgsoil)ofN-NO3 (a)andN-NH4 (b)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil;
10∗FR:10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Thedifferentlettersindicatesignificant
differences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime.
6.0 interactionbetweenbothfactorsaccountedforonly10%and
8%ofthevariance,respectively(Table3).ValuesofPearson’s
5.5 d correlationcoefficient(𝑟)alsoindicatedthatthenumberof
5.0 a culturable nitrifying bacteria was positively correlated with
4.5 ag bg 𝐻-AOA(0.717,𝑃<0.001),𝑆-AOA(0.731,𝑃<0.001),𝐻-AOB
bf b g (0.452,𝑃=0.006),and𝑆-AOB(0.436,𝑃=0.008)(Table4).
4.0 f
oil) eh
y s 3.5 h 3.3.CommunityStructureof
dr
g 3.0 c ce Ammonia-OxidizingMicroorganisms
u/
g cf 2.5 3.3.1. Ammonia-Oxidizing Archaea (AOA). The obtained
o
(l 2.0 DGGE patterns showed that both dosages of imidacloprid
caused changes in the structure of the AOA community
1.5
duringtheexperimentalperiod(Figure3(a)).Thedosageof
1.0 insecticidewasthemainfactorthatgroupedthetreatments,
regardlessofthetimeelapsedasindicatedbytheperformed
0.5
cluster analysis (Figure3(b)). Despite the differences in the
0.0
DGGE profiles between the imidacloprid-treated and con-
1 14 28 56 trol soil, the calculation of the Shannon-Wiener index (𝐻)
Day after application (Figure4(a)) and the richness (𝑆) (Figure4(b)) values for
C soil treated with the field rate (FR) dosage of imidacloprid
FR (1mg/kg soil) showed no changes in measured indices for
10∗FR theAOAcommunitymembers.Inturn,the10∗FRdosage
Figure2:Thenumberofnitrifyingbacteria(logcfu/gdrysoil)in of insecticide (10mg/kg soil) negatively affected the AOA
soil treated with imidacloprid (C: control; FR: 1mg/kg soil; 10 ∗ community,whichwasconfirmedbythedecreaseofthe𝐻
FR:10mg/kgsoil).Thedatapresentedarethemeansandstandard and𝑆valuesincomparisonwiththevaluesobtainedforthe
deviations of three replicates. Different letters indicate significant controlsoil(Figures4(a)and4(b)).
differences (𝑃 < 0.05, LSD test), considering the effects of the TheANOVAanalysisrevealedthatthe𝐻indexforAOA
pesticidedosageandtime. wassignificantlyaffectedbythetreatment(𝑃 < 0.001)and
BioMedResearchInternational 5
Table3:Thetwo-wayANOVAanalysisforthemeasuredparameters.
Parameter Sourceofvariation df Sumofsquares Meansquares Varianceexplained(%) 𝐹 𝑃
Concentrationofions
Treatment 2 1908.79 954.40 83 989.3 P<0.001
N-NO − Time 3 158.20 52.73 7 54.6 P<0.001
3
Treatment×time 6 204.12 34.02 9 35.3 P<0.001
Treatment 2 819.2 409.6 64 2275.5 P<0.001
N-NH + Time 3 282.2 94.1 22 522.6 P<0.001
4
Treatment×time 6 13.9 28.9 13 161.1 P<0.001
Treatment 2 15.65 7.83 74 124.7 P<0.001
Numberofnitrifyingbacteria Time 3 2.23 0.74 10 11.8 P<0.001
Treatment×time 6 1.63 0.27 8 4.3 P=0.004
AOA-DGGEanalysis
Treatment 2 0.21 0.11 64 61.2 P<0.001
𝐻 Time 3 0.02 0.01 8 4.8 P=0.009
Treatment×time 6 0.05 0.001 16 5.1 P=0.002
Treatment 2 24.50 12.25 72 73.5 P<0.001
𝑆 Time 3 0.66 0.22 2 1.3 𝑃=0.286
Treatment×time 6 4.83 0.81 14 4.8 P=0.002
Treatment 2 0.002 0.0009 24 7.1 P=0.004
𝐸𝐻 Time 3 0.001 0.0004 15 3.0 𝑃=0.052
Treatment×time 6 0.002 0.0003 20 2.0 𝑃=0.112
AOB-DGGEanalysis
Treatment 2 0.52 0.26 34 214.6 P<0.001
𝐻 Time 3 0.46 0.15 30 126.3 P<0.001
Treatment×time 6 0.53 0.09 35 72.9 P<0.001
Treatment 2 7.72 3.86 28 139.0 P<0.001
𝑆 Time 3 9.42 3.14 34 113.0 P<0.001
Treatment×time 6 9.83 1.63 36 59.0 P<0.001
Treatment 2 0.0012 0.0005 10 2.5 𝑃=0.102
𝐸𝐻 Time 3 0.0009 0.0003 8 1.4 𝑃=0.267
Treatment×time 6 0.0039 0.0007 36 3.1 P=0.023
AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria;𝐻:Shannon-Wienerindex;𝑆:richness;𝐸𝐻:evenness.Theeffectsinboldaresignificant
at𝑃<0.05.
