Antisense sequencing improves the accuracy and precision of A-to-I editing measurements using the peak height ratio method.

0.26 MB·English

by  Rinkevich, Frank D

Rinkevichetal.BMCResearchNotes2012,5:63
http://www.biomedcentral.com/1756-0500/5/63
TECHNICAL NOTE Open Access
Antisense sequencing improves the accuracy and
precision of A-to-I editing measurements using
the peak height ratio method
Frank D Rinkevich1, Peter A Schweitzer2 and Jeffrey G Scott1*
Abstract
Background: A-to-I RNA editing is found in all phyla of animals and contributes to transcript diversity that may
have profound impacts on behavior and physiology. Many transcripts of genes involved in axonal conductance,
synaptic transmission and modulation are the targets of A-to-I RNA editing. There are a number of methods to
measure the extent of A-to-I RNA editing, but they are generally costly and time consuming. One way to
determine the frequency of A-to-I RNA editing is the peak height ratio method, which compares the size of peaks
on electropherograms that represent unedited and edited sites.
Findings: Sequencing of 4 editing sites of the Da6 nicotinic acetylcholine receptor subunit with an antisense
primer (which uses T/C peaks to measure unedited and edited sites, respectively) showed very accurate and
precise measurements of A-to-I RNA editing. The accuracy and precision were excellent for all editing sites,
including those edited with high or low frequencies. The frequency of A-to-I RNA editing was comparable to the
editing frequency as measured by clone counting from the same sample. Sequencing these same sites with the
sense primer (which uses A/G peaks) yielded inaccurate and imprecise measurements.
Conclusions: We have validated and improved the accuracy and precision of the peak height ratio method to
measure the frequency of A-to-I RNA editing, and shown that results are primer specific. Thus, the correct
sequencing primer must be utilized for the most dependable data. When compared to other methods used to
measure the frequency of A-to-I RNA editing, the major benefits of the peak height ratio are that this method is
inexpensive, fast, non-labor intensive and easily adaptable to many laboratory and field settings.
Findings A-to-I RNA editing regulatesbehavior andlife history
A-to-IRNAeditingiscatalyzedbyadenosinedeaminases traitsin many phyla of animals. The widespreadconser-
that act on RNA (ADARs) that bind to double stranded vation of this pathway is thought to be a viral defense
pre-mRNAs and convert adenosine (A) to inosine (I) mechanism [3,4]. A-to-I RNA editing occurs in protein
which is recognized by the ribosome as a guanosine [1]. coding and non-coding sequences, transposable ele-
ADARsarefoundinallanimals,butareabsentfrompro- ments,introns,5’and3’untranslated regionsofthepre-
tists,plantsandfungi[2].TherearethreeADARgenesin mRNA that may result in changes in the amino acid
vertebrates. ADAR1 and ADAR2 both have catalytic sequences,splicesitesorlevelsoftranscripts[4,5].RNA
activity, whereas ADAR3 lacks activity, although the editing frequently results in non-synonymous substitu-
functional domains of ADAR3 are conserved. ADAR3 is tionsthatcan becriticallyimportantforproperfunction
likelyisaduplicateofADAR2.AsingleADARgeneexists or tissue distribution. For example, RNA editing results
ininsects.DrosophilamelanogasterdAdarishomologous inaQ/Raminoacidsubstitutionintheporeloopdomain
tovertebrateADAR2[2]. of the AMPA receptor GluR-B subunit that makes the
channel impermeable to Ca2+. Unedited GluR-B tran-
scripts lead to neuronal death that causes seizures and
*Correspondence:[e-mail]
1DepartmentofEntomology,ComstockHall,CornellUniversity,Ithaca,NY prematuredeathineditingdeficientmice[6].
14853,USA
Fulllistofauthorinformationisavailableattheendofthearticle
©2012Rinkevichetal;BioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons
AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin
anymedium,providedtheoriginalworkisproperlycited.
