thompson & thompson genetics in medicine

512 Pages·2015·34.5 MB·English

THOMPSON & THOMPSON
GENETICS
IN MEDICINE
THOMPSON & THOMPSON
GENETICS
EIGHTH
EDITION
IN MEDICINE
Robert L. Nussbaum, MD, FACP, FACMG
Holly Smith Chair of Medicine and Science
Professor of Medicine, Neurology, Pediatrics and Pathology
Department of Medicine and Institute for Human Genetics
University of California San Francisco
San Francisco, California
Roderick R. McInnes, CM, MD, PhD, FRS(C), FCAHS, FCCMG
Alva Chair in Human Genetics
Canada Research Chair in Neurogenetics
Professor of Human Genetics and Biochemistry
Director, Lady Davis Institute
Jewish General Hospital
McGill University
Montreal, Quebec, Canada
Huntington F. Willard, PhD
President and Director
The Marine Biological Laboratory
Woods Hole, Massachusetts
and
Professor of Human Genetics
University of Chicago
Chicago, Illinois
With Clinical Case Studies updated by:
Ada Hamosh, MD, MPH
Professor of Pediatrics
McKusick-Nathans Institute of Genetic Medicine
Scientific Director, OMIM
Johns Hopkins University School of Medicine
Baltimore, Maryland
1600 John F. Kennedy Blvd.
Ste 1800
Philadelphia, PA 19103-2899
THOMPSON & THOMPSON GENETICS IN MEDICINE, ISBN: 978-1-4377-0696-3
EIGHTH EDITION
Copyright © 2016 by Elsevier Inc. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means, electronic
or mechanical, including photocopying, recording, or any information storage and retrieval system,
without permission in writing from the publisher. Details on how to seek permission, further
information about the Publisher’s permissions policies and our arrangements with organizations such
as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website:
www.elsevier.com/permissions.
This book and the individual contributions contained in it are protected under copyright by the
Publisher (other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and experience
broaden our understanding, changes in research methods, professional practices, or medical
treatment may become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in
evaluating and using any information, methods, compounds, or experiments described herein. In
using such information or methods they should be mindful of their own safety and the safety of
others, including parties for whom they have a professional responsibility.
With respect to any drug or pharmaceutical products identified, readers are advised to check
the most current information provided (i) on procedures featured or (ii) by the manufacturer of
each product to be administered, to verify the recommended dose or formula, the method and
duration of administration, and contraindications. It is the responsibility of practitioners, relying
on their own experience and knowledge of their patients, to make diagnoses, to determine dosages
and the best treatment for each individual patient, and to take all appropriate safety precautions.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors,
assume any liability for any injury and/or damage to persons or property as a matter of products
liability, negligence or otherwise, or from any use or operation of any methods, products,
instructions, or ideas contained in the material herein.
Previous editions copyrighted 2007, 2004, 2001, 1991, 1986, 1980, 1973, 1966.
Library of Congress Cataloging-in-Publication Data
Nussbaum, Robert L., 1950- , author.
Thompson & Thompson genetics in medicine / Robert L. Nussbaum, Roderick R. McInnes,
Huntington F. Willard.—Eighth edition.
p. ; cm.
Genetics in medicine
Thompson and Thompson genetics in medicine
Includes bibliographical references and index.
ISBN 978-1-4377-0696-3 (alk. paper)
I. McInnes, Roderick R., author. II. Willard, Huntington F., author. III. Title.
IV. Title: Genetics in medicine. V. Title: Thompson and Thompson genetics in medicine.
[DNLM: 1. Genetics, Medical. QZ 50]
RB155
616′.042—dc23
2015009828
Content Strategist: Meghan Ziegler
Senior Content Development Specialist: Joan Ryan
Publishing Services Manager: Jeff Patterson
Senior Project Manager: Mary Pohlman
Design Direction: Xiaopei Chen
Printed in Canada.
