Terminal amino-acids disturb thermostability & activity Terminal Amino-acids Disturb Xylanase ...

14 Pages·2011·0.39 MB·English

JBC Papers in Press. Published on November 9, 2011 as Manuscript M111.269753
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M111.269753
Terminal amino-acids disturb thermostability & activity
Terminal Amino-acids Disturb Xylanase Thermostability and Activity *

Liangwei Liu 1, Guoqiang Zhang 1, Zhang Zhang 1, Suya Wang 2, and Hongge Chen 1,3

1 From the Life Science College, Henan Agricultural University, Zhengzhou 450002.

2 Department of Food Science and Engineering, Nanjing University of Economics, Nanjing 210003.

3 Key Laboratory of Enzyme Engineering of Agricultural Microbiology, Ministry of Agriculture

* Running title: Terminal amino-acids disturb thermostability & activity

To whom correspondence should be addressed: Liangwei Liu, Life Science College, Henan
Agricultural University, 95 Wenhua Road, Zhengzhou 450002, Henan P.R China. Tel: (86)
371-63555175; Fax: [phone]. E-mail: [email protected] D
o
w
n
lo
a
Key words: terminal amino-acid; xylanase; thermostability; activity d
e
d
fro
m
Background: Different from alpha-helix/ Aspergillus niger GH10 xylanase (Xyn) is http
beta-strand, non-regular region contains selected as a model molecule of (beta/alpha)8, ://ww
amino-acid defined as disordered residue (DR); since the general structure consists of ~10% w
.jb
its effect is elusive on enzyme structure and enzymes. The Xyn has five N- and one c.o
rg
function. C-terminal DRs, which were respectively b/
y
g
Results: Terminal DR-deletions increased deleted to construct three mutants, Xyn N, u
e
s
significantly xylanase thermostability and Xyn C, and Xyn NC. Each mutant was t o
n
D
activity. approximately 2-, 3-, or 4-fold more e
c
e
m
Conclusion: Terminal DRs disturb xylanase thermostable, and 7-, 4-, or 4-fold more active b
e
thermostability and activity. than the Xyn. The N-terminal deletion r 31
, 2
Significance: DR-deletion increased regular decreased the xylanase temperature optimum 01
8
secondary structural content, hence, led to slow for activity (T ) 6 °C, but the C-terminal
opt
decreased dG in thermal denaturation process, deletion increased its T 6 °C. The N- and
opt
and ultimately enhanced enzyme C-terminal deletions had opposing effect on
thermostability. the enzyme T , but had additive effect on its
opt
thermostability. The five N-terminal DR
SUMMARY deletion had more effect on the enzyme
Protein structure is composed of regular kinetics, but less effect on its
secondary structural elements (alpha-helix thermo-property than the one C-terminal DR
and beta-strand) and non-regular region. deletion. CD data showed that the terminal
Different from helix and strand, non-regular DR-deletions increased regular secondary
region is consisted of amino-acid defined as structural contents, hence, led to slow
disordered residue (DR). Compared with decreased Gibbs free energy changes (dG) in
those of helix and strand, effect of DR is thermal denaturation process, ultimately,
elusive on enzyme structure and function. An enhanced enzyme thermostabilities.
1
Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
Terminal amino-acids disturb thermostability & activity
Protein structure is constructed by regular Xyn C, and Xyn NC. The DR deletions
secondary structural elements known as a -helix increase xylanase thermostability and catalytic
and b-strand, and non-regular region. Different efficiency, providing a new rational engineering
from regular secondary structures, non-regular method, because it is still a great challenge for
region is consisted of amino-acid referred to as rational engineering of enzyme thermostability
disordered amino-acid residue (DR). Secondary and activity (15-17).
structure connects with enzyme thermostability.