Rinkevichetal.BMCResearchNotes2012,5:63 Page2of6
http://www.biomedcentral.com/1756-0500/5/63
The transcripts of many ligand-gated or voltage-sensi- Table 1Sequences ofthe primers used
tive ion channels and G-protein coupled receptors are PrimerName Sequence
targets of A-to-I RNA editing [4,7-9]. Genome wide stu- Da6ORF-F CACGCGATACAAACAAGCCAAGGACA
dies in D. melanogaster have shown wide-spread editing Da6ORF-R ACGATTATGTGCGGAGCGGAGAG
of these genes [9]. RNA editing of these genes is most
DmelActinF ACTCCGGCGATGGTGTCTCC
common in regions that code for functionally important
DmelActinR GGGCGGTGATCTCCTTCTGC
amino acids in the protein. In voltage-gated K+, Na+
T7 TAATACGACTCACTATAGGG
and Ca2+ channels, residues involved in channel gating
SP6 TATTTAGGTGACACTATAG
or inactivation are edited. Editing sites on nAChR or Da6R CCAGGGCAGCCATTGTAGGAAAAC
GABA receptor subunits occur in crucial areas in the Da6IR2 GCAGCAGGCGTAGACTATCGTATT
ligand-binding domain and TM2 that forms the channel Da6285F AACGGAATACGGCGGGGTCAAG
pore [9-12]. Da6ORF-F3 GCGCCTGCTGAACCATCTGC
There are a number of dAdar transcripts produced Da6ORF-R3 ACCACCGACGAGGGCGACCAT
and dAdar expression is important for a number of
functions in the fruit fly. Four common transcripts of
dAdar result from alternative splicing and these tran-
scripts are themselves subject to RNA editing [13]. D. C or A/G electropherograms peaks, respectively, to indi-
melanogaster dAdar null mutants show significant defi- cate unedited and edited sites. The heights of the peaks
ciencies in motor control and mating that grow progres- at each editing site from the electropherogram were
sively worse with age. Nervous system morphology is measured using Photoshop Creative Suite 4 (Adobe Sys-
greatly affected by dAdar null mutants [14]. Behavioral tems Inc, San Jose CA) and the ratio of the peak heights
deficits were also seen in D. melanogaster that had was compared to the expected heights [17]. The reliabil-
reduced dAdar expression. These mutants did not fly, ity of the peak height ratio method was validated by
exhibited diurnal activity patterns and displayed tem- comparing the frequency of editing determined from
perature sensitive paralysis [15]. Males deficient in sequencing individual clones from the same sample. A
dAdar took longer to engage in courtship behaviors and more detailed description of the methods used is found
had a dramatically altered courtship song [16]. in the Additional File 1.
There are a variety of methods for measuring the
extent of A-to-I RNA editing [17,18] and these are Determination of editing with Da6IR2
important for the burgeoning study of A-to-I RNA edit- Determination of Da6 editing at four sites was very
ing (since 2007, there have been more than 1080 journal accurate and precise when sequenced with Da6IR2 (Fig-
articles, book chapters and meeting presentations on A- ure 1A), and observed values never varied from the
to-I RNA editing). However, current methods to mea- expected values by more than 3% (Table 2). The slope
sure the extent of RNA editing tend to be costly, time of the line from a plot of observed vs. expected editing
consuming and use radioactive materials or generate (for each site) was not significantly different from 1.0
hazardous waste. Using the Da6 nicotinic acetylcholine and the r2 values were 1.0 (Table 3). Therefore, the
receptor subunit, we demonstrate a detailed and observed frequency of editing is in high agreement with
improved method for a highly accurate and precise esti- the expected frequency of editing at all sites.
mate of the frequency of editing using peak height ratios
from Sanger sequencing electropherograms and com- Determination of editing with Da6285F
pare its costs and benefits to other methods for measur- Determination of Da6 editing estimates was unreliable
ing RNA editing frequency. (inaccurate and imprecise) when sequenced with
Da6285F at all four editing sites (Figure 1B, Table 2).