Last digit is the print number: 9 8 7 6 5 4 3 2 1
Preface
In their preface to the first edition of Genetics in and precision medicine into Genetics in Medicine by
Medicine, published nearly 50 years ago, James and providing more examples of how genomics is being used
Margaret Thompson wrote: to identify the contributions made by genetic variation
to disease susceptibility and treatment outcomes.
Genetics is fundamental to the basic sciences of The book is not intended to be a compendium of
preclinical medical education and has important genetic diseases nor is it an encyclopedic treatise on
applications to clinical medicine, public health and human genetics and genomics in general. Rather, the
medical research. … This book has been written to authors hope that the eighth edition of Genetics in
introduce the medical student to the principles of Medicine will provide students with a framework for
genetics as they apply to medicine, and to give him understanding the field of medical genetics and genom-
(her) a background for his own reading of the ics while giving them a basis on which to establish a
extensive and rapidly growing literature in the field. program of continuing education in this area. The
If his (her) senior colleagues also find it useful, we Clinical Cases—first introduced in the sixth edition to
shall be doubly satisfied. demonstrate and reinforce general principles of disease
inheritance, pathogenesis, diagnosis, management, and
What was true then is even more so now as our knowl- counseling—continue to be an important feature of
edge of genetics and of the human genome is rapidly the book. We have expanded the set of cases to add
becoming an integral part of public health and the prac- more common complex disorders to the set of cases.
tice of medicine. This new edition of Genetics in Medi- To enhance further the teaching value of the Clinical
cine, the eighth, seeks to fulfill the goals of the previous Cases, we continue to provide a case number (high-
seven by providing an accurate exposition of the funda- lighted in green) throughout the text to direct readers
mental principles of human and medical genetics and to the case in the Clinical Case Studies section that is
genomics. Using illustrative examples drawn from medi- relevant to the concepts being discussed at that point in
cine, we continue to emphasize the genes and mecha- the text.
nisms operating in human diseases. Any medical or genetic counseling student, advanced
Much has changed, however, since the last edition of undergraduate, graduate student in genetics or genom-
this book. The rapid pace of progress stemming from ics, resident in any field of clinical medicine, practicing
the Human Genome Project provides us with a refined physician, or allied medical professional in nursing or
catalogue of all human genes, their sequence, and an physical therapy should find this book to be a thorough
extensive, and still growing, database of human varia- but not exhaustive (or exhausting!) presentation of the
tion around the globe and its relationship to disease. fundamentals of human genetics and genomics as
Genomic information has stimulated the creation of applied to health and disease.
powerful new tools that are changing human genetics
research and medical genetics practice. Throughout, we Robert L. Nussbaum, MD
have continued to expand the scope of the book to Roderick R. McInnes, MD, PhD
incorporate the concepts of personalized health care Huntington F. Willard, PhD
v
Acknowledgments
The authors wish to express their appreciation and Hospital of Philadelphia; Ruth Macpherson of the Uni-
gratitude to their many colleagues who, through their versity of Ottawa Heart Institute; Mary Norton at the
ideas, suggestions, and criticisms, improved the eighth University of California San Francisco; Crista Lese
edition of Genetics in Medicine. In particular, we are Martin of the Geisinger Health System; M. Katharine
grateful to Anthony Wynshaw-Boris for sharing his Rudd and Lora Bean of Emory University School
knowledge and experience in molecular dysmorphology of Medicine; Eric Shoubridge of McGill University;
and developmental genetics in the writing of Chapter Peter St. George-Hyslop of the University of Toronto
14 and to Ada Hamosh for her continuing dedication and the Cambridge Institute for Medical Research;
to and stewardship of the Clinical Case Studies. Paula Waters of the University of British Columbia;
We also thank Mark Blostein, Isabelle Carrier, Robin Williamson; Daynna Wolff of the Medical Uni-
Eduardo Diez, Voula Giannopoulos, Kostas Pantopou- versity of South Carolina; and Huda Zoghbi of the
los, and Prem Ponka of the Lady Davis Institute, McGill Howard Hughes Medical Institute and Baylor College
University; Katie Bungartz; Peter Byers of the University of Medicine.
