Yeasts Acquire Resistance Secondary to Antifungal Drug Treatment by Adaptive Mutagenesis

13 Pages·2012·3.48 MB·English

Yeasts Acquire Resistance Secondary to Antifungal Drug
Treatment by Adaptive Mutagenesis
David Quinto-Alemany1, Ana Canerina-Amaro1, Luı´s G. Herna´ndez-Abad1, Fe´lix Machı´n1,
Floyd E. Romesberg2, Cristina Gil-Lamaignere1*
1UnidaddeInvestigacio´n.HospitalUniversitarioNuestraSen˜oradeCandelaria,SantaCruzdeTenerife,Spain,2ChemistryDepartment,TheScrippsResearchInstitute,La
Jolla,California,UnitedStatesofAmerica
Abstract
Acquisition of resistance secondary to treatment both by microorganisms and by tumor cells is a major public health
concern.Severalspeciesofbacteriaacquireresistancetovariousantibioticsthroughstress-inducedresponsesthathavean
adaptive mutagenesis effect. So far, adaptive mutagenesis in yeast has only been described when the stress is nutrient
deprivation.Here,wehypothesizedthatadaptivemutagenesisinyeast(SaccharomycescerevisiaeandCandidaalbicansas
model organisms) would also take place in response to antifungal agents (5-fluorocytosine or flucytosine, 5-FC, and
caspofungin, CSP), giving rise to resistance secondary to treatment with these agents. We have developed a clinically
relevantmodelwherebothyeastsacquireresistancewhenexposedtotheseagents.Stressfullifestyleassociatedmutation
(SLAM)experimentsshowthattheadaptivemutationfrequenciesare20(S.cerevisiae–5-FC),600(C.albicans–5-FC)or1000
(S.cerevisiae–CSP)foldhigherthanthespontaneousmutationfrequency,theexperimentaldataforC.albicans–5-FCbeing
inagreementwiththeclinicaldataofacquisitionofresistancesecondarytotreatment.ThespectrumofmutationsintheS.
cerevisiae–5-FCmodeldiffersbetweenspontaneousandacquired,indicatingthatthemolecularmechanismsthatgenerate
them are different. Remarkably, in the acquired mutations, an ectopic intrachromosomal recombination with an 87%
homologousgenetakesplacewithahighfrequency.Inconclusion,wepresenthereaclinicallyrelevantadaptivemutation
modelthatfulfils the conditionsreportedpreviously.
Citation:Quinto-AlemanyD,Canerina-AmaroA,Herna´ndez-AbadLG,Mach´ınF,RomesbergFE,etal.(2012)YeastsAcquireResistanceSecondarytoAntifungal
DrugTreatmentbyAdaptiveMutagenesis.PLoSONE7(7):e42279.doi:10.1371/journal.pone.0042279
Editor:JoySturtevant,LouisianaStateUniversity,UnitedStatesofAmerica
ReceivedApril11,2012;AcceptedJuly2,2012;PublishedJuly31,2012
Copyright:(cid:2)2012Quinto-Alemanyetal.Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense,whichpermits
unrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalauthorandsourcearecredited.
Funding:CGLwassupportedbytheSpanishMinistryofScienceandInnovationthroughaMEC/Fulbrightpostdoctoralgrant(EX2004–1241),the‘‘Ramo´ny
Cajal’’tenuretrackprograms(RYC07/1263toCGLandRYC05/1354toFM)andbytheResearchProjectFundingbytheInstitutodeSaludCarlosIII(FISPI08/1624
toCGLandFISPI09/00106toFM).Allfinancialsupportwasco-financedbytheEuropeanRegionalDevelopmentFunds(ERDF).Thefundershadnoroleinstudy
design,datacollectionandanalysis,decisiontopublish,orpreparationofthemanuscript.
CompetingInterests:Theauthorshavedeclaredthatnocompetinginterestsexist.
*E-mail:[email protected]
Introduction agents5-fluorocytosine(flucytosine,5-FC)andcaspofungin(CSP).
We selected 5-FC because of the very high occurrence of
Acquisition of resistance secondary to treatment both by secondary resistance in patients that creates the need for its
microorganisms and by tumor cells is a major public health administration in combination with another drug (typically
concern.Thisresistancecanhaveametabolic(eg.overexpression amphotericin B or fluconazole) [7,8], and CSP because of its
of efflux pumps) or genetic origin (through mutations). Several relevance as oneofthenewest antifungal agents.
