1 Cell Cycle Dependent Chromatin Loading of the Fanconi Anemia Core Complex by FANCM ...

29 Pages·2008·1.61 MB·English

From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
Blood First Edition Paper, prepublished online January 3, 2008; DOI 10.1182/blood-2007-09-113092

Cell Cycle Dependent Chromatin Loading of the Fanconi Anemia Core Complex by
FANCM/FAAP24

Jung Min Kim1, Younghoon Kee1, Allan Gurtan1, and Alan D. D’Andrea1*

1Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School,
Boston, MA 02115, USA

*Corresponding Author: Alan D. D’Andrea, MD
Dana-Farber Cancer Institute
Department of Radiation Oncology
Division of Genomic Stability and DNA Repair
Harvard Medical School
44 Binney Street
Boston, MA 02115, USA
Phone: [phone]
Fax: [phone]
E-mail: [e-mail]

Running Title: FANCM recruits FA core complex

Keywords: Cell Cycle/Chromatin/FANCM/Fanconi Anemia/Helicase

1
Copyright © 2008 American Society of Hematology
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
ABSTRACT

Fanconi anemia (FA) is a genetic disease characterized by congenital abnormalities, bone
marrow failure, and cancer susceptibility. Thirteen FA proteins are involved in regulating
genome surveillance and chromosomal stability. The FA core complex, consisting of eight FA
proteins (A/B/C/E/F/G/L/M), is essential for the monoubiquitination of FANCD2 and FANCI.
FANCM is a human ortholog of the archaeal DNA repair protein Hef, and it contains a DEAH
helicase and a nuclease domain. Here, we examined the effect of FANCM expression on the
integrity and localization of the FA core complex. FANCM was exclusively localized to
chromatin fractions and underwent cell cycle dependent phosphorylation and dephosphorylation.
FANCM-depleted HeLa cells had an intact FA core complex but were defective in chromatin
localization of the complex. Moreover, depletion of the FANCM binding partner, FAAP24,
disrupted the chromatin association of FANCM and destabilized FANCM, leading to defective
recruitment of the FA core complex to chromatin. Our results suggest that FANCM is an anchor
required for recruitment of the FA core complex to chromatin, and that the FANCM/FAAP24
interaction is essential for this chromatin loading activity. Dysregulated loading of the FA core
complex accounts, at least in part, for the characteristic cellular and developmental abnormalities
in FA.
2
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
INTRODUCTION