of Washington; Philippe Campeau of the Ste Justine We extend deep thanks to our ever persistent, deter-
University Hospital Research Center; Ronald Cohn, mined, and supportive editors at Elsevier, Joan Ryan,
Chris Pearson, Peter Ray, Johanna Rommens, and Mary Pohlman, and Meghan Ziegler. Most importantly,
Stephen Scherer of the Hospital for Sick Children, we once again thank our families for their patience and
Toronto; Gary Cutting and Ada Hamosh of Johns understanding for the many hours we spent creating
Hopkins School of Medicine; Beverly Davidson of the this, the eighth edition of Genetics in Medicine.
Children’s Hospital of Philadelphia; Harold C. Dietz of And, lastly and most profoundly, we express our
the Howard Hughes Medical Institute and Johns deepest gratitude to Dr. Margaret Thompson for pro-
Hopkins School of Medicine; Evan Eichler of the viding us the opportunity to carry on the textbook she
Howard Hughes Medical Institute and the University created nearly 50 years ago with her late husband,
of Washington; Geoffrey Ginsburg of Duke University James S. Thompson. Peggy passed away at the age of
Medical Center; Douglas R. Higgs and William G. 94 shortly after we completed this latest revision of her
Wood of the Weatherall Institute of Molecular Medi- book. The book, known widely and simply as “Thomp-
cine, Oxford University; Katherine A. High of the son and Thompson”, lives on as a legacy to their careers
Howard Hughes Medical Institute and the Children’s and to their passion for genetics in medicine.
vii
1
C H A P T E R
Introduction
THE BIRTH AND DEVELOPMENT OF develop treatment and surveillance plans, and partici-
pate in outreach to other family members at risk for the
GENETICS AND GENOMICS
disorder.
Few areas of science and medicine are seeing advances However, genetic principles and approaches are not
at the pace we are experiencing in the related fields of restricted to any one medical specialty or subspecialty;
genetics and genomics. It may appear surprising to they permeate many, and perhaps all, areas of medicine.
many students today, then, to learn that an appreciation Here are just a few examples of how genetics and
of the role of genetics in medicine dates back well over genomics are applied to medicine today:
a century, to the recognition by the British physician • A pediatrician evaluates a child with multiple con-
Archibald Garrod and others that Mendel’s laws of genital malformations and orders a high-resolution
inheritance could explain the recurrence of certain clini- genomic test for submicroscopic chromosomal dele-
cal disorders in families. During the ensuing years, with tions or duplications that are below the level of reso-
developments in cellular and molecular biology, the field lution of routine chromosome analysis (Case 32).
of medical genetics grew from a small clinical subspe- • A genetic counselor specializing in hereditary breast
cialty concerned with a few rare hereditary disorders to cancer offers education, testing, interpretation, and
a recognized medical specialty whose concepts and support to a young woman with a family history of
approaches are important components of the diagnosis hereditary breast and ovarian cancer (Case 7).
and management of many disorders, both common and • An obstetrician sends a chorionic villus sample taken
rare. from a 38-year-old pregnant woman to a cytogenet-
At the beginning of the 21st century, the Human ics laboratory for confirmation of abnormalities in
Genome Project provided a virtually complete sequence the number or structure of the fetal chromosomes,
of human DNA—our genome (the suffix -ome coming following a positive screening result from a non-
from the Greek for “all” or “complete”)—which now invasive prenatal blood test (see Chapter 17).
serves as the foundation of efforts to catalogue all • A hematologist combines family and medical history
human genes, understand their structure and regulation, with gene testing of a young adult with deep venous
determine the extent of variation in these genes in dif- thrombosis to assess the benefits and risks of initiat-
ferent populations, and uncover how genetic variation ing and maintaining anticoagulant therapy (Case 46).