species of bacteria acquire resistance to various antibiotics (e.g. InS.cerevisiae,cellularuptakeof5-FCreliesonapurine-cytosine
rifamycins, trimethoprim and b-lactams [1–4]) through stressful permease encoded by FCY2. Once inside the cell, 5-FC is
lifestyle-associated mutations (SLAM, [5]) using stress-induced convertedto5-fluorouracil(5-FU)throughtheactionofacytosine
responses (eg. SOS, RpoS, etc) that have an adaptive mutagenic deaminase,encodedbyFCY1.Theuracilphosphoribosyltransfer-
effect. ‘‘Adaptive mutagenesis’’ has been defined as ‘‘a generic ase (UPRTase) encoded by FUR1 then converts 5-FU into 5-
term for processes that allow individual cells of nonprolifer- fluorouridine-59-monophosphate(5-FUMP),whichisthenfurther
ating cell populations to acquire advantageous mutations and phosphorylatedbykinasestoyieldtheuracildi-andtriphosphate
thereby to overcome the strong selective pressure of analogs, 5-fluorouridine diphosphate (5-FUDP) and triphosphate
proliferation limiting environmental conditions’’ i.e. adapt to the (5-FUTP). 5-FUTP is incorporated into fungal RNA in place of
environment [6]. uridylicacid,alteringtheaminoacylationoftRNA,disturbingthe
Very little is known about the mechanisms that yeasts use to aminoacid pool and inhibiting protein synthesis [8,9]. Alterna-
adapt to environmental stress. So far, adaptive mutagenesis in tively, 5-FUDP may be converted to 5-fluorodeoxyuridine
yeast has only been described when the stress is nutrient diphosphate (5-FdUDP) through the action of RNR. 5-FdUMP
deprivation (for a review, see [6]). The aim of this work was to inhibits DNA synthesis through the inhibition of thymidylate
develop a broader adaptive mutation model with clinical synthase (encoded by CDC21). Resistance to 5-FC has been
relevance. We used Saccharomyces cerevisiae and Candida albicans as proposed to occur through mutations in the afore-mentioned
model organisms, and as environmental stress the antifungal genes,FCY2,FCY1,FUR1,CDC21,oreventhrough mutations
PLoSONE | www.plosone.org 1 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
that lead to the up-regulation of the pyrimidine synthesis [8,10]. Reagents
Nevertheless,since5-FCinterfereswithDNAandRNAsynthesis Caspofungin acetate was purchased from Merck Sharp &
[8]andonemightarguethatithasamutageniceffectperse(albeit Dohme Ltd., UK, 5-Fluorocytosine from Alfa Aesar GmbH,
notdescribedintheliterature),wehavevalidatedourresultswith Germany, Taq DNA polymerase kit from VWR, Denmark, low
adrugthathasacompletelydifferentmodeofaction,CSP.Thisis meltingagaroseforCHEFfromPromegaCorp,Madison,WIand
an echinocandin that inhibits cell-wall synthesis (by non-compet- agarose D1 low EEO from Pronadisa, Spain. Sequencing was
itive inhibition of the b(1–3) glucane sythase) and does not performed usingBig Dye 3.1(Applied Biosystems, Foster City).
penetratethecellmembrane,andthuswouldnotdirectlyinterfere
withnucleotidemetabolism[10].Mutationsinthecodingsubunits Minimum Inhibitory Concentration
oftheb(1–3)glucanesythase,FKS1andFKS2,havebeenshown
Theminimuminhibitoryconcentration(MIC)ofdrugsinsolid
to cause resistance in patient-derived strains. In this work we
SC media was determined by pouring 1 ml SC medium
describe howtheacquisitionof resistance secondary totreatment
containing several dilutions of either 5-FC or CSP on each well
with either drug takes place invitro and we show how this ofa24-wellplate.For5-FC,1.7?104cellswereinoculatedoneach
acquisition fulfills the previously described requirements for an
well (to have the same cell density on the agar surface as
adaptive mutagenesis model inyeasts [6]. 5?105cells on 90mm petri dishes, used in SLAM experiments
describedbelow).ForCSP,1.7?105cellswereinoculatedoneach
Materials and Methods well(samecelldensityas5?106cellson90mmpetridishes).After
48and72hours,growthonthesurfaceoftheagarwasevaluated.
Yeast Strains and Media
The MIC was determined as the smallest drug concentration
StrainsusedinthisstudyareS.cerevisiaeBY4741andC.albicans
where the cells formed less than 3 colonies on the surface
SC5314. S. cerevisiae and C. albicans were grown at 30 or 37uC
(spontaneous resistant cells).
respectively,inYPDmedium(1%yeastextract,2%peptone,2%
dextrose)orsyntheticcompletemedium(SC;0.67%yeastnitrogen
Determination of Adaptive Mutation Frequencies: SLAM
base, 2% glucose) supplemented with aminoacids as described in
Experiments
Burke,etal.[11].Solidmediacontained2%agar.5-FC-resistant
mutants(5-FCr)wereselectedonSCcontaining100mg/ml5-FC. Stressful-lifestyle-associatedmutation(SLAM)experimentswere
CSP-resistant mutants (CSPr) were selected on SC containing performed as follows: Individual colonies (originally descended
0.72 mg/ml CSP. fromasinglecell)weresuspendedinYPDandincubatedat30uC
(S.cerevisiae)or37uC(C.albicans)toobtaindifferentsubpopulations.
Whentheseculturesreachedadensityofapproximately108cells/
ml the cell concentration was adjusted to 5?106 (5-FC) or 5?107
(CSP) cells/ml with 0.9% sterile NaCl solution. Each subpopula-
Table1. Primersused foramplification andsequencing of tionwasthenplatedon2solidSCmediumplateswithantifungal
the genescausing 5-FC resistance. drugatadensityof5?105(5-FC)or5?106(CSP)cellsper90-mm-
diameter dish. A moisturized chamber at either temperature was
used to avoid desiccation of the plates. Only those cells already
Name Oligosequence Annealing(6C) harboring mutations that confer resistance at the time of plating
wereabletocontinueproliferationandformcoloniesonthedrug
Geneamplificationprimersandconditions containingmediumrightafterplating.Basedonthegrowthofthe
Fcy2_f ATGGAACGGCCTCAAGGAACT 57 5-FCrstrainsfcy1Dandfcy2D,visiblecoloniesofresistantmutants
Fcy2_r TGATACATGACGTGAAATGTGC 57 are visible within 24–60h. Following the appearance of colonies
FCY1_af GTTTTCTATTGCCATTTTTATCG 55 formed by the pre-existing mutants (i.e. after the first 3 days of
selection for drug resistance), additional resistant mutants contin-
FCY1_ar ACCTGAACACCGACGAAGAC 55
ued to appear during prolonged incubation of the plates. These
Fur1_af GAGGAACCGATTGGCAGAGC 59
newlyarisingcolonieswerescoredbidailyfor9 dayspostplating.