For example, thermophilic enzyme has EXPERIMENTAL PROCEDURES
stabilized secondary structures, such as Bacterial strains and reagents. According
increased residues within strand, stabilized helix, to the A. niger genome annotation (18), we
and increased content of regular structure (1,2). cloned the Xyn gene into pET20b(+) (Novagen,
Helix and strand have stabilizing contribution Shanghai, China). The Xyn has 302 residues
(3,4), but long loop has destabilizing (Swiss-prot No: A2QFV7), consisting with the
contribution to protein thermostability (5). residue length of mature Xyn_ps (Swiss-prot No:
Stabilities of helix and strand are mainly P56588) (13). According to the Xyn_ps D
o
w
influenced by their N- and C-terminal residues structure (1BG4) and sequence alignment, the n
lo
a
(6-9). Compared with those of regular secondary Xyn has five N-terminal DRs (Q1A2S3V4S5) d
e
d
structural elements, effect of DR is elusive on and one C-terminal DR (L302) (Fig. 1). The five fro
m
enzyme structure and function. Additionally, N-, the one C-, and the six bi-terminal DRs were h
ttp
since new N- and C-terminus are often added or respectively deleted to construct three mutants, ://w
w
deleted to facilitate protein purification (10,11), Xyn N, Xyn C, and Xyn NC. Molecular w
.jb
more information should be known about DR. reagents were Pfu polymerase, restriction c.o
rg
An Aspergillus niger xylanase (Xyn) endo-nucleases (NdeI/XhoI), T4 DNA ligase, b/
y
g
(Swiss-prot: A2QFV7) is selected as a model DNA and protein marker, etc (Takara Inc, u
e
s
molecule of GH10 hydrolase, since it plays an Dalian, China). t o
n
D
important role in biomass conversion and Construction of the mutants. The e
c
e
m
renewable energy production. The Xyn exhibits pET20b(+)-xyn served as template for b
e
(/ba ) structure, and the general fold consists of construction of deletion mutants (Fig. 1). The r 31
8 , 2
~10% enzymes, including amylase, glycosidase, genes xyn, xyn n, xyn c, and xyn nc were 01
8
triose-phosphate isomerase, etc (12). Based on amplified by using the primers p1/p2, p3/p2,
sequence alignment with the mature Penicillium p1/p4, and p3/p4 respectively, with italic shown
simplicissimum xylanase (Xyn_ps) and its for NdeI and XhoI restriction sites. PCR was
structure (PDB code: 1BG4) (13), the Xyn is carried out by using 3.0 µl of pET20b-xyn as
found having five DRs at N-terminus (Q1-S5) template, each 1.0 µl of the related primers, 0.5
and one at C-terminus (L302) that do not µl of Pfu polymerase, 4.0 µl of dNTPs, and
construct helix or strand (Fig. 1). According to 1×buffer. PCR conditions were: 4 min at 94 °C,
the negative correlation between non-regular 30 cycles (1 min at 94 °C; 1 min at 47 °C; 1 min
content and xylanase optimum temperature of at 72 °C), 10 min at 72 °C.
activity (T ) (14), the DRs are assumed to p1: ggaattccatatgcaggcttcagtgagtattga
opt
disturb xylanase thermostability. In order to p2: ccaaattactcgaggagagcatttgcgatagc
demonstrate the assumption, the five N-, the one p3: ggaattccatatgattgataccaaattcaaggc
C-, and the six bi-terminal DRs are respectively p4: ccaaattactcgagagcatttgcgatagcag
deleted to construct three mutants, Xyn N, The amplified genes were cloned into
2
Terminal amino-acids disturb thermostability & activity
pET20b(+) digested with NdeI and XhoI to V *[S]/(K +[S]) to calculate maximal activity
max m
delete redundant restriction endo-nuclease sites (V ) and K (Origin). Xylanase standard
max m
(Supplementary Fig. 1). After transforming E. activity was determined by dinitrosalicylic acid
coli BL21(DE3) competent cells, the method (DNS) described previously (19).
recombinant plasmids were extracted and Far-UV Circular dichroism (CD) spectra.