The thirteen identified Fanconi Anemia (FA) proteins cooperate in a common cellular
pathway regulating the cellular response to DNA crosslinking agents, such as cisplatin (CDDP),
diepoxybutane (DEB), and mitomycin C (MMC) 1. Eight of the FA proteins (A, B, C, E, F, G,
L, M) are assembled into a core complex 2,3 which contains a ubiquitin E3 ligase activity
(FANCL subunit) 4 and a DNA translocase activity (FANCM) 5. In response to DNA damage, or
during S phase progression, the FA core complex coordinately monoubiquitinates two
downstream substrates, FANCD2 6; 7 and FANCI 8 9,10. These monoubiquitinated proteins
subsequently translocate to the chromatin where they are believed to interact with additional
downstream FA proteins, including FANCJ/BRIP1 11-13, FANCD1/BRCA2 14, and
FANCN/PALB2 15 16. These downstream proteins then regulate homologous recombination
(HR) repair. Disruption of any of the proteins in the FA pathway accounts for the common
cellular and clinical phenotype of FA patients 17. How the pathway participates in the process of
DNA crosslink repair remains unknown 18. Some FA complementation groups also exhibit
additional phenotypic variation, suggesting that some FA genes have functions outside a simple
linear FA pathway 19-22.
The FA core complex may have additional functions beyond the monoubiquitination of
FANCD2 and FANCI 8. A FANCD2-Ub linear fusion protein complements the MMC
hypersensitivity of Fancd2-deficient chicken cells but fails to correct the phenotype of FA core
complex deficient cells 23. The FA core complex may therefore have additional activities, such
as the recognition of specific DNA substrates, the regulation of the DNA replication machinery,
and/or the monoubiquitination of additional (unknown) substrates. These additional functions
3
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
may be explained, at least in part, by the presence of FA core subcomplexes with variable sizes
and variable subcellular distributions 3.
When a replication fork encounters an interstrand DNA crosslink during replication, the
replication fork arrests near the lesion, resulting in aberrant DNA structures. These abnormal
structures activate checkpoint and repair pathways. FA cells, carrying mutations in FA genes,
are highly sensitive to DNA crosslinking agents, compared with other DNA damaging agents,
such as IR, UV and HU. This hypersensitivity suggests that some components of the FA core
complex may be involved in detecting and binding the DNA lesions caused by treatment of DNA
crosslinking agents.
The recently identified FANCM 5 and FANCJ 11,12 13 proteins suggest a direct
involvement of FA proteins at sites of DNA repair. FANCM is homologous to the archaeal
protein Hef (helicase-associated endonuclease for fork-structured DNA), and is a member of the
XP-F superfamily 24. The N-terminal region of FANCM is able to bind to single-stranded DNA
25. Moreover, FANCM has a DNA-dependent ATPase activity, and it can dissociate DNA triple
helices in vitro 5,25. FANCJ/BRIP1, which is thought to play a role downstream in the FA
pathway, is a 5’-to 3’ DNA helicase with substrate specificity towards specific DNA duplexes
(Y-shaped DNA). Also, in support of a role for FA proteins in the processing of DNA structures,
a recent study demonstrated that recombinant FANCD2 has direct DNA binding activity in vitro
26. Ciccia et al. 27 reported that recombinant FANCM is directed to branched DNA structures by
a novel FA core complex member, FAAP24. Consistent with these studies, some branched DNA
structures activate FANCD2 monoubiquitination in vitro 28. Deficiency of either FANCM or
FAAP24, but not FANCJ, inhibits FANCD2 monoubiquitination. These results suggest that the
4
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
DNA binding affinity of the FANCM/FAAP24 complex may regulate the ubiquitin ligase
activity or the localization of the FA core complex.
Here, we show that FANCM recruits the FA core complex to chromatin but is not
essential for the assembly of the FA core subunits. Cells depleted of FANCM by siRNA, or cells
in which both FANCM alleles are mutated, are defective in the chromatin association of the FA
core complex. In addition, we found that the interaction of the FANCM with FAAP24 is required
for their stable association in chromatin.

MATERIALS AND METHODS

Cell culture
HeLa cells were maintained in DMEM medium with 15% fetal calf serum (FCS). EUFA867
(FANCM deficient lymphoblasts) and GM02254A.L (wild type lymphoblasts) were maintained
in RPMI-1640 medium with 15% FCS. For generation of FLAG-FANCL HeLa cell lines,
pMMP-puro-Flag-FANCL construct was used for the retrovirus production.

Cell synchronization
For synchronization of cells in G1/S phase, HeLa cells were incubated with 2.5 mM thymidine
for 18 h twice with an intervening 10 h of incubation of without thymidine 29. For
synchronization of cells in M phase, HeLa cells were incubated with 2.5 mM thymidine for 20 h,
and then incubated for 12 h with 200 ng/ml nocodazole without thymidine. The cell cycle
synchronization was confirmed by flow cytometry after propidium iodide staining.

Cell Extraction and Fractionation
5
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
For whole cell extracts, cell pellets were directly lysed with SDS-sample buffer. For biochemical
cell fractionation, cells were first lysed with 0.1 % Triton X-100 CSK buffers (10 mM PIPES
pH6.8, 100 mM NaCl, 300 mM sucrose, MgCl2, 1mM EGTA, 1 mM EDTA, 1mM PMSF, 1
µg/ml leupeptin, 1 µg/ml aprotinin, 50 mM NaF, 0.1mM NaVO4 and 0.1 % TritonX-100) for 5
min on ice. After centrifugation (1500 g for 5 min), the supernatant was labeled “S”. The pellet
was washed once more with the same buffer and labeled “P”.