Fur1_ar TCAAGATGGTGTTCGGGTGTG 59 The number of viable cells during the course of the experiment
CDC21_af GCTTCTTTCCCCTCTCGTC 57 was determined by excising identical pieces of surface (plugs) on
CDC21_ar TCTTTTTGCCCTGGTGTTCC 57 drug-containing SCplates. Cells fromtheagar plugs were plated
Genesequencingprimersandconditions at an appropriate dilution on YPD plates, and colony forming
units were counted after 5 days to ensure that any living cell
Fcy2_F0 GCATATAAAACATCCTATCC 50
present would form a visible colony. To calculate spontaneous
Fcy2_F1 TTTGGGTGCCTTAGGAC 50
mutation frequencies (referred to as ‘‘day 3’’), colonies appeared
Fcy2_F2 AAGGTGGTGAATGGGTAG 50 on or before day 3 were divided by the number of viable cells
Fcy2_R1 CCCAACCGACACAAGC 50 counted 3 hours post-exposure, providing the cells ample time to
Fcy2_R2 TAGGAACCAGGATAGCAT 50 finishwhatevercycletheyhadstartedduringYPDincubationand
Fcy2_R3 GAAATGTGCACGGGGAAATGA 50 toincorporate5-FCintothecellandstartitsaction.Tocalculate
adaptivemutationfrequenciesthenumberofmutantcolonieswas
FCY1_ars TTTCAAGTCTTCCCTAGTAGTG 50
normalized by the number of viable cells present on the plate
FCY1_sf TAGTGACCTATGGTGTG 50
when the mutation took place (two days before). Therefore, the
Fur1_sf AAGCTGCCTCAAAAGAG 50 numberofmutantcoloniesvisibleondays5,7or9wasdividedby
CDC21_sf AGTATCAAGGAGAGAGC 50 thenumberofviablecellsondays3,5or7.Frequenciespresented
CDC21_sr TTTCTCCTCGTGCTGTC 50 are cumulative starting on day 5 as customary in the pertinent
literature.
doi:10.1371/journal.pone.0042279.t001
PLoSONE | www.plosone.org 2 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
Figure2.KineticsofacquisitionofresistancebyS.cerevisiaeto
5-FC. Kinetics of the acquisition of resistance by S. cerevisiae during
prolonged incubation on medium containing 100mg/ml 5-FC. Cells
(5?105)wereusedtoinoculate5-FCsupplementedSCagarmediumand
SLAM experiments performed as described in the Methods section.
Mean and standard error for 29 independent subpopulations. *
indicates p,0.001 as evaluated by ANOVA with Bonferroni post-hoc
test.
doi:10.1371/journal.pone.0042279.g002
Reconstruction Experiments
To verify the mutational origin of the late-arising colonies as
opposedtoametabolicorigin,1925-FCrS.cerevisiaeand965-FCr
C. albicans colonies arising at days 5 or later were subcultured on
SC+5-FCplates,theninliquidYPDandthenagainonSC+5-FC
plates.In98%ofthecases,thecoloniesgrewwithin48–60hours.
NinetysixCSPrS.cerevisiaecoloniesarisingatday5orlaterwere
Figure 1. Effect of various concentrations of 5-FC in S. subculturedonSC+CSPplates,theninliquidYPDandthenagain
cerevisiae. Behaviourof S. cerevisiae duringprolonged incubation on
onSC+CSPplates.In97%ofthecases,thecoloniesgrewwithin
media containing 50mg/ml (circles), 75mg/ml (squares), 100mg/ml
48–60hours.
(triangles)or200mg/ml(cross)5-FC.(A)KineticsoftheappearanceofS.
cerevisiae resistant to 5-FC. Cells (5?105) were used to inoculate 5-FC
supplemented SC agar medium. Plates were incubated in a moisture Sequence Analysis
chamber at 30uC and scored bidaily for the appearance of 5-FCr Genomic DNA of randomly chosen late 5-FCr colonies was
colonies.Thefrequencyof5-FCrcellswascalculatedasthenumberof
prepared using glass beads, followed by phenol-chloroform-
drugresistantcoloniesobservedeachdayforagivenclonedividedby
isoamyloalcoholandethanolprecipitation.Fragmentsencompass-
the number of cells present on the plates two days earlier (moment
when one cell mutated and began giving rise to the visible colony ing the complete genes were amplified and sequenced in-house
counted). (B) 5-FC leads to some cell death in a concentration using an ABI 3500 Genetic Analyzer (applied Biosystems, Foster
dependent manner. Viable colony forming units were determined by City). Table 1shows a listof primers andconditions used.
recovering cells from 5-FC-containing plates and replating on
permissivemedium.Survivalisshownrelativetothenumberofviable
Cell Cycle Analysis by FACS
cellspresent3hoursafterplatingon5-FC(asexplainedintheMethods
section) and is the mean and standard error for 5 independent Flow cytometry analysis was carried out as described before
subpopulations. [13]. Briefly, for each time point, resistant colonies were excised
doi:10.1371/journal.pone.0042279.g001 from one 90mm diameter plate and the remaining non-resistant
cellswerewashedoffwith70%EtOHandstoredat4uCfor1to
According to the Luria-Delbruck model [12], if the cells 15days. After RNase and proteinase K treatment, they were
acquire a spontaneous mutation when growing in the liquid stained with 50mg/ml propidium iodide (Sigma-Aldrich Chemie
medium before being plated on stressful conditions, a mutation Gmbh,Germany)inaBDFACScaliburflowcytometer,adjusting
acquired early in the liquid culture will possibly take place, thepeaksfor1Nand2Nwithanasynchronouscultureat30uC
leading to an abnormal amount of colonies (Jackpot). Subpop- before reading thesamples.