contributes to disease. The human genome of any indi- • A surgeon uses gene expression array analysis of a
vidual can now be studied in its entirety, rather than one lung tumor sample to determine prognosis and to
gene at a time. These developments are making possible guide therapeutic decision making (see Chapter 15).
the field of genomic medicine, which seeks to apply a • A pediatric oncologist tests her patients for genetic varia-
large-scale analysis of the human genome and its prod- tions that can predict a good response or an adverse
ucts, including the control of gene expression, human reaction to a chemotherapeutic agent (Case 45).
gene variation, and interactions between genes and the • A neurologist and genetic counselor provide APOE
environment, to medical care. gene testing for Alzheimer disease susceptibility for a
woman with a strong family history of the disease
GENETICS AND GENOMICS IN MEDICINE so she can make appropriate long-term financial
plans (Case 4).
The Practice of Genetics
• A forensic pathologist uses databases of genetic poly-
The medical geneticist is usually a physician who works morphisms in his analysis of DNA samples obtained
as part of a team of health care providers, including from victims’ personal items and surviving relatives
many other physicians, nurses, and genetic counselors, to identify remains from an airline crash.
to evaluate patients for possible hereditary diseases. • A gastroenterologist orders genome sequence analysis
They characterize the patient’s illness through careful for a child with a multiyear history of life-threatening
history taking and physical examination, assess possible and intractable inflammatory bowel disease. Sequenc-
modes of inheritance, arrange for diagnostic testing, ing reveals a mutation in a previously unsuspected
1
2 THOMPSON & THOMPSON GENETICS IN MEDICINE
gene, clarifying the clinical diagnosis and altering 1000 individuals but is usually much less. Although
treatment for the patient (see Chapter 16). individually rare, single-gene disorders as a group are
• Scientists in the pharmaceutical industry sequence responsible for a significant proportion of disease and
cancer cell DNA to identify specific changes in onco- death. Overall, the incidence of serious single-gene dis-
genic signaling pathways inappropriately activated orders in the pediatric population has been estimated to
by a somatic mutation, leading to the development be approximately 1 per 300 liveborn infants; over an
of specific inhibitors that reliably induce remissions entire lifetime, the prevalence of single-gene disorders is
of the cancers in patients (Case 10). 1 in 50. These disorders are discussed in Chapter 7.
Multifactorial disease with complex inheritance
describes the majority of diseases in which there is a
Categories of Genetic Disease
genetic contribution, as evidenced by increased risk for
Virtually any disease is the result of the combined action disease (compared to the general public) in identical
of genes and environment, but the relative role of the twins or close relatives of affected individuals, and yet
genetic component may be large or small. Among dis- the family history does not fit the inheritance patterns
orders caused wholly or partly by genetic factors, three seen typically in single-gene defects. Multifactorial dis-
main types are recognized: chromosome disorders, eases include congenital malformations such as
single-gene disorders, and multifactorial disorders. Hirschsprung disease (Case 22), cleft lip and palate, and
In chromosome disorders, the defect is due not to a congenital heart defects, as well as many common dis-
single mistake in the genetic blueprint but to an excess orders of adult life, such as Alzheimer disease (Case 4),
or a deficiency of the genes located on entire chromo- diabetes, and coronary artery disease. There appears to
somes or chromosome segments. For example, the pres- be no single error in the genetic information in many of
ence of an extra copy of one chromosome, chromosome these conditions. Rather, the disease is the result of the
21, underlies a specific disorder, Down syndrome, even combined impact of variant forms of many different
though no individual gene on that chromosome is genes; each variant may cause, protect from, or predis-
abnormal. Duplication or deletion of smaller segments pose to a serious defect, often in concert with or trig-
of chromosomes, ranging in size from only a single gered by environmental factors. Estimates of the impact
gene up to a few percent of a chromosome’s length, can of multifactorial disease range from 5% in the pediatric
cause complex birth defects like DiGeorge syndrome or population to more than 60% in the entire population.