sequenced to confirm gene accuracy by using an The xylanase CD spectra were determined on a
ABI 3730 automated DNA sequencer Jasco-J810 spectropolarimeter flushed with
(Invitrogen Biotechnology, Shanghai, China). nitrogen gas. Each protein sample was scanned
The accurate transformants containing for three times, and the data were averaged and
pET20b-xyn n, pET20b-xyn c, pET20b-xyn used for reported CD spectra, which were
nc, and pET20b-xyn were grown, induced, and recorded from 195 to 260 nm using 0.1-cm
collected to extract xylanases according to path-length cuvette at a scan speed of 50
standard protocols (19). Since having C-terminal nm/min, response time of 2 s, bandwidth of 2
6×His tags, the xylanases were purified by using nm, and pitch of 0.2 nm. For thermodynamic
Co2+-binding resin (Amersham Bioscience, analysis, the thermal denaturation CD spectra D
o
w
Piscataway, U.S.A). Active fractions were were recorded at 220 nm from 30 to 80 °C upon n
lo
a
pooled and further purified by using sephadex heating at a constant rate of 2 °C/min. The molar d
e
d
G-25. The xylanases were detected using 12% ellipticities [uM.R.E.] were calculated according fro
m
polyacrylamide SDS-PAGE and stained with to the following equation: where [], , l, and C h
ttp
Coomassie brilliant G-250. Protein are the molar and observed ellipticity, ://w
w
concentration was measured by path-length (in centimeters), and molar protein w
.jb
Spectrophotometer ND-1000 at 280 nm using concentration, respectively. Thermal c.o
rg
derivatization (NanoDrop Technologies, denaturation curves were fitted to a modified b/
y
g
Wilmington, U.S.A). van’t Hoffe quation using a reversible two-state u
e
s
Assay of xylanase property. Properties of protein unfolding model (20). The spectra data t o
n
D
the mutant xylanases were assayed in parallel were fitted to the native and denatured transition e
c
e
m
with the Xyn for three independent reactions, baselines to obtain thermal melting temperature b
e
and the data were averaged. Xylanase Topt was (Tm), enthalpy change (dH), entropy change (dS), r 31, 2
determined from 30 to 60 °C, and pHopt was and Gibbs’ free energy chang e(dG) values 018
determined from pH 2.6 to 7.0 in (Sigmaplot, Version 10.0).
imidazole-biphthalate buffer. After incubation at *MW
50 °C for 10-min interval from 0 to 100 min, [ ]＝ (cid:190)(cid:190)(cid:190) (cid:190)(cid:190)(cid:190)
residual activity was assayed and expressed as 100*l*C
ratio in percentage of the untreated xylanase
activity. The data were fitted to the Arrhenius RESULTS
function (y = A*e-kt) to calculate thermal Construction of the deletion mutants. The
inactivation half-life for activity (t ) to indicate DR-deleted genes produced specific DNA bands
1/2
thermostability (Origin, version 8.0). Xylanase at about 1.3 kb on gel-electrophoresis (Fig. 1).
kinetics was assayed at optimal condition by After confirming accuracies of the extracted
reaction for 5 min using birch-wood xylan at recombinant plasmids, the transformants
concentration from 2.5 to 50 mg/ml containing pET20b-xyn n, pET20b-xyn c, and
(Sigma-Aldrich, Shanghai, China). The data pET20b-xyn nc were grown and induced to
were fitted with the Hill function (y = extract xylanases. The enzymes Xyn N, Xyn
3
Terminal amino-acids disturb thermostability & activity
C, and Xyn NC produce specific protein bands one C-terminal DR deletion. The affinity of
at about 35 kD on SDS-PAGE (Fig. 1, Table. 1). Xyn NC was higher than those of Xyn N and
The larger apparent molecular masses are Xyn C.