ulations that displayed a jackpot on day 3 were removed from
the experiments because they provide a fortuitous deviation of Microscopic Analysis
the mean and due to the methodological problem posed, since Time-lapsemicroscopyexperimentswereperformedtoevaluate
an excessive number of resistant colonies on the agar surface theeffectof5-FConcellmorphology.Fortheseexperiments,one
prevent us from extracting resistant-cell free plugs to calculate 5-FCr (used as control for normal growth) and 2 WT subpopu-
the number of viable cells. lations were plated on SC+5-FC medium as in SLAM assays, a
263 cm slice was cut out and placed on a glass slide. After
PLoSONE | www.plosone.org 3 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
microscopic examination of 7 fields (enough to count 300–
500cellsattime0),theslideswerekeptinamoisturechamberat
30uC for 12days. Exactly the same fields were examined at
specifiedtimestoobservecelldivision.Toevaluatethepercentage
of cells that initiated cytokinesis (assessed as budding), 182cells
from 3 different fields at 3 hours post-exposure were followed
through time. The percentage was calculated as the number of
cells that initiated bud formation x100/182within7 days.
To examine nuclear division of the same subpopulations, for
each time point, all the 5-FCr colonies were excised from one
90mmdiameterplateandtheremainingnon-resistantcellswere
washedoffwithsterileH O,collectedandkeptat224uC.Onthe
2
day of the experiment, cells were thawed, stained with 1 mg/ml
DAPI (Sigma-Aldrich Chemie Gmbh, Germany) and examined
under fluorescence. For optimal visualization and presentation of
the data, the fluorescent field was colored in a gradient yellow –
red – black frombrightesttoward darkest lightintensities.
CHEF by Pulse-field gel Electrophoresis (PFGE)
PFGE to see all yeast chromosomes was performed using a
CHEFDR-IIIsystem(Bio-Rad)ina1%agarosegelin0.56TBE
buffer and run at 14uC for 24h at 6 V/cm with an initial
switchingtimeof60seconds,afinalof120seconds,andanangle
of120u.Ethidiumbromidewasusedtovisualizethechromosome
bandsin thegel.
Statistical Analysis
Mean and Standard Error of the Mean were calculated using
the statistics package Instat V 3.10 by GraphPad Software, Inc.
The significance of the differences between mutants emerged by
day3(spontaneous)andthoseemergedlater(Pvalues,two-tailed
95% confidence value) were calculated using ANOVA with
Bonferroni post-hoc test.
Results
Prolonged Exposure to 5-FC Increases the Mutation
Frequency in S. Cerevisiae
We examined the behavior of 5 S. cerevisiae subpopulations
during exposure to various concentrations of 5-FC through time
(Fig. 1). S. cerevisiae colonies resistant to 5-FC (Fig. 1a) appeared
after long-term incubation on drug-supplemented SC medium
within a concentration window (e.g. too low, all cells survive; too
high, invariably lethal, fig. 1b). The lowest concentration that
inhibited growth (MIC) was 25mg/ml, while the lowest concen-
tration that was invariably lethal (MLC) was 400mg/ml (16 fold
the MIC). Thus, we selected 4 fold the MIC for the subsequent
experiments.
Next,weevaluatedthekineticsoftheacquisitionofresistanceto
5-FC through time (Fig. 2). As expected, a few resistant colonies
grew within1 to3 days (pre-existing or spontaneous), most likely
due to spontaneous mutations that took place while growing on
drug-free liquid medium. This occurred at a spontaneous
mutation frequency of 3?102663.9?1027 mutants/cell. In these
Figure3.AnalysisofgrosschromosomalrearrangementsinS.
cerevisiaeresistant to 5-FC by pulse-field gel electrophoresis. 6SLAMexperiments,comprising29subpopulations, wefounda
CHEFofthechromosomesofawild-type(WT)and4ofthesecondary5- jackpot onlyonce (seemethods section).
FCrstrains.Theblackarrowindicatestheonlyrearrangementfound,an ProlongedexposureofS.cerevisiaetofourfold5-FCMICresulted
apparentdeletionin chromosomeIVconcomitantwitha newdiffuse in the appearance of resistant colonies that continued to
bandoflowmolecularweight(greyarrow).Runconditions:1%agarose
accumulate for longer than 16days after initial exposure to the
gelin0.56TBEbufferandrunat14uCfor24hat6V/cmwithaninitial
drug (long-term or acquired resistant). Experiments were termi-
switchingtimeof60seconds,afinalof120seconds,andanangleof
120u. nated at day 9, when they reached a final frequency of
doi:10.1371/journal.pone.0042279.g003 6.9?102569.8?1026 mutants/cell. Thesetwofrequencies (sponta-
neous vs. adaptive) were significantly different (p,0.001), reflect-
PLoSONE | www.plosone.org 4 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
Table2. Effect of5-FCon the spectrumofmutations infourgenes thatmay beinvolvedin drug resistance.