theincubationtime(𝑃 = 0.009).Inaddition,theinteraction DGGEfingerprintsamongbothtreatmentsandcontrolsoil
between these factorswas alsosignificant (𝑃 = 0.002). The (Figure5(a)).Thedosageofinsecticidewasthemainfactor
treatmenteffectexplained64%ofthevariance,whereastime that grouped the treatments, regardless of the time elapsed
accounted for only 8% of the variance. The interactions asindicatedbytheperformedclusteranalysis(Figure5(b)).
betweenthesefactorsexplainedafurther16%(Table3).The Cluster analysis generally showed that imidacloprid dosage
richness value (𝑆) for AOA was also significantly affected was the main factor grouping the treatments, regardless
by the treatment (𝑃 < 0.001) as well as by the interaction of the time elapsed (Figure5(b)). Despite the differences
betweentreatmentandtime(𝑃=0.002).Thetreatmenteffect in the DGGE profiles between the imidacloprid-treated
explained most of the variance (72%) and the interactions and control soil, the calculation of the Shannon-Wiener
between these factors explained a further 14% (Table3). index (𝐻) (Figure6(a)) and the richness (𝑆) (Figure6(b))
The two-way ANOVA also indicated that the incubation values for soil treated with the field rate (FR) dosage of
timeandtheinteractionsbetweentreatmentandtimewere imidacloprid(1mg/kgsoil)showednochangesinmeasured
factors which did not significantly affect the 𝐸𝐻 value for indicesfortheAOBcommunitymembersondays1,14,and
AOA during the experiment. However, the treatment effect 28. In contrast, the values of both indices (𝐻 and 𝑆) were
significantly (𝑃 = 0.004) affected the measured parameter, significantly (𝑃 < 0.005) higher on day 56 in comparison
anditexplainedmostofthevariance(24%)(Table3). with the values obtained for the control soil. In the case of
the10∗FRdosageofinsecticide,aninitialdecline(ondays
3.3.2. Ammonia-Oxidizing Bacteria (AOB). The PCR- 1and14)followedbytheincrease(onday56)ofthe𝑆and𝐻
DGGEprofilesofsoilAOBcommunityunderimidacloprid values was obtained for AOB community(Figures6(a) and
stress also showed that there were significant changes in 6(b)).
6 BioMedResearchInternational
Table4:ValuesofPearson’scorrelationcoefficient(𝑟)forcorrelationamongmeasuredmicrobialparameters.
N-NO3− N-NH4+ Number 𝐻-AOA 𝑆-AOA 𝐸𝐻-AOA 𝐻-AOB 𝑆-AOB 𝐸𝐻-AOB PC1 PC2
−
N-NO 1
3
−0.776
+
N-NH4 P<0.001 1
0.866 −0.633
Number P<0.001 P<0.001 1
0.663 −0.414 0.717
𝐻-AOA P<0.001 P=0.012 P<0.001 1
0.727 −0.488 0.731 0.952
𝑆-AOA P<0.001 P=0.003 P<0.001 P<0.001 1
𝐸𝐻-AOA P−=0.04.70803 P0=.305.0733 P−=0.03.50832 𝑃−=0.204.1452 P−=0.04.90802 1
𝐻-AOB P0=.401.7011 𝑃0=.001.6925 P0=.405.0206 P0<.600.0101 P0<.601.0801 𝑃−=0.03.20454 1
𝑆-AOB P0=.307.0723 𝑃0=.008.6907 P0=.403.0608 P0<.507.0101 P0<.508.0701 𝑃−=0.03.00868 P0<.908.0301 1
𝐸𝐻-AOB 𝑃0=.006.7314 𝑃−=00.1.73120 𝑃0=.003.0861 𝑃0=.008.7614 𝑃=0.101.5505 𝑃−=0.01.34434 𝑃0=.300.0570 𝑃0=.104.7391 1
0.867 −0.577 0.859 0.870 0.929 −0.549 0.727 0.688 0.200
PC1 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 P<0.001 𝑃=0.241 1
−0.379 0.732 −0.266 0.052 0.003 0.104 0.659 0.684 0.193 0.000
PC2 P=0.023 P<0.001 𝑃=0.117 𝑃=0.764 𝑃=0.987 𝑃=0.546 P<0.001 P<0.001 𝑃=0.259 𝑃=1.000 1
AOA:ammonia-oxidizingarchaea;AOB:ammonia-oxidizingbacteria;𝐻:Shannon-Wienerindex;𝑆:richness;𝐸𝐻:evenness.Theeffectsinboldaresignificant
at𝑃<0.05.