attributed to the xylanases having acidic CD analysis. According to the thermal
properties and 6-His tag at C-termini, since denaturation CD spectra, the T s of Xyn N,
m
acidic protein was found binding less SDS, Xyn C, and Xyn NC are 46.4 °C, 50.5 °C,
therefore having larger apparent molecular mass and 50.8 °C, respectively, which are 4.1 °C
(21-23). lower, equivalent to, and 0.3 °C higher than that
Enzyme property. The T s of Xyn N, of Xyn (Table. 1, Fig. 3). Since the mutant Ts
opt m
Xyn C, and Xyn NC are 38 °C, 50 °C, and 44 were not consistent with their t s, the enhanced
1/2
°C, respectively, which are 6 °C lower, 6 °C enzyme thermostability was not caused by
higher, and equivalent to that of Xyn (Fig. 2, increase of T . After calculating enzymatic dGs
m
Table. 1). Thereby, the N-terminal deletion between native and denatured states, the slopes
decreased, but the C-terminal deletion increased of dG profiles decrease slowly in order of Xyn <
xylanase T 6 °C, while the N- and C-terminal Xyn C < Xyn N < Xyn NC (Fig. 3). Thus, D
opt o
w
deletions had opposing effect on the xylanase the enhanced thermostabilities consist with the n
lo
a
T . The three mutants had equivalent pH s to slow decreased dGs ， and it agrees with d
opt opt ed
the Xyn (Table. 1, Supplementary Fig. 2), thermodynamic analysis of the two variants of fro
m
indicating that the DR deletions did not alter the Streptomyces halstedii xylanase (24). Similar to h
ttp
xylanase pH property. the dG data, the xylanases unfold quickly in ://w
w
After incubation at 50 °C, the t s of Xyn order of Xyn > Xyn C > Xyn N > Xyn NC w
1/2 .jb
N, Xyn C, and Xyn NC are 54.5 min, 74.7 (Fig. 3). Since its Tm is lower, the Xyn N is c.org
min, and 114.3 min, respectively, which are less thermostable than the Xyn C. The Xyn b/
y
g
approximately 2-, 3-, or 4-fold longer than that NC is the most thermostable enzyme for having u
e
s
of Xyn (Fig. 2). The N- and C-terminal deletions the highest T and the slowest decreased dG. t o
m n D
had additive effect on xylanase thermostability, The calculated heat capacity change (dC) values e
c
e
m
since the half-life of Xyn NC is approximately show decreasing order of Xyn > Xyn C > b
e
sum of those of Xyn N and Xyn C. However, Xyn N > Xyn NC (Table. 1). Thus, the r 31
, 2
the one C-terminal DR had more effect on decreased dC tendency is also comparable with 01
8
xylanase thermostability than the five the enhanced thermostability. The tendency is
N-terminal DRs. also shown in thermodynamic analysis of the
After kinetic analysis, xylanase activities ribosomal protein L30e and the Bacillus subtilis
increase in order of Xyn NC < Xyn C < xylanase (11,25). However, the other two
Xyn N. Each V is approximately 3.8-, 4.1-, thermodynamic parameters (dS and dH) have no
max
or 7.3-fold higher than the Xyn (Table. 1, general tendencies in thermal denaturation
Supplementary Fig. 3). The N- and C-terminal process.
deletions had no additive, but slight opposing To compare if regular secondary structural
effect on xylanase activity. The three mutants contents increased or not after the DR deletions,
increased catalytic activity, but decreased the xylanase CD data were used to dissect
affinity for xylan. Thus, the more substrates bind secondary structural elements, since a -helix,
to an enzyme, the higher is its activity. The five b-sh eet, and irregular-coil have characterized
N-terminal DR deletion had more effect on negative CD spectrum bands at ~222 and 210
xylanase activity and its affinity than that of the nm, ~215 nm, and ~195 nm, respectively. All of
4
Terminal amino-acids disturb thermostability & activity
the CD profiles have two clear minima at 210 involved in substrate binding, the C-terminal
and 222 nm (Fig. 4), agreeing with GH10 deletion changed substrate binding specificity of
xylanase having both a -helix and b-she et the phospholipase A2 (27). Similarly, deletion of
features. The three mutant CD spectra remain the 10 kDa C-terminal peptide caused steric
unchanged minima at 222 nm, although the hindrance of substrate toward the catalytic
relative amplitudes decreased, compared with concave cleft of Fibrobacter succinogenes
that of the Xyn. Since irregular-coil has 1,3-1,4-ß-D-glucanase (28).