even isolated autism without any obvious physical These disorders are the subject of Chapter 8.
abnormalities. As a group, chromosome disorders are
common, affecting approximately 7 per 1000 liveborn
ONWARD
infants and accounting for approximately half of all
spontaneous abortions occurring in the first trimester of During the 50-year professional life of today’s profes-
pregnancy. These types of disorders are discussed in sional and graduate students, extensive changes are
Chapter 6. likely to take place in the discovery, development, and
Single-gene defects are caused by pathogenic muta- use of genetic and genomic knowledge and tools in
tions in individual genes. The mutation may be present medicine. Judging from the quickening pace of discov-
on both chromosomes of a pair (one of paternal origin ery within only the past decade, it is virtually certain
and one of maternal origin) or on only one chromosome that we are just at the beginning of a revolution in inte-
of a pair (matched with a normal copy of that gene grating knowledge of genetics and the genome into
on the other copy of that chromosome). Single-gene public health and the practice of medicine. An introduc-
defects often cause diseases that follow one of the classic tion to the language and concepts of human and medical
inheritance patterns in families (autosomal recessive, genetics and an appreciation of the genetic and genomic
autosomal dominant, or X-linked). In a few cases, the perspective on health and disease will form a framework
mutation is in the mitochondrial rather than in the for lifelong learning that is part of every health profes-
nuclear genome. In any case, the cause is a critical error sional’s career.
in the genetic information carried by a single gene.
Single-gene disorders such as cystic fibrosis (Case 12),
GENERAL REFERENCES
sickle cell anemia (Case 42), and Marfan syn-
drome (Case 30) usually exhibit obvious and charac- Feero WG, Guttmacher AE, Collins FS: Genomic medicine—an
updated primer, N Engl J Med 362:2001–2011, 2010.
teristic pedigree patterns. Most such defects are rare,
Ginsburg G, Willard HF, editors: Genomic and personalized medicine
with a frequency that may be as high as 1 in 500 to (vols 1 & 2), ed 2, New York, 2012, Elsevier.
2
C H A P T E R
Introduction to the
Human Genome
Understanding the organization, variation, and trans-
CHROMOSOME AND GENOME ANALYSIS IN
mission of the human genome is central to appreciating
CLINICAL MEDICINE
the role of genetics in medicine, as well as the emerging
principles of genomic and personalized medicine. With Chromosome and genome analysis has become an impor-
tant diagnostic procedure in clinical medicine. As described
the availability of the sequence of the human genome
more fully in subsequent chapters, these applications
and a growing awareness of the role of genome varia-
include the following:
tion in disease, it is now possible to begin to exploit the • Clinical diagnosis. Numerous medical conditions,
impact of that variation on human health on a broad including some that are common, are associated with
scale. The comparison of individual genomes under- changes in chromosome number or structure and
require chromosome or genome analysis for diagnosis
scores the first major take-home lesson of this book—
and genetic counseling (see Chapters 5 and 6).
every individual has his or her own unique constitution
• Gene identification. A major goal of medical genetics
of gene products, produced in response to the combined and genomics today is the identification of specific
inputs of the genome sequence and one’s particular set genes and elucidating their roles in health and disease.
of environmental exposures and experiences. As pointed This topic is referred to repeatedly but is discussed in
detail in Chapter 10.
out in the previous chapter, this realization reflects what
• Cancer genomics. Genomic and chromosomal changes
Garrod termed chemical individuality over a century
in somatic cells are involved in the initiation and pro-
ago and provides a conceptual foundation for the prac- gression of many types of cancer (see Chapter 15).
tice of genomic and personalized medicine. • Disease treatment. Evaluation of the integrity, compo-
Advances in genome technology and the resulting sition, and differentiation state of the genome is criti-
cal for the development of patient-specific pluripotent
explosion in knowledge and information stemming
stem cells for therapeutic use (see Chapter 13).
from the Human Genome Project are thus playing an
• Prenatal diagnosis. Chromosome and genome analy-
increasingly transformational role in integrating and sis is an essential procedure in prenatal diagnosis (see
applying concepts and discoveries in genetics to the Chapter 17).
practice of medicine.