Methods summary The observed frequency of editing was significantly dif-
We used the peak height ratio method to estimate the ferent than expected in 17 of 28 comparisons and varied
level of A-to-I RNA editing at 4 sites of the Da6 nicoti- by as much as 23% (Table 2). In all, 20 estimates were
nic acetylcholine receptor subunit cDNA from the Can- significantly different from the expected editing rate by
ton-S strain of Drosophila melanogaster. Da6 clones more than 5%. The slope of the line from a plot of
that were unedited or edited at four sites were mixed in observed values of editing vs. those expected was signifi-
different proportions by weight to produce varying levels cantly different from 1.0 for three of the four editing
of A-to-I RNA editing. Two primers, (Da6IR2 and sites and the r2 value was less than 1.0 in 3 of the 4
Da6285F, Table 1) were used for sequencing. Da6IR2 cases (Table 3). This indicates use of the sense Da6285F
was an antisense primer and Da6285F is a sense primer. primer is not a reliable method for determining the fre-
The Da6IR2 and Da6285F primers yielded a mix of T/ quency of editing.
Rinkevichetal.BMCResearchNotes2012,5:63 Page3of6
http://www.biomedcentral.com/1756-0500/5/63
Figure 1 Electropherograms of a sample containing a 1:1 mixture of clones that are edited and unedited. Electropherograms
representing1:1ratiosofeditedanduneditedtranscriptssequencedwithA)Da6IR2(antisense)orB)Da6285F(sense)primers.Numbersabove
peaksindicateeditingsitesbasedonthenucleotidenumberingoftheopenreadingframeofDa6.NotethatDa6IR2isanantisenseprimerso
thesequenceofA-to-Ieditingsitesisinreverse.AntisensesequencingwithDa6IR2generateseditingsitesasamixofC/Tsignals,whereas
sensesequencingwithDa6285FgenerateseditingsitesasamixofA/Gsignals.
Table 2EstimatesofA-to-I RNA editingfrequency between Da6IR2and Da6285Fsequencing primers
EditingSite
SequencingPrimer ExpectedEditingRate 398 400 415 416
Da6IR2 0.95 0.94±0.02 0.96±0.01 0.92±0.03 0.92±0.03
0.90 0.88±0.01* 0.90±0.01 0.87±0.00* 0.88±0.01
0.75 0.76±0.01 0.74±0.01 0.75±0.02 0.76±0.01
0.50 0.51±0.01* 0.50±0.03 0.50±0.02 0.52±0.01*
0.25 0.25±0.03 0.24±0.02 0.23±0.01 0.25±0.02
0.10 0.11±0.03 0.09±0.01 0.09±0.02 0.09±0.03
0.05 0.07±0.03 0.07±0.02 0.08±0.05 0.07±0.05
Da6285F 0.95 0.85±0.12 0.88±0.17 0.97±0.03 0.97±0.02
0.90 0.86±0.05 0.86±0.05 0.95±0.01* 0.93±0.00*
0.75 0.66±0.04* 0.79±0.04 0.84±0.03* 0.81±0.03*
0.50 0.38±0.02* 0.58±0.02* 0.67±0.01* 0.60±0.05*
0.25 0.19±0.03* 0.33±0.04* 0.43±0.04* 0.39±0.13
0.10 0.06±0.03 0.17±0.02* 0.33±0.06* 0.23±0.10*
0.05 0.04±0.02 0.13±0.04 0.25±0.04* 0.23±0.06*
Valuesrepresentthemean±standarddeviation.Valueswithanasteriskindicateestimatededitingfrequencyisdifferentfromtheexpectededitingrate(one-
samplet-testvs.expectedmean,p<0.05)
Rinkevichetal.BMCResearchNotes2012,5:63 Page4of6
http://www.biomedcentral.com/1756-0500/5/63
Table 3Comparison ofthe reliability ofestimating A-to-I and edited sites appeared as a mix of T/C signals,
RNA editing oftheDa6subunit usingthe peak height respectively. In contrast, results with Da6285F showed
ratiomethod between Da6IR2andDa6285F primers at unedited and edited sites as A or G, respectively (Figure
different rates ofexpectedediting 1B, Table 2). Therefore, it is imperative that the proper
EditingSite primer (Da6IR2 in this case) be used to accurately esti-
Seq.Primer 398 400 415 416 mate the frequency of A-to-I RNA editing.