Day Gene Mutation Type Effect Day Gene Mutation Type Effect
2 FCY1 190GCRAT (V233RK) TI M 7 FCY2 410CGRTA (A136RV) TI M
2 FCY1 107GCRAT (C205RSTOP) TI N 7 FCY2 843GCRAT (W281RSTOP) TI N
2 FCY1 179CGRAT (T229RK) TV M 7 FCY2 1594GCRCG (G532RR) TV M
2 FCY1 58CGRAT (E189RSTOP) TV N 7 FCY2 410CGRAT (A137RE) TV M
2 FCY1 58CGRAT (E189RSTOP) TV N 7 FCY2 1311CGRAT (Y437RSTOP) TV N
2 FCY1 58CGRAT (E189RSTOP) TV N 7 FCY2 308CGRAT (S102RSTOP) TV N
3 FCY2 FCY22968–1470 R 7 N.F.
3 FCY2 1226TARAT (L657RSTOP) TV N 9 FCY2 D657 D F
3 FCY2 1475TARAT (Y493RSTOP) TV N 9 FCY2 D155–157 D F
3 FCY2 1475TARAT (Y493RSTOP) TV N 9 FCY2 FCY221098–1143 R
3 FCY2 1568TARGC (L522RSTOP) TV N 9 FCY2 FCY221098–1143 R
5 FCY1 41GCRCG (G14RA) TV M 9 FCY2 FCY221098–1143 R
5 FCY2 fcy2D D 9 FCY2 FCY22968–1143 R
5 FCY2 FCY221053–1143 R 9 FCY2 453GCRAT (M151RI) TI M
5 FCY2 FCY22968–1143 R 9 FCY2 680ATRGC (Y227RC) TI M
5 FCY2 FCY22909–1143 R 9 FCY2 1136ATRGC (Y378RC) TI M
5 FCY2 FCY221065–1143 R 9 FCY2 1205TARGC (M401RR) TV M
5 FCY2 FCY221014–1143 R 9 FCY2 1344CGRAT (Y448RSTOP) TV N
5 FCY2 FCY221089–1143 R 9 N.F.
5 FCY2 FCY221103–1143 R 9 N.F.
5 FCY2 448CGRTA (Q150RSTOP) TI N DoubleMutants
5 FCY2 1594GCRCG (G532RR) TV M 7 FCY2 FCY22978–1143 R
5 FCY2 842GGRTA (W280RL) TV M FCY1 316TARCG (C106RR) TI M
5 N.F. 7 FCY2 FCY22884–1074 R
7 FCY2 D469–472 D F FUR1 518ATRGC (E173RG) TI M
7 FCY2 fcy2D D 7 FCY2 D1222–1602 D
7 FCY2 1020insertionA2 I F FCY2 1214ATRCG (N404RT) TV M
7 FCY2 FCY221053–1143 R 7 FCY2 FCY22913–1143 R
7 FCY2 FCY221053–1143 R FCY2 D909 D F
7 FCY2 FCY221065–1143 R 9 FCY1 258GCRAT (Syn) TI S
7 FCY2 FCY22263–565 R N.F.
7 FCY2 FCY22378–693;1443–1512 R 9 FCY2 FCY221053–1143 R
7 FCY2 FCY22844–1143 R FCY1 437TARCG (L146RP) TV M
7 FCY2 FCY22968–1143 R 9 FCY2 392TARGC (Syn) TV S
7 FCY2 FCY22968–1143 R FCY1 173CGRAT (S58RY) TV M
7 FCY2 FCY221089–1137 R 9 FCY2 FCY22300–513 R
7 FCY2 FCY221123–1137 R FCY2 753GCRAT (Syn) TI S
7 FCY2 FCY221104–1143 R 9 FCY2 945insertionT I F
#
7 FCY2 FCY22921–1143 R FCY2 937CGRAT (L913RI) TV M
7 FCY2 832GCRAT (A278RT) TI M 9 FCY2 453GCRAT (M151RI) TI M
7 FCY2 914TARCG (L305RF) TI M FCY2 445ATRCG (Syn) TV S
N.F.:Nomutationfound,Syn:Sinonimousmutation,D:deletion,I:Insertion,R:recombination,TI:transition,TV:transversion,M:missense,N:nonsense,S:silent,F:
frameshift.
doi:10.1371/journal.pone.0042279.t002
ing the very different conditions in which mutations took place, grewwithin48–60hours(mostofthemwerealreadyvisiblebefore
andsuggestingthepossibilityofdifferentunderlyingmechanisms. 48hours). These experiments enabled us to rule out the
Reconstruction experiments were also performed to examine hypotheses of slow-growing cells as origin of the late-arising
the stability of acquired resistant phenotypes and to evaluate the colonies, and to establish the genetic (hereditary) source of the
possibility that those colonies came from slow-growing individual long-term (acquired) resistance.
cells. Ninety eight percent of the 192 5-FCr colonies examined
PLoSONE | www.plosone.org 5 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
Figure 4. Intrachromosomal recombination of FCY2. Ectopic homologous recombination events found. FCY2, FCY21 and FCY22 are on
chromosomeV,atthespecifieddistances.Afterfolding,therecombinationeventtakesplace,yieldingtheFCY2rsequences.Thearrowsmarkthe
startcodonineithertheWatsonortheCrickstrands.FCY2wisthewild-typeFCY2sequence;FCY2rarethesequencesofthreechosenrecombinant
mutants,andFCY22isthepseudogenFCY2hasrecombinedwith.
doi:10.1371/journal.pone.0042279.g004
Analysis of the Spectrum of Mutations that Causes werefoundintheFCY2gene.Indeed,of59mutations,54(91%)
Resistance were in the FCY2 gene, belonging to 49 clones (89.1% of the
analyzedclones).AsidefromFCY2,wefound4pointmutationsin
To gain further insight into the hereditary source of the
the deaminase FCY1 gene, belonging to those clones that
acquired resistance and the possible mechanisms for it, we
displayed 2 concomitant mutations. We also found 1 transition
examined whether the resistant clones had experienced gross
in FUR1 - concomitant with a mutation in FCY2 -, and no
chromosomal rearrangements and we analyzed the sequences of
mutation at all (silent or otherwise) in CDC21. The spectrum of
the four genes that seemed more likely to be involved: the
the59mutationswasdistributedasfollows:2(3.4%)insertions,7
permease FCY2, the deaminase FCY1, the ribosyl transferase
(11.9%)deletions,11(18.6%)transitionsandanequalnumberof
FUR1 andtheTMPsynthase CDC21.