Antibodies
Rabbit anti-FANCM was kindly provided by Dr. Weidong Wang 5, anti-FAAP24 was kindly
provided by Dr. Steve West 27. Rabbit anti-FANCA, FANCG, FANCE were described
previously 30. Affinity-purified FANCG was generated for IF studies. Other reagents used in
this study were as follows; anti-FANCJ (Novus), anti-FANCD2, monoclonal anti-FLAG M2,
M2-Agrarose beads and α-tubulin (Santacruz), CHK1-p345 (Cell Signaling), MUS81 and
MCM3 (Bethyl laboratories), RPA70 (EMD), Histone H3 (upstate), Orc2 (Pharmingen).
In addition, a new anti-FANCM antibody was raised against amino acids 1190-1273 of
FANCM. This polypeptide fused to maltose binding protein was expressed in Escherichia Coli
and purified as instructed in manufacture’s protocol (New England Biolabs), prior to antibody
generation in New Zealand white rabbits.

Immunoprecipitation
Whole cells were lysed with 0.5 % TX-300mCSK containing 300 mM NaCl for 30 min on ice.
After centrifugation (12.000 rpm for 20 min), the supernatant was diluted to 150 mM NaCl
before immunoprecipitation. Cell extracts were incubated with 15 µl anti-FLAG M2 agarose
6
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
overnight at 4°C on a rocker, washed three times with 0.1% TX-150mCSK buffer. The
precipitates were analysed on 3-8% Tris-Acetate SDS-PAGE (Invitrogen).

siRNAs transfection
siRNA were synthesized by Qiagen. The target sequences of LacZ, FANCM, FAAP24-1,
FAAP24-2, FANCA, and UBE2T are aacgtacgcggaatacttcga, aagctcataaagctctcggaa,
attttcgaggatggcttgaca, tgcattctttatgtcaccgaa, cagcgttgagatatcaaagat, and gatctaagttgcctaccttga,
respectively. Control siRNA is designed and provided by Qiagen.
MMC survival assay
HeLa cells transfected with siRNAs were seeded in duplicate in 96-well microplates at a density
of 400 cells/well in appropriate medium. MMC was added at a final concentration of 0 to 200
nM. Cells were then incubated at 37°C in a 5% CO incubator for 5 days, and cell survival was
2
then determined by staining nucleic acids with a proprietary dye (CyQUANT; Molecular Probes)
and subsequently analyzed by a fluorescence microplate reader according to the manufacturer's
protocol. Alternatively, HeLa cells were transfected with the indicated siRNAs for 48 h, and
then exposed to the indicated concentration of MMC for 5 days. Viable cells were counted by
trypan blue exclusion.

Immunofluorescence staining
HeLa cells were transfected with siRNAs for 48 hr before seeding into 4-well culture slide at a
density of 20000 cells per well. Cells were preextracted with PBS containing 0.3 % Triton X-100
for 2 min and then fixed with 3.7 % paraformaldehyde for 10 min on ice. After blocking with
5% goat serum/0.1% NP-40/PBS, the cells were incubated with the affinity purified rabbit
7
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
polyclonal anti-FANCG antibody (1:400 dilution) overnight at 4oC. The Alexa Fluor 488 goat
anti-rabbit IgG (Molecular Probes) was used as a secondary antibody at 1:500 dilution.

Phosphatase treatment
Cell extracts were incubated with 400 units of λ phosphatase at 30°C for 40 min and then
analyzed by western blotting.