Da6IR2 0.98±0.03 1.00±0.03 0.97±0.05 0.97±0.05 The disparity in editing estimation between primers
(1.00) (1.00) (1.00) (1.00) may be a consequence of the sequencing chemistry
Da6285F 0.94±0.10 0.88±0.10* 0.80±0.07* 0.85±0.04* commonly used for dye-terminator cycle sequencing
(0.99) (0.99) (0.99) (1.00)
prior to analysis on automated, capillary DNA analyzers.
Valuesaretheslopesandassociatedconfidenceintervalsofeditingestimate Current nucleotide formulations substitute dITP for
vs.expectedvalues.Numbersinparenthesesindicatether2value.Slopeswith
dGTP to prevent compression of poly-G tracts in the
*indicatevaluesthataresignificantlydifferentthan1.0(i.e.,95%CIdoesnot
include1.0) resulting electropherogram. However, the incorporation
of dITP is less efficient than dGTP [19].
Validation of the peak height ratio method using a Table 4 shows a comparison of the time, labor and
known sample financial costs of the peak height ratio method with
The frequency ofediting at 4siteswas determinedfor a existing protocols. The financial cost savings are the
sample of Canton-S cDNA by examining the sequences most significant and noteworthy advantage of the peak
ofindividualclonesdeterminedwiththeDa6IR2primer. height ratio method. Other major benefits (which can
This sample was then evaluated using the peak height result in additional savings) of the peak height ratio
ratiomethod.Comparisonofthesemethodsshowedthey method are that nearby editing sites can be evaluated
wereincloseagreementandwerenotsignificantlydiffer- simultaneously (Table 4), requires only 6 steps to gener-
ent at any editing site. This agreement wasobserved for ate data from a sample (every other method requires
sites that had either a low (398 and 400) or high fre- more steps, all of which can introduce data variation
quencyofediting(415and416,Figure2). and experimental failure), is relatively fast, and can be
carried out with equipment normally available in most
Method comparison labs (only a centrifuge and a thermocycler are needed).
We have validated and verified a very accurate, precise, Besides these savings of time and money, there are
fast and cost-effective method for estimating editing many other technical advantages of using peak height
rates. The accuracy and precision of the editing esti- ratios over other methods. RNA editing may introduce
mates were primer specific (Figures 1 and 2, Tables 2 or eliminate a restriction enzyme site. Poisoned primer
and 3). Results with primer Da6IR2 were excellent, extension utilizes ddGTP as a reaction terminator in
while those with primer Da6285F were much less reli- edited transcripts. A larger band will result from une-
able (Figure 1). When sequenced with Da6IR2, unedited dited transcripts because dATP would be incorporated
into the product. These methods utilize fluorescent or
phosphoimaging systems for quantification.
0.9 The major drawbacks to poisoned primer extension
Peak Height
Frequency 00..78 Clone Counting aqnudanrteifsitcraictitoionnodfiagessitnsglaereedthitaintgthseitye,otnhlyeyalulosewrfaodriotlhae-
Relative Editing 000...456 bwdiehgleaestdtlowarbitofhlrurioanrdteieosncisseoinvtotelp.yeTlsahabenedhleidpgohpisrcoiomnsetedrospf,ratihmnederraeersxettresinoctsmiiooenn-
0.3 is mainly due to the high cost of fluorescent dyes and
0.2 32P. These two protocols are cost effective only when
larger numbers of replications can be performed in a
0.1
short period of time. In the case of restriction enzyme
0.0
398 400 415 416 digestion, the edited site may alter a restriction enzyme
Editing Site
recognition sequence for which an inexpensive or widely
Figure2Comparisonofpeakheightratioandclonecounting
used restriction enzyme may not be readily available. In
methods.Comparisonofeditingestimatesbetweenthepeak
the case of adjacent or nearby editing sites, multiple
heightratiomethodandclonecountingatfoureditingsitesof
Da6.Thereisnodifferenceintheeditingproportionofsamples enzymes would be needed to be used to account for
usingthepeakheightratiomethodorclonecounting.Theediting recognition site variation. Complications may arise in
sitenumbersrepresentthebaseoftheopenreadingframeofDa6 cases when a restriction enzyme is not available to
thatisedited.
recognize the change in recognition sequence.