THE HUMAN GENOME AND THE
CHROMOSOMAL BASIS OF HEREDITY
which at this point we consider simply and most broadly
Appreciation of the importance of genetics to medicine as functional units of genetic information, are encoded
requires an understanding of the nature of the heredi- in the DNA of the genome, organized into a number of
tary material, how it is packaged into the human rod-shaped organelles called chromosomes in the
genome, and how it is transmitted from cell to cell nucleus of each cell. The influence of genes and genetics
during cell division and from generation to generation on states of health and disease is profound, and its roots
during reproduction. The human genome consists of large are found in the information encoded in the DNA that
amounts of the chemical deoxyribonucleic acid (DNA) makes up the human genome.
that contains within its structure the genetic informa- Each species has a characteristic chromosome com-
tion needed to specify all aspects of embryogenesis, plement (karyotype) in terms of the number, morphol-
development, growth, metabolism, and reproduction— ogy, and content of the chromosomes that make up its
essentially all aspects of what makes a human being a genome. The genes are in linear order along the chro-
functional organism. Every nucleated cell in the body mosomes, each gene having a precise position or locus.
carries its own copy of the human genome, which con- A gene map is the map of the genomic location of the
tains, depending on how one defines the term, approxi- genes and is characteristic of each species and the indi-
mately 20,000 to 50,000 genes (see Box later). Genes, viduals within a species.
3
4 THOMPSON & THOMPSON GENETICS IN MEDICINE
The study of chromosomes, their structure, and their information; that is, they typically have the same genes
inheritance is called cytogenetics. The science of human in the same order. At any specific locus, however, the
cytogenetics dates from 1956, when it was first estab- homologues either may be identical or may vary slightly
lished that the normal human chromosome number is in sequence; these different forms of a gene are called
46. Since that time, much has been learned about human alleles. One member of each pair of chromosomes is
chromosomes, their normal structure and composition, inherited from the father, the other from the mother.
and the identity of the genes that they contain, as well Normally, the members of a pair of autosomes are
as their numerous and varied abnormalities. microscopically indistinguishable from each other. In
With the exception of cells that develop into gametes females, the sex chromosomes, the two X chromosomes,
(the germline), all cells that contribute to one’s body are are likewise largely indistinguishable. In males, however,
called somatic cells (soma, body). The genome con- the sex chromosomes differ. One is an X, identical to the
tained in the nucleus of human somatic cells consists of Xs of the female, inherited by a male from his mother
46 chromosomes, made up of 24 different types and and transmitted to his daughters; the other, the Y chro-
arranged in 23 pairs (Fig. 2-1). Of those 23 pairs, 22 are mosome, is inherited from his father and transmitted to
alike in males and females and are called autosomes, his sons. In Chapter 6, as we explore the chromosomal
originally numbered in order of their apparent size from and genomic basis of disease, we will look at some
the largest to the smallest. The remaining pair comprises exceptions to the simple and almost universal rule that
the two different types of sex chromosomes: an X and human females are XX and human males are XY.
a Y chromosome in males and two X chromosomes in In addition to the nuclear genome, a small but impor-
females. Central to the concept of the human genome, tant part of the human genome resides in mitochondria
each chromosome carries a different subset of genes in the cytoplasm (see Fig. 2-1). The mitochondrial chro-
that are arranged linearly along its DNA. Members mosome, to be described later in this chapter, has a
of a pair of chromosomes (referred to as homologous number of unusual features that distinguish it from the
chromosomes or homologues) carry matching genetic rest of the human genome.