Thestatisticalanalysisrevealedthatthe𝐻indexforAOB (Figure7). Analysisofcorrelationamongtested parameters
wassignificantly(𝑃 < 0.001)affectedbythetreatmentand showedthatPC1valuescorrelatedmainlywiththenumberof
the incubation time. In addition, the interaction between culturablenitrifyingbacteriaaswellaswiththebiodiversity
thesefactorswasalsosignificant.Bothfactorsandinteraction ofAOAandAOBcommunitymembers,whereasPC2values
between them explained more or less equal (30%–35%) correlatedmainlywiththebiodiversityofAOB.
variance (Table3). The richness value (𝑆) for AOB was also ImidaclopridnegativelyaffectedtheconcentrationofN-
significantly (𝑃 < 0.001) affected by the treatment and the NO3− in soil, whereas the concentration of N-NH4+ has
timeaswellasbytheinteractionbetweenbothfactors.The increasedduringtheexperimentalperiod.Manyauthorscon-
interaction between considered factors explained most of firmedthatnitrificationprocessismoresensitivetopesticides
the variance (36%). The treatment and the time explained than ammonification. For example, Martinez-Toledo et al.
further24%and34%ofthevariance,respectively(Table3). [18],studyingtheeffectofmethylpyrimifosonsoilmicroflora,
The ANOVA also indicated that the interaction between revealedthatthisinsecticidesignificantlydecreasedthenitri-
treatmentandtimewastheonlyfactorsignificantlyaffecting ficationrateinagriculturalsoil.Similarly,otherinsecticides
the𝐸𝐻valueduringtheexperiment(Table3). (e.g.,diazinon,teflubenzuron,lambda-cyhalothrin,phorate,
carbofuran, and fenvalerate) were found to be the factors
−
4.Discussion responsible for the significant decrease of N-NO3 in soil
[19–22]. This phenomenon observed for the imidacloprid-
The impact of imidacloprid on the structure of ammonia- treatedsoilcanbeexplainedbythefactthatarchaeaand/or
oxidizing microorganisms was assessed via PCR-DGGE. bacteria involved in ammonia oxidizing might be killed
+
Complex fingerprints for both microbial groups (AOA and by the insecticide and the transformation of N-NH4 into
−
AOB) were obtained and multivariate statistical analysis N-NO3 was stopped in the soil. This fact may also be
was used to assess the effects of insecticide and sampling confirmedbytheplatecountdatawhichshowedthedecrease
time on their community structure. The two-way ANOVA of the number of culturable nitrifying bacteria during the
indicatedthatmeasuredparametersweresignificantly(𝑃 < experimental period. It is also a high probability that the
0.05) affected by the treatment and the incubation time, degradationprocessofimidaclopridcouldalsohaveresulted
+
andmoreovertheinteractionbetweenthesefactorswasalso intheproductionofN-NH4 .Moreover,theresultsofsome
significant.Ingeneral,thetreatmenteffectexplainedmostof studieshaveshownthatpesticidesstimulateammonification
thevariance(Table3).Moreover,thePCAclearlyseparated by killing a remaining sensitive part of soil microorgan-
measured parameters especially in 10 ∗ FR-treated and isms that are subjected to mineralisation processes, con-
controlsoilsamples.TheprincipalcomponentsPC1andPC2 sequently increasing the ammonium concentration in soils
accounted for 61.1% and 16% of this variation, respectively [23].