Rinkevichetal.BMCResearchNotes2012,5:63 Page5of6
http://www.biomedcentral.com/1756-0500/5/63
Table 4Comparison ofmethods used to measure A-to-IRNA editing
Method #Steps Days Cost/ Cost/ Relative Sites/
Sample 3Analysesa Cost Analysis
PeakHeightRatio 6(RNAisolation,RT,PCR,PCRpurification,sequencing,analysis) 3 $11.87 $35.62 1 Several
PoisonedPrimer 7(RNAisolation,RT,primerlabeling,PCR,gel,imaging,analysis) 1-2 $120.63Fb $133.24Fb 15.0Fb One
Extension $123.4032P $157.8432P 17.732P
RestrictionDigest 9(RNAisolation,RT,PCR,purification,REdigestion,purification,gel, 2 $10.37Fb $31.10Fb 3.50Fb One
imaging,analysis) $123.4032P $135.7032P 15.232P
UltraHigh 9(RNAisolation,RT,PCR(×2),purification(×2),hybridization,sequencing, 21- $1609.80 $4829.39 136 Oneto
Throughput analysis) 28 Severalc
Sequencing
CloneCounting 10(RNAisolation,RT,PCR,PCRpurification,cloning,transformation, 6 $24.48 $561.25 15.8 Several
colonyscreening,colonygrowth,plasmidpurification,sequencing,
analysis)
a=Cost/3Analysesissimplynotthree-foldtheCost/Repasprimerscanbelabeledandusedinmultiplesamplesonasingledayofexperiments
b=Fluorescentassay
c=theabilitytoreadseveraleditingsitesisdeterminedbyproximityofeditingsites
CostsarebasedonusingthematerialslistedinAdditionalFile1.AdditionalcostswerebasedonpGEM-TCloningSystemII,PureYieldPlasmidPurification
System(Promega),restrictionenzymes(PshAIandHpyCH4V,NewEnglandBiolabs),KinaseMaxKit,AlexaFluor488andNucAway(Invitrogen).DataforUltraHigh
ThroughputSequencingisbasedonAbbasetal.,2010andconsistsofasinglelane86bpsingle-endreadonaGenomeAnalyzer.Thecost/sampleisthecostof
performingasingleexperimentfromonebiologicalsample.Thecost/3analysesisthecostforthreereplicatesfromonebiologicalsample.Relativecostisfor
assessingthefoureditingsitesofDa6reportedherein.Thepriceofshipping,primers,gels,standardmarkers,imagingequipment,software,andlaborwerenot
includedinthecost
A major limitation of the poisoned primer extension UHTS is that many editing sites on many transcripts of
method is that is can only assess one editing site at a many genes can be evaluated.
time. In order to obtain the same amount of data across Clone counting can be performed to quantify the fre-
four editing sites as used in this experiment, four unique quency of editing. While there are many advantages to
reactions would need to be run on each sample. This this method, the major drawback is that a large number
would require extensive sample planning and manage- of clones need to be sequenced to ensure an accurate
ment. Also, using sense primers to assess editing at reflection of editing frequency. This process may take a
adjacent editing sites would be particularly troublesome, few days to complete and the cost of sequencing a large
as in the case of editing sites 415 and 416 of the Da6 number of clones may be substantial. Screening colonies
nAChR subunit used in this experiment. Two sense pri- for positive inserts usually requires screening many
mers would have to be utilized to account for tran- more colonies than will actually go for sequencing. The
scripts with edited and unedited versions at site 415 in waste generated by growing colonies on plates and in
order to accurately assess editing at site 416 as mis- liquid media needs to properly disposal by autoclaving
matches at the 3’ end of primer with template can lead or incinerating at an approved facility.