transversions. The remaining 28 (47.5%) mutations were pro-
Onlyonegrosschromosomalrearrangementwasfoundamong
505-FCrclonesexaminedbyCHEF(Fig.3).Instead,theoriginof duced by intrachromosomal (since our strain is haploid) homol-
ogousrecombinationwithFCY22(Fig.4),a1592bpgenelocated
resistance was mostly found by sequencing the above mentioned
8459 bases downstream of FCY2, in chromosome V, with 87%
genes.Whenexaminingthemutationsinwhatwehavecountedas
homology to FCY2. The mechanisms for this recombination
primarilyresistantclones(pre-exposureresistance),weobserveda
warrant furtherresearch.
marked difference between those that grew within 2 days and
those that took 3days to grow (Table 2). Indeed, all 6 resistant
Analysis of the Cell Cycle
clonesthatappearedwithin2 daysshowedapointmutationinthe
deaminase FCY1, 4 nonsense and 2 missense. Of note, 3 of the In view of the differences found in the sequencing data, we
nonsense mutations were the same transversion 58 CGRAT. In pondered over the possibility that the non-resistant living cells
contrast to what we expected, the spectrum of mutations of the remaining on the plate are replicating their DNA and that the
clonesthat appeared at day 3after drug exposure wasdrastically mutationsarearisingfromreplicationorrepairerrors.Asfigure5
differentfromthatatday2.Indeed,all5mutationsfoundwerein shows,thevastmajorityofthenon-resistantlivingcellsremaining
thepermeaseFCY2gene.Moreover,most(4of5)werenonsense on theSC+5-FC plate seem to undergo an arrest in G1/S phase
transversions, 3 TARAT and 1 TARGC, and we found no already after 3 hours exposure to the drug, lasting for at least,
transitions. 6 days. Nevertheless, a small subpopulation of cells undergoing a
When searching for the origin of resistance in those clones regular cell cycle (as occurs in tumors) orcells undergoing a very
emergedafterday3,wecouldnotfindthecausativemutationin5 slow cell cycle would be undetectable by FACS. Thus, we
(9.1%)of555-FCrclones(Table2).Ofthese5clones,1presented performed a time-lapse microscopicexamination (Fig.6).
asilentsubstitutioninFCY1,whiletheremaining4presentedno Asfigure6shows,cellsgrownindrug-freeliquidmediumfinish
mutations in any of the 4 genes sequenced. Overall, in those 55 thealreadyinitiatedcellcyclesaftertheyareplatedinpresenceof
clonessequenced,wefoundatotalof59mutations(2concomitant drug,sotheynearlydoublethepopulationwithinthefirst3hours.
mutationsin9clonesanalysed).Thevastmajorityofthemutations Afterthat,thecelldivisionisquiteslow,takingfromseveralhours
PLoSONE | www.plosone.org 6 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
PLoSONE | www.plosone.org 7 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
Figure5.Effectsofprolongedexposureto5-FConcellcycleprogression.Foreachpanel,resistantcolonieswereexcisedfromone150mm
diameterplateandtheremainingnon-resistantcellswerewashedoffwith80%EtOHtomeasureDNAcontentsbyFACSasdescribedinMaterials
andMethods.IneachpaneltheXaxisrepresentstheDNAcontentandtheYaxisrepresentsthenumberofcells.TheFACShistogramsmeasuredat
varioustimesasspecifiedineachpanel.
doi:10.1371/journal.pone.0042279.g005
to days for a cell to bud. During 7 days we followed up the Discussion
budding eventsof182individualcellspresent inthecultureafter
Acquisitionofresistancesecondarytodrugtreatmentisamajor
3 hours (to avoid including previous cycles started in absence of
clinical probleminbothbacterial andfungal infectionsaswell as
drug),failingtoobserveanyindividualcellperformingseveralcell
in cancer [4,10,15]. One way cells can acquire resistance is by
cycles.Instead,weobservedthat56%ofthose182cellspresenton
changesinageneoftherouteofactionofthedrug,i.e.mutation.
the slide after 3hours carried out further budding events at later
Adaptive mutations are those that enable a cell to adapt to a
times,definitelyalargernumberthanjustasmallsubpopulationof
growth-limiting (stressful) environment [6]. Several adaptive
cells.Whenobservedthroughtime,itisapparentthatthecycleis
mutation mechanisms are used by bacteria to acquire resistance
extremely slow and that a small bud can take from several hours
to various antibiotics [1,2,4], including the SOS or the RpoS-
uptodaystogrow.Wecanthusconcludethatnosmallpopulation
controlled stressresponses.
isundergoing aregularcellcycle.Rather,thisdatatogetherwith
Data about adaptive mutation mechanisms in eukaryotes is
that collected from FACS analysis suggests that the cell cycle is
ratherscarce.Afewreportssuggesttheirexistenceincertaintypes
sloweddowntoagreatextentatanearlySphase,withorwithout
of cancer (see, for instance, the works by Hara etal. [16] and
transient arrest.