BioMedResearchInternational 7
10∗FR-3 (day 28)
10∗FR-2 (day 28)
10∗FR-3 (day 1)
Day 1 10∗FR-2 (day 1)
C FR 10∗FR 10∗FR-1 (day 1)
1 2 3 1 2 3 1 2 3 10∗FR-3 (day 14)
10∗FR-2 (day 14)
10∗FR-1 (day 14)
10∗FR-1 (day 28)
FR-3 (day 56)
FR-3 (day 28)
FR-2 (day 28)
Day 14 10∗FR-1 (day 56)
C FR 10∗FR 10∗FR-3 (day 56)
1 2 3 1 2 3 1 2 3 10∗FR-2 (day 56)
C-3 (day 14)
C-2 (day 14)
C-1 (day 14)
FR-3 (day 1)
FR-2 (day 1)
FR-1 (day 1)
Day 28 C-2 (day 1)
C FR 10∗FR FR-3 (day 14)
1 2 3 1 2 3 1 2 3 FR-2 (day 14)
FR-1 (day 14)
C-3 (day 1)
C-1 (day 1)
FR-2 (day 56)
FR-1 (day 28)
C-3 (day 28)
Day 56 C-1 (day 28)
C FR 10∗FR FR-1 (day 56)
1 2 3 1 2 3 1 2 3 C-3 (day 56)
C-2 (day 56)
C-1 (day 56)
C-2 (day 28)
0.30 0.25 0.20 0.15 0.10 0.05 0.00
(a) DGGEprofiles (b) Phylogenicdendrogram
Figure3:DGGEprofiles(a)andphylogenicdendrogram(b)forPCR-amplifiedarchaealamoAgeneforsoiltreatedwithimidacloprid(C:
control;FR:1mg/kgsoil;10∗FR:10mg/kgsoil).
The DGGE analysis showed that AOA were more sen- overallrichness(𝑆)andthediversity(𝐻)ofAOAand/orAOB
sitive to imidacloprid than AOB. Moreover, there were community members. Several studies have demonstrated
differences between profiles obtained for the imidacloprid- that the excessive use of pesticides has raised concerns
treated and control soils manifested by the disappearance regardingthetoxiceffectsonnontargetingmicroorganisms.
of some bands (for AOA) or the appearance of several new Increasingevidencehasindicatedthatpesticideschangethe
bands(forAOB),especiallyinsoilsamplestreatedwiththe communitystructureofAOAand/orAOBanddecreasethe
10 ∗ FR dosage. The richness (𝑆) and genetic diversity (𝐻) nitrificationrateinsoil.Forexample,usingDGGE,Lietal.
valuesforAOAweresignificantlylowerincomparisonwith [24] demonstrated that acetochlor had a negative effect on
thevaluesobtainedforthecontrolsoil,whereasforAOBthe AOBdiversityinsoil.PampulhaandOliveira[25]indicated
diversityindiceschangedfromdecreasingattheinitialstage that the presence of bromoxynil and prosulfuron strongly
toincreasingattheendoftheexperimentalperiod,suggest- inhibited the growth of AOB in sandy soil. Gigliotti and
ing that imidacloprid may stimulate the increase of AOB. Allievi[26]describedthatcinosulfuronandbensulfuron,at
The observed phenomenon suggests that sensitive species thenormalfieldapplicationrateandata100-foldhigherrate,
among ammonia-oxidizing microorganisms were replaced decreasedthenitrificationactivityinagriculturalsoil.
by microorganisms characterised by a higher tolerance to Our results also suggest that observed changes in the
this insecticide and/or the ability to degrade imidacloprid. community structure of AOA and AOB could be due to
+
The result of these changes might be the increase of the an increase in the concentration of N-NH4 . In some pre-
numbersofspecificmicroorganismsandthedecreaseinthe vious studies on agricultural soils, long-term N fertilizer
8 BioMedResearchInternational
2.50 12
11
2.25 b d ab a ab a a a
a b a 10 a a a a
e
e e
c
2.00 9 d
c
d d
8
1.75
b
7
1.50 6
1 14 28 56 1 14 28 56
Day after application Day after application
C C
FR FR
10∗FR 10∗FR
(a) Shannon-Wienerindex(𝐻) (b) Richness(𝑆)
1.00
bce e
0.98 c
bce acac
be
c
acd
0.96 a d
a
0.94
0.92
0.90
1 14 28 56
Day after application
C
FR
10∗FR
(c) Evenness(𝐸𝐻)
Figure4:Thediversityindicesforammonia-oxidizingarchaea(AOA)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil;10∗FR:
10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Differentletters(withineachindex)indicate
significantdifferences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime.