to reduced amplification efficiency. Conversely, an anti- The peak height ratio method with the antisense pri-
sense primer could be used to assess editing at site 416 mer utilizes the different intensities in the T/C signal of
without regard for editing status at site 415. However, eletropherograms. The disadvantage of this method is
this would require the use of ddCTP as the reaction ter- that it does not allow for the identification of which
minator. The cost to measure the same 4 editing sites of editing sites are edited on each transcript. However, the
Da6 by poisoned primer extension would be 15 to 17 cost, labor, turnaround time is unequivocal. The peak
fold higher than by the peak height method (Table 4). height ratio method is very advantageous in that there
Ultra high throughput sequencing (UHTS) is extre- are few steps required to complete an analysis from bio-
mely cost prohibitive and better suited for experiments logical sample to data point.
that may not require comparing many biological sam-
ples. Next generation UHTS is the most accurate Applications of this method
method to measure the frequency of RNA editing. It The technical efficiency of the peak height ratio method
can even detect rare transcripts that are missed by clone makes it an ideal method for demonstrating the extent
counting methods [18]. The major disadvantages are of A-to-I RNA editing in high school and introductory
cost and the short reads generated may only be useful biology classes, or in research laboratories as a signifi-
for multiple editing sites that are nearby if the user cant cost reduction method. Additionally, a mobile lab
needs to know what sites are edited on a specific tran- unit could be assembled for rapid sample processing in
script. However, the undeniable major advantage of the field and other remote areas. The RNA extraction,
Rinkevichetal.BMCResearchNotes2012,5:63 Page6of6
http://www.biomedcentral.com/1756-0500/5/63
reverse transcription and PCR could be done in the field Competinginterests
and processed samples could be mailed to a sequencing Theauthorsdeclarethattheyhavenocompetinginterests.
facility. Processing field collected animals would help
Received:22September2011 Accepted:24January2012
overcome potential changes in allele frequency that may Published:24January2012
result from genetic drift if they were returned to a lab
and reared for a second generation. This would also References
1. NishikuraK:FunctionsandregulationofRNAeditingbyADAR
reduce the risk of sample degradation and shipping deaminases.AnnuRevBiochem2010,79:321-349.
nucleic acids across international borders is typically 2. JinY,ZhangW,LiQ:OriginsandevolutionofADAR-mediatedRNA
less burdensome than shipping organisms or tissues. editing.IUBMBLife2009,61(6):572-578.
3. BassBL,WeintraubH:Anunwindingactivitythatcovalentlymodifiesits
The peak height method could also be used to esti- double-strandedRNAsubstrate.Cell1988,55(6):1089-1098.
mate allele frequencies within populations. Using pools 4. BassBL:RNAeditingbyadenosinedeaminasesthatactonRNA.AnnRev
of animals, it is possible to simultaneously evaluate allele Biochem2002,71:817-846.
5. FukuiT,ItohM:RNAeditinginPtransposableelementread-through
frequencies from as many as 10 diploid or 20 haploid transcriptsinDrosophilamelanogaster.Genetica2010,138:1119-1126.
individuals based on the upper (0.95) and lower (0.05) 6. HiguchiM,MaasS,SingleFN,HartnerJ,RozovA,BurnashevN,
detection rates that we used in this analysis. This would FeldmeyerD,SprengelR,SeeburgPH:PointmutationinanAMPA
recepetorgenerescueslethalityinmicedeficientintheRNA-editing
allow for the detection of a single allele out of 20 poten- enzymeADAR2.Nature2000,406:78-81.
tial alleles. It is likely that this method could be vali- 7. O’ConnellMA:RNAediting:rewritingreceptors.CurrBiol1997,7:
dated for even lower detection rates. This method R437-R439.
8. PaulMS,BassBL:InosineexistsinmRNAattissue-specificlevelsandis
would be extremely valuable in our lab for evaluating mostabundantinbrainmRNA.EMBOJ1998,17(4):1120-1127.
the frequency of insecticide resistance alleles from field 9. HoopengardnerB,BhallaT,StaberD,ReenanR:Nervoussystemtargetsof
collected populations. RNAeditingidentifiedbycomparativegenomics.Science2003,
301:832-836.