Steinkamp etal. [17]) and most research about yeasts has been
Whileperformingthistime-lapsemicroscopywenoticedalarge
performed on S. cerevisiae (reviewed in [6]). The models available
number of aberrant shapes and apparent pseudohyphae. We
arebasedonnutrientdeprivation,whereoneofthesemodelshas
wonderedwhetherthoseaberrationspossessedanucleusorifthey
revealed the requirement of yKU70, a non-homologous end-
arose during failed attempts to divide. We used fluorescence
joining protein [18]. Nevertheless, in addition to lacking clinical
microscopytoexaminethecellnucleus(Fig.7),observingthatthe
relevance,thesemodelsareratherlimited,sincetheyarebasedon
aberrant cells do have a nucleus, so there is cell division, albeit
an artificial yeast construction that can only adapt to starvation
abnormal. We also observed that mitosis is indeed progressing,
conditions by introducing a frameshift in a promoter region,
since wefoundinstances ofanaphase (arrows).
preventing the researcher from detecting any other types of
mutations that may be acquired by the cell. All these consider-
Extension of the Model of Acquisition of Resistance
ations suggest that adaptive mutation processes do take place in
through Adaptive Mutations eukaryotic cells [19], but a broader model amenable to genetic
Inordertoevaluatewhetherourmodelisspecificofdrugorof studies is needed to describe them in depth. This need has
organism we assayed a more relevant clinical drug, CSP, on the prompted us todevelop thepresented model.
one hand, and an infectious yeast, Candida albicans, on the other A model to study adaptive mutation has to meet two main
hand. criteria, as reviewed by Heidenreich [6]. First, ‘‘a population of
When examining the acquisition of resistance (Fig. 8), we cellshastobekeptinaprolongedstateofgrowthlimitationbythe
observed that upon prolonged exposure to CSP, many more application of nonlethal stress conditions’’, ideally arresting
resistantS.cerevisiaecoloniesemergedthanuponexposureto5-FC completely the cell cycle. ‘‘Second, the possibility should exist
(Fig. 8a). Indeed, while in the 11 subpopulations analysed the that, as a matter of principle, the proliferation arrest is abolished
spontaneous mutation frequency (6.4?102661.2?1026 colonies/ bymutations…Theresultingemergenceofamutantcloneamidst
viable cell) was similar to that of 5-FC, the acquired resistance the majority of’’ non-growing ‘‘cells allows the detection of
frequency rose to 4.7?102262.7?1022 colonies/viable cell adaptive mutation events’’. The model we have developed meets
(p,0.05). bothcriteria:
ThespontaneousmutationfrequencyofC.albicansleadingto5-
FCrwaswithintheexpectedrange(8.4?102868.4?1028colonies/ 1.S. cerevisiae cells have slowed down their cell cycle to such an
extentthatonesinglecellmaytakefromseveralhourstodays
viable cell) [14] (Fig. 8b), but by day 9 the resistance frequency
to complete one cycle and bud, as shown above. Thus, one
rose to 5.4?102561.9?1025 colonies/viable cell, more than 600
wouldthinkthatmostofthemutationsarisenseemtoemerge
fold the spontaneous frequency (p,0.001). A total of 21
not only due to errors by replicative DNA polymerases, but
subpopulations were evaluated in theseexperiments.
fromother mutagenicmechanisms aswell.
In both instances we performed reconstruction experiments to
2.The proliferation arrest is abolished by a number of possible
examine the stability of acquired resistant phenotypes, finding
mutations,asalreadydetailedintheintroduction.Thus,asthe
similar results tothosewith S.cerevisiae and5-FC.
second requirement states, mutations do exist that abolish the
Analyzing these data, we queried what kind of effect, if any,
proliferation arrest.
thesedrugswereexertingonyeastviability(Fig.9).Inspiteofthe
highmutationfrequencyfoundinS.cerevisiaewheninpresenceof
Whencomparingourmodeltotheavailablestarvationmodels,
CSP,thedrughadaseverefungicidaleffect,sothatwehadgreat
we find some similarities. For instance, the late arising resistant
methodologicaldifficultiesincountingthenon-resistantlivingcells
coloniesresultfrompost-platingmutations.Thiscanbeconcluded
remaining on the plate on day 7,a number that was beyond our from the results of the reconstruction experiments and from the
limit of detection on day 9. In contrast, as described in the observation that each mutation found in the vast majority of the
literature, the effect of 5-FC on C. albicans was fungistatic rather colonies analyzed was absent from both the spontaneous mutant
thanfungicidal,cellsnearlydoubling(180.0625.3%)theiroriginal colonies from the same subpopulation and from the other late
population after7 days. arising colonies of the same plate, which clearly shows that the
mutationoccurredafterplating.Analysisofthemutationspectrum
PLoSONE | www.plosone.org 8 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
PLoSONE | www.plosone.org 9 July2012 | Volume 7 | Issue 7 | e42279
AcquisitionofResistancebyAdaptiveMutagenesis
Figure6.FollowupofS.cerevisiaemicrocoloniesduringprolongedexposureto5-FC.FollowupofS.cerevisiaemicrocoloniesduring
prolongedexposureto5-FCforthespecifiedtime.Afterinoculatinga90mmdiameterPetridishcontainingSCmediumwith100mg/ml5-FCinthe
samefashionasperformedforSLAMexperiments,a6cm2slicewascutoutandplacedonaglassslideandkeptinamoistchamber.Randomfields
werechosenattime0andfollowedthroughtimeasspecifiedintheMethodssectionforthetimesindicatedineachpicture.PanelAshowsdetailed
followupofonefield.AdjacenttothefieldshowninpanelB,acellacquiredresistanceandgrew,eventuallyinvadingthefollowedupfield(black
arrow).Amarkeddifferencecanbeobservedbetweentheedgeofmicrocoloniesandthe5-FCrcolony.
doi:10.1371/journal.pone.0042279.g006
shows a clear distinction between the early and the late arising 5-FC,andtoevaluateitsbroadnessandclinicalrelevance,wehave
mutations,whichprovesthatwhatevermechanismistakingplace, validated itwith twovariants.