BioMedResearchInternational 9
FR-2 (day 28)
FR-3 (day 1)
C-3 (day 1)
C-1 (day 1)
C-2 (day 28)
Day 1 FR-2 (day 14)
C FR 10∗FR FR-1 (day 14)
1 2 3 1 2 3 1 2 3 FR-1 (day 1)
C-2 (day 1)
C-3 (day 56)
C-2 (day 56)
C-1 (day 56)
FR-3 (day 28)
FR-1 (day 28)
Day 14 C FR 10∗FR C-3 (day 28)
1 2 3 1 2 3 1 2 3 C-1 (day 28)
FR-3 (day 14)
C-2 (day 14)
FR-2 (day 1)
C-3 (day 14)
C-1 (day 14)
10∗FR-3 (day 1)
Day 28 10∗FR-2 (day 1)
C FR 10∗FR 10∗FR-1 (day 1)
1 2 3 1 2 3 1 2 3 10∗FR-3 (day 14)
10∗FR-2 (day 14)
10∗FR-1 (day 14)
FR-3 (day 56)
10∗FR-1 (day 28)
10∗FR-3 (day 28)
10∗FR-2 (day 28)
Day 56
C FR 10∗FR 10∗FR-3 (day 56)
10∗FR-2 (day 56)
1 2 3 1 2 3 1 2 3 10∗FR-1 (day 56)
FR-2 (day 56)
FR-1 (day 56)
0.6 0.5 0.4 0.3 0.2 0.1 0.0
(a) DGGEprofiles (b) Phylogenicdendrogram
Figure5:DGGEprofiles(a)andphylogenicdendrogram(b)forPCR-amplifiedbacterialamoAgeneforsoiltreatedwithimidacloprid(C:
control;FR:1mg/kgsoil;10∗FR:10mg/kgsoil).
+
applicationseemedtostimulatethegrowthofAOB[13,27]. have a preference for low N-NH4 concentration in soil
This could be explained by a stimulatory effect of high N- [32].AlthoughthediversityandrichnessofAOBcommunity
NH4+ concentrationontheAOBdiversityandrichness.On memberswerehigherafterapplicationof10∗FRdosageof
the contrary, the diversity and richness indices for AOA imidacloprid,nitrificationratewaslowerincomparisonwith
+ −
(Figure4) showed a declining trend by increasing N-NH4 thecontrolsoilasindicatedbythedecreaseofN-NO3 .These
concentrationduringtheexperimentalperiod(Figure1(b)). results and the simultaneous decrease in the diversity and
Similar results have been reported by Di et al. [28], who richnessofAOAcommunitymembersmayfurthersupport
observedthatAOBandAOAhaddifferentgrowthpatterns hypothesis that AOA rather than AOB control nitrification
under contrasting soil N conditions. In addition, analysis [15].However,someauthorsshowedthatsoilnitrificationwas
of values of Pearson’s correlation coefficient (𝑟) revealed significantlycorrelatedwiththeabundanceofbacterialamoA
significant correlations (𝑃 < 0.05) between the values of genes[30,31].SuchdifferencesincontributionsofAOBand
diversity and richness indices for AOA and AOB and N- AOAmaybeduetodifferentfactors,amongwhichthemost
+ +
NH4 concentration (Table4). These results indicated that importantisprobablytheconcentrationofN-NH4 [15,33].
+
N-NH4 concentration may be the most important factor
determining the contribution of these microorganisms to 5.Conclusions
soilnitrification.Moreover,asfoundindifferentecosystems,
the AOA amoA copy numbers were more abundant than Basedontheobtainedresults,weconcludedthattheappli-
AOB [29–31]. Therefore, our results also provide further cation of imidacloprid changed the structure of ammonia-
evidences to support the hypothesis that AOB growth is oxidizingmicroorganisms.Insecticidesignificantlyincreased
+
favoured by high concentration of N-NH4 , whereas AOA the diversity and richness of AOB but suppressed the
10 BioMedResearchInternational
1.90 7
e e c
1.70 c
ad 6
ac ad cd d d a
a
1.50
a a a a a a a a
5
1.30
4
1.10
b b
b b
3
0.90
0.70 2
1 14 28 56 1 14 28 56
Day after application Day after application
C C
FR FR
10∗FR 10∗FR
(a) Shannon-Wienerindex(𝐻) (b) Richness(𝑆)
1.00
b
c
ac
0.98
bd ac c ace
cde
a e
0.96
a
a
0.94
0.92
0.90
1 14 28 56
Day after application
C
FR
10∗FR
(c) Evenness(𝐸𝐻)
Figure6:Thediversityindicesforammonia-oxidizingbacteria(AOB)insoiltreatedwithimidacloprid(C:control;FR:1mg/kgsoil;10∗FR:
10mg/kgsoil).Thedatapresentedarethemeansandstandarddeviationsofthreereplicates.Differentletters(withineachindex)indicate
significantdifferences(𝑃<0.05,LSDtest),consideringtheeffectsofthepesticidedosageandtime.
Description:1Department and Institute of Microbiology and Virology, School of Pharmacy with Received 18 August 2014; Revised 1 December 2014; Accepted 1 December 2014 .. (e.g., diazinon, teflubenzuron, lambda-cyhalothrin, phorate,.