10. JonesAK,BuckinghamSD,PapadakiM,YokotaM,SattelleBM,MatsudaK,
Conclusions SattelleDB:Splice-variantandstage-specificRNAeditingofthe
The accuracy and precision of the estimate of A-to-I DrosophilaGABAreceptormodulatesagonistpotency.JNeurosci2009,
29:4287-4292.
RNA editing using the peak height ratio method with
11. YaoX,SongF,ZhangY,ShaoY,LiJ,LiuZ:Nicotinicacetylcholine
sequences of Da6 from the antisense Da6IR2 primer is receptorbeta-1subunitfromthebrownplanthopper,Nilaparvata
in very good agreement with expected values and is lugens:A-to-IRNAeditinganditspossiblerolesinneonicotinoid
sensitivity.InsectBiochemMolBiol2009,39:348-354.
comparable to the quantitative clone counting method.
12. SongW,LiuZ,TanJ,NomuraY,DongK:RNAeditinggeneratestissue-
It is also very cost effective and fast compared to other specificsodiumchannelswithdistinctgatingproperties.JBiolChem
current methods, especially when evaluating editing at 2004,279(31):32554-32561.
13. PalladinoMJ,KeeganLP,O’ConnellMA,ReenanRA:dADAR,aDrosophila
multiple sites. Because of these many advantages, it is
double-strandedRNA-specificadenosinedeaminaseishighly
likely that this method will prove to be a powerful and developmentallyregulatedandisitselfatargetforRNAediting.RNA
useful tool in evaluating the extent of A-to-I RNA edit- 2000,6:1004-1018.
14. PalladinoMJ,KeeganLP,O’ConnellMA,ReenanRA:A-to-Ipre-mRNA
ing in this rapidly growing field of study, and has other
editinginDrosophilaisprimarilyinvolvedinadultnervoussystem
uses in other fields (such as population genetics) as well. functionandintegrity.Cell2000,102:437-449.
15. JepsonJEC,ReenanRA:Adenosine-to-inosinegeneticrecodingis
requiredintheadultstagenervoussystemforcoordinatedbehaviorin
Additional material Drosophila.JBiolChem2009,284(45):31391-31400.
16. JepsonJ,SavyaY,YokoseC,SugdenA,SahinA,ReenanR:Engineered
alterationsinRNAeditingmodulatecomplexbehaviorinDrosophila:
Additionalfile1:DetailedMethods.
RegulatorydiversityofadenosinedeaminaseactingonRNA(ADAR)
targets.JBiolChem2010,286(10):8325-8337.
17. JepsonJEC,ReenanRA:Geneticapproachestostudyingadenosine-to-
inosineRNAediting.MethEnzymol2007,424:265-287.
Acknowledgements 18. AbbasAI,UrbanDJ,JensenNH,FarrellMS,KroezeWK,MieczkowskiP,
ThisstudywasfundedbyDowAgrosciences(FDRandJGS)withno WangZ,RothBL:AssessingserotoninreceptormRNAeditingfrequency
competinginterests. byanovelultrahigh-throughputsequencingmethod.NuclAcidsRes
2010,38(10):e118.
Authordetails 19. InnisMA,MyamboKB,GelfandDH,BrowMA:DNAsequencingwith
1DepartmentofEntomology,ComstockHall,CornellUniversity,Ithaca,NY ThermusaquaticusDNApolymeraseanddirectsequencingof
14853,USA.2InstituteforBiotechnologyandLifeScienceTechnologies, polymerasechainreaction-amplifiedDNA.PNAS1988,85:9436-9440.
BiotechnologyHall,CornellUniversity,Ithaca,NY14853,USA.
doi:10.1186/1756-0500-5-63
Authors’contributions Citethisarticleas:Rinkevichetal.:Antisensesequencingimprovesthe
FDRandJGSdesignedtheexperimentsandwrotethemanuscript.FDR accuracyandprecisionofA-to-Ieditingmeasurementsusingthepeak
performedalllaboratoryworkanddataanalysis.PASprovidedtechnical heightratiomethod.BMCResearchNotes20125:63.
commentaryandanalysisofsequencingmethodology.Allauthorsapproved
ofthefinalmanuscript.