it is clearly different between the two phases. Whereas the early The first variant is using the infectious yeast, C. albicans, as
arising(spontaneous)clonesshowmostlypointmutationsineither model organism. This clinically important fungus can cause life-
FCY1 or FCY2, the late arising clones (adapted) predominantly threateningsystemicinfections,especiallyinimmunocompromised
have recombined FCY2 with the 8 kbase downstream 87% patients [25]. When compared to the haploid S. cerevisiae strain
homologous gene FCY22. In regard to the point mutations, the used,thespontaneousmutationfrequencyinthisdiploidorganism
typesandgenesfoundvariedwithinthedifferentphases.Whereas wastwoordersofmagnitudelower(intherangeof1028mutants/
the vast majority of point mutations found in spontaneous clones viable cell). But in agreement with the clinical situation, the
wereinFCY1(day2)ortransversionsinFCY2,inadaptedclones adaptive mutation frequency increased greatly through time,
wefoundpredominantlyrecombinationsandasimilarnumberof becoming similar to that of S. cerevisiae (in the range of 1025
transitionsthantransversionsinFCY2.Of50clonesanalyzed,we mutants/viable cell). In contrast to Saccharomyces, viability data
only found by CHEF 1 gross rearrangement, although smaller showthattheCandidapopulationisnearlydoubledwithin7 days.
rearrangements wouldremain undetected by thismethod. This difference is probably due to the different effect of 5-FC on
Comparingourmutationspectrumtothatfoundinthealready either species (fungicidal for S. cerevisiae vs. fungistatic for C.
existing models we have found no similarities. We already albicans). Some cells of both species are slowly reproducing but,
expected that because of the different nature of the mutations whilesomeotherS.cerevisiaecellsdie,theC.albicansonesdon’tdie,
necessarytoescapetheproliferationarrest.Whereasinstarvation remaining quiescent (static), so the overall number of viable cells
modelsonlyaframeshiftinaspecificgene(Lys2orHom3)would increase. The slow replication during our assays imply that the
get selected and re-start growth, our model is very little stringent adaptivemutationfrequenciescanbe,atleastinpart,introduced
with the type of mutation that may become selected and fixed. by replicative polymerase errors, but since the extent of this
Frameshifts, fragment or gene deletions, point mutations, recom- replication is so small, some other mechanism(s) may possibly be
binations, could all provide the mutation necessary to overcome underlying too.
thegrowth limitation, as wehaveseen. The second variant of our model was using an echinocandin
Of note, we found not even one mutation in CDC21, even drug, CSP. This antifungal agent was approved for use barely
though it has been proposed that a change-of-function point 12years ago, with a cost of over 500 USD per day per patient.
mutation in this gene might confer resistance to 5-FC [8]. This Its target is completely different from that of 5-FC, since it is a
underscoresthemetabolicneedforthisgeneandthedifficultiesin noncompetitive inhibitor of b(1–3)-glucan synthase, an enzyme
finding a point mutation that would enable the enzyme to work that catalyzes the extracellular synthesis of b(1–3)-glucan of the
without being affected by thedrug. cell wall [10]. Although CSP elicited a spontaneous mutation
Our model presents additional advantages over the starvation- frequency similar to 5-FC, the adaptive frequency was extremely
based models. Firstly, it is a closer approach to the clinical higher, reaching a range of 1022 CSPr/viable cell. There are
situation andhasmore clinicalrelevance: somereportsontheemergenceofCSPresistantcandidiasisupon
preemptive therapy, as well as of isolates with reduced
1.In recent years S. cerevisiae has acquired relevance as model susceptibility to CSP during therapy, but as of yet, data on the
organism in areas such as pharmacology and oncology. frequency or the incidence of this secondary resistance is not yet
Although it lacks some aspects inherent to cancer, the available, although it will be very interesting to compare our
biochemical routes for the organism functioning are highly invitro data to it.
conserved in eukaryotes, from yeast to human. Most genes In this model, we have observed that yeasts acquire heritable
present a high sequence homology, and protein functions are resistanceuponprolongedexposuretodrugswitheitherfungistatic
enormouslyconservedamongspecies[20].Therefore,usingS. or fungicidal effect, and unexpectedly, the more fungicidal the
cerevisiae as model allows us to discover the role of proteins effect,themoretheadaptivemutationfrequencyisincreasedover
within the cell metabolism context and to identify therapeutic thespontaneous.Thissuggeststhatafactor(s)mayexistthatleads
targets. toadaptivemutationandthatthisfactorincreasesduringcellular
2.Thecytosineanalogue5-FC,failedafteritsdevelopmentasan stress, and the stronger the stress, the higher the factor increases.
antitumordrug,provedusefulasanantifungaldrug.However, Whether this factor is a metabolite (e.g. increased oxidants that
itisnolongerusedasasingleagentduetothehighfrequency may be damaging the DNA) or a biochemical mechanism
of secondary resistance acquisition (30%) [8]. Still, 5-FC is (analogue to bacterial adaptive mechanisms like SOS response,
currentlybeingexploredinnewapproachestocancertherapy oranincreasedDNAdamagebyanendonuclease,forinstance)is
(see forinstance [21,22]). currentlyunderstudy.Whatwehaveobservedisthatspontaneous
mutations in our S. cerevisiae –5-FC model are different from
In addition to its clinical relevance, another advantage of our adaptive mutations, which implies different mutagenic mecha-
model is that the adaptive mutation frequency has similar nisms.Wehaveshownherethatoneoftheadaptivemechanisms
characteristics to those obtained in other models [23,24], but is is through recombination events of the permease FCY2 with an
orders of magnitude higher, which facilitates the assays. Never- 87% homologous gene, FCY22. These observations pose a
theless,toruleouttheexistenceofanintrinsicmutageniceffectof number of interesting queries, like what are the factor(s) leading
PLoSONE | www.plosone.org 10 July2012 | Volume 7 | Issue 7 | e42279