Somatic cell
Mitochondrial Nuclear chromosomes
chromosomes
CAATAACGTATGAATATAAACTGCTCAATAAGATAAACAATAGCAGTTACTGCTGTGCTGATCTTTATGGCATTCATTCAGTACATCGGGTCTCCGGAAGACACTACTTCGGGGGTCGGCTCATAGCTTTATACTGGAGTTCTAAAAAATTCCGTTATTAAGACAAATTATTGGTATCCTATGTATGCGCCATTGGAAAATTTTACCAATCGCCGGGGTTTTCAATAACCTGATAAGATCCAGGAGTTATGCCTCTCTAGTAAATATGATCGCTAAAACTGTCATCTTAATTACGAAAATGAGATTTCTTCCGCGCACAAGTAGGTGCTGGTTCCATGTTTGTGCAGCCCCAGTAGCCCTACATATAGTCAAGTGGTGGATCAGAAATTACAAGTGATAACTTTCTCTAATAGTTCCGTGAGTAAGAAAACGTTTATTTTCAGCCAGACCGCACCTACATTTATTAACGCTAACATACAACCTGGTCGGGGATAATTTGTAAGTAAGTTAGTCCCGCATTGAACAACATTACTGGCCCTATTATTTGCCGGATAGCTATGAAACGTTTTCACGCAGTTTTGGGAAACGTCGCATTGTTAGAAACCGGCAATGTTAAGGTTCCCATCAATTGGTATACTGTAGCTTATACATATTTGAATAACATAGCTTGAGAATTCATCGAGCACTAAGAACACCATTCCTCTTGCTATTACGATGGATATGGCCGTTGTACTAATCAGTCCGCACGAAATCCTTGAAAGGAGGTGTTTTCTGGTATATTACCAATGTCTTCTTGAGTTTACACTCAGTATAAAAAAATGCGCGCTCGGTGTACCAGCCTTGATAGTATTCGTTACTGCAAT CAATAACGTATGAATATAAACTGCTCAATAAGATAAACAATAGCAGTTACTGCTGTGCTGATCTTTATGGCATTCATTCAGTACATCGGGTCTCCGGAAGACACTACTTCGGGGGTCGGCTCATAGCTTTATACTGGAGTTCTAAAAAATTCCGTTATTAAGACAAATTATTGGTATCCTATGTATGCGCCATTGGAAAATTTTACCAATCGCCGGGGTTTTCAATAACCTGATAAGATCCAGGAGTTATGCCTCTTCAGTAAATATGATCGCTAAAACTGTCATCTTAATTACGAAAATGAGATTTCTTCCGCGCACAAGTAGGTCTGGGTTCCATGTTTGGTCAGCCCCAGTGACCCTACATATAGTCAAGTGGTGGATCAGAAATTACAAGTGATAACTTTCTCTATAAGTTCCGTGAGTAAGAAAACGTTTATTTTCAGCCAGACCGCACCTACATTTATTAACGCTAACTAACAACCTGGTCGGGGATAATTTTGAAGTAAGTTAGTCCCGCATTGAACAACATTACTGGCCCTATTATTTGCCGGATAGCTATGAAACGTTTTCACGCAGTTTTGGGAAACGTCGCTATGTTAGAAACCGGCAATGTTAAGGTTCCCATACATTGGTATACTGTAGCTTATACATATTTGAATAACATAGCTTAGGAATTCATCGAGACCTAAGAACACCATTCCTCTTGCTATTACGAGTGATATGGCCGTTGTATCAATCAGTCCGCACGAAATCTCTGAAAAGGGGTGTTTTTCGGTATATTACCAATGTCTTCTGTAGTTATCACTCAGTATAAAAAAATGCGCGCTCGGTGTACCAGCCTTGATAGTATTCTGTACTGCAAT