RESULTS

FANCM localizes to chromatin and is phosphorylated following DNA damage
To examine the cellular localization of FANCM, cells were lysed in a low salt (100 mM
NaCl) and detergent-containing buffer, yielding a soluble fraction (S) and an insoluble pellet (P)
(Figure 1A). The (S) fraction contained cytoplasmic and nucleoplasmic proteins, and the (P)
fraction contained proteins stably bound to nuclear structure (e.g., chromatin and nuclear matrix
proteins). FANCM was exclusively detected in the (P) fractions, and cellular localization did not
change following DNA damage with MMC or replication block with hydroxyurea (HU) (Figure
1B). MMC and HU activated phosphorylation of the chromatin bound FANCM, consistent with
previous studies 5. Monoubiquitinated FANCD2 was found primarily in the P fraction, as
previously described 31, and FANCA was found in both fractions.
The (P) fraction was further extracted with 1% Triton or 250 mM NaCl (Figure 1C).
FANCM was insoluble in 1% Triton (lane 5-8), whereas more than 70% of FANCM was soluble
in 250 mM NaCl (lane 9-12). After MMC treatment, highly phosphorylated FANCM remained
in the pellet after 250 mM NaCl extraction. The FANCM mobility shifts were abolished by
treatment with lambda phosphatase (Figure 1D, compare lanes 9-12). These results imply that
8
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
FANCM stably associates with chromatin and that MMC activates the phosphorylation of
FANCM, thus increasing its binding affinity for chromatin.

Phosphorylation of FANCM is dynamically regulated during the cell cycle
To detect possible changes in the association of FANCM with chromatin during the cell
cycle (Figure 2A), HeLa cells were synchronized at G1/S boundary by double thymidine block
(lanes 1-7) or in M phase by nocodazole treatment (lanes 8-12). Cells were collected at the
indicated time points and fractionated prior to immunoblotting. All FANCM was found in (P)
fractions (chromatin fractions) and no significant changes in FANCM levels were detected
during the cell cycle. Monoubiquitinated FANCD2 was found in the (P) fractions during S
phase, consistent with previous studies 31. FANCG levels were found in (S) and (P) fractions
throughout the cell cycle, although the levels in the chromatin fraction were decreased in mitosis
(lanes 8-12), consistent with previous studies indicating that the FA core complex is excluded
from condensed mitotic chromosmes 32.
Mobility shifts of FANCM were observed throughout the cell cycle, and these mobility
shifts were removed with lambda phosphatase (Supplementary Figure 1). These results suggest
that all or most of the post translational modification of FANCM resulted from phosphorylation.
We cannot rule out the possibility of other post-translational modifications (i.e., acetylations,
methylations) which may not significantly alter the electrophoretic mobility of FANCM.
FANCM was moderately phosphorylated during S phase (lanes 2-6), extensively phosphorylated
during mitosis (lanes 7-10), and dephosphorylated after mitotic exit (lanes 11-12). FANCM
phosphorylation reached maximum levels during mitosis when FANCD2 monoubiquitination
was not detectable and when FANCG levels in chromatin were decreased. These results suggest
9
From www.bloodjournal.org by guest on January 1, 2019. For personal use only.
that hyperphosphorylation of FANCM may negatively regulate the E3 ubiquitin ligase activity of
the FA core complex in mitotic cells.

Chromatin localization of FA core complex is regulated in a cell cycle-dependent manner
To investigate the function of FANCM phosphorylation during cell cycle, we examined
the assembly of the FA core complex in HeLa cells in either M phase or S phase (Figure 2B-D).
For these studies, we used HeLa cells stably expressing an epitope tagged Flag-FANCL protein.
Cells were fractionated into S100 and S300 fractions (Figure 2B), and FA proteins were
analyzed. FA core complex protein levels did not vary during cell cycle. Flag FANCL
coimmunoprecipitated with FANCM, FANCG, and FANCA in S phase cells (lanes 5-8);
however, in mitotic cells (lanes 9-12), FANCM remained chromatin bound while FANCG and
FANCA still coimmunoprecipitated from the soluble fraction (Figure 2C). To examine the
dynamic changes in the interaction between FANCM and remaining FA core proteins during cell
cycle, cells were collected at various times after release from G1/S arrest (Figure 2D). At G1/S
(lane 1-4), late S (lanes 13-16) and G2/M (lanes 17-20) phases, an interaction among the
FANCM-FANCA-FANCG-FANCL proteins was detected in the soluble fractions. In contrast,
in early S (lanes 5-8) and mid-S (lanes 9-12) phases, the interaction was preferentially detected
in the insoluble fraction. Taken together, these results confirm that the intact FA core complex is
present throughout the cell cycle but is released from the chromatin-bound FANCM protein in
mitosis.

FANCM is required for chromatin association of the FA core complex
10