CAATAACGTTAAACTGCTCATGAATAAAAAGTATAAAAGCCAATAGTTACGTCGTGTTGCATCTTTTAGATTGCCATTCAGACACTTGGTGCGTCGCAAGAACCATCTTCGGGGGTCGCAGCTCTAGTTTATACTGGGATTCTAAAATTAATCCGTATATACGAAAATATTTTGACGTCTATGTATGCCCAGAGTGAATATTTTAACCACTGCGGCTGGTTTCAATACACTGATAAGAATCCGAGGTTTGACCTCTCTAGTAATAATGATCGCTAAAACTGTCATCTTATATCAGAAGATTAATGATCTTCCGCGCACAAGTAGGTGGGCTTTCCATGTTTGGCTAGCCCCAGGATCCCATACTATAGTCAAGGGTTGGATCAAGAATTACAAGGTTAAACTTCTTCTATAAGTTCCGTGAGAATGAACAAGTTATTTTTCACGCGACCAGCCATCAAATTTCTTAACGCTAACATACAACCTTGCGGGGGATAATTTGTAGATAAGTTAGTCCGCCTATGAACAACATTACTGGCCCTTAATTTTCGCGGTAAGCTATGAACAGTTTCACTGCGATTTTGGGAAACGTCCGATTGTTAGACCAAGGACATGTTAAGTTGCCCATACATTGGTAATCTGATGCTTACTAATATTTGAAATAACTGACTTGAGAATTCACTGGAACCTAAGAACACCATCTCTCTTGCTATCATGAGTGATATGCGCGTTGTACTATACAGTCCCGACGAAATCCTTGAAAGAGGGTGTTTTCTGGTTAATATCCAATGTCTTTCGTAGTTATCCATCAGTATAAAAAATACGGCGCTCGGTGTACCAGCCTAGTTAGTATTCTGTACTGCAAT TCCAACTCCAGTAGAATATATGAATAGAAAATAGCAATAACAATAGTTACGTCTGTGTGCATTTCTTATTAGGCCATTGCAAACTCTGTGGCGGTCCAAAAGCCTACCTGTGGGGTACGCGCTTAGCTTTAATCTGGGAACATTTATTAAACCTGTATATACAGAAATTATGATCTGTCTATGTATGACCCGAGGAATTTATTTAACCACTGGCCGTTTCTGGATAACACGTATAAGACTCAGGAGTGTTACTCCCTTAGTAATAAGTGTACCTAAAAGCCTTATCTTATATACGAATAGTTAAAGTTTCCCCGGCACAAGAGTGCTGTGGTTCCATGTTTGGCTAGCCCCAGTAGCCCAATCTATAGCTAAGTGTGGGATCGAAAATTACAAGGTTAAACTCTTTTCAGTAATTCCGTGATAAGAGAACAGTTTATTTTCACGCGACCAGCCACTAAATTTCTTAACGCTAACATACACCATGCGTGGGGATAATTTGTGAAATAGTTAGCCCTGCTATAGACAACATATTCGGCCCATTTTATTCGGCGAGTACTATAAAGTTGCATCCTGCGATTTTGGGAACACTGGCTAGTTTCACAGAAGGACATTGTAGATCGTCCAACTATTGTGACTATGAGTCTTCAATATTATTGAAATCAATGACTTGGAAATTCACTGGAACCTAAGAACACCACTTCTCTTGCTATTGCAAGTGATTAGCCGGGTTTATCTAAACGTCCCGCAGAAATCTCTGAAAGAGGGTGTTTTCTGTTGAATATCCAATGTCTTTTCGAGTTATCCATACTAGTAAAAAAATGCGCGCTCGGTTGACCAGCCTTTAGAGTACTTTGTACGTCAAT
...CTAGCAATTCTTATAATCGTACGCTAG
TCTTATGGAAACTGTGAATAGGCTTATAACAGGAG
GTCTTAGCCATTCGAATCGTACGCTAGC...
Human Genome Sequence
Figure 2-1 The human genome, encoded on both nuclear and mitochondrial chromosomes.
See Sources & Acknowledgments.