characterized negative band at ~195 nm, the
spectra minima at 210 nm shift towards higher DISCUSSION
wavelengths in order of Xyn < Xyn N < Xyn Previously, enzyme was truncated entire
NC < Xyn C, indicating that the contents of domain completely or deleted terminal residues
helix and strand within the mutants increased successively (27-33). The present study deleted
relatively after the DR-deletions, compared with respectively the six terminal DRs based on
that of the Xyn. Thus, the terminal DRs disturb structural analysis, and the deletions increased
enzyme stability, consisting with the decreased significantly the xylanase thermostability and D
o
w
GB1 stability after elongation of a loop (5). activity. Similar to our data, the N-glycanase n
lo
a
Structural analysis. In order to analyze the increased deglycosylation activity after deletion d
e
d
terminal DR effects from structural level, the of the N-terminal helix (29). After successive fro
m
Xyn structure was modeled (Fig. 4) based on the truncation analysis, the seven N-terminal h
ttp
Xyn_ps structure (1B31). According to sequence residues and the three C-terminal residues were ://w
w
alignment with the Thermotoga maritima shown unnecessary for the Clostridium w
.jb
xylanase B and its structure annotation (1VBR) thermocellum lichenase catalytic activity (30). c.o
rg
(26), we found the active-site residues (E132, As to enzyme thermostability, the successive b/
y
g
E238) and substrate-binding sites (K51, R82, deletion of terminal residues decreased the u
e
s
W88, Q208, and W268) of the A. niger Xyn. phosphoribosyltransferase thermostability (31); t o
n
D
The five N-terminal DRs and the one C-terminal probably, its structure and conformation were e
c
e
DR do not construct helix or strand of the (/ba ) disturbed by the successive deletions. Similar to mb
8 e
structure, and the new N- and C-terminus our data, the extra four N-terminal residues r 31
, 2
become closer to each other after the deletions, decreased the lysozyme thermostability and its 01
8
which make the structure becoming more refolding rate (10). Deletion of the four
compact. Moreover, the disulfide bond C-terminal glycine-rich repeat and the domain
C256-C262 probably becomes tighter after the increased enzyme thermostability,
DR deletions. As to effect on catalytic activity, substrate-binding affinity, and activity,
the N-terminal DRs (Q1-S5) and the helix respectively (28,30,32). Residue mutations
containing the C-terminal DR (L302) are close happened generally in N-termini of the 15 most
to the residue W276, which was found forming thermostable xylanases, showing that the
a “lid” to partially shield the active-site residues N-terminal region was more susceptible to
(E132 and E238) in the Penicillium thermal unfolding (9). The five N-terminal
simplicissimum xylanase (13). After the DR mutations might confer structural stability, and
deletions, substrate probably enters more easily hence prevent the mesophilic Streptomyces
to the substrate-binding sites, K51, R82, W88, olivaceovirdis xylanase overall thermal
Q208, and W268 of the A. niger Xyn (Fig. 4). unfolding (34). The N- and C-terminus were
Since a cluster of N- and C-terminal residues found playing very prominent roles in inactive
5
Terminal amino-acids disturb thermostability & activity
and active fold switch of the Bacillus subtilis regular secondary structural elements, the DR
xylanase (11). Although commonly used in deletions increased contents of helix and strand
facilitating protein purification by adding or within enzyme, thus, led to slow decreased dG
deleting N- or C-terminal residues, newly tendency in thermal denaturation process.
created residues interfered with protein structure Thermophilic proteins had more stable helixes
and function (11). Thus, protein should have and larger residue fractions within helical
complete and no extra residues in functional conformation than mesophilic counterparts
analysis, as well as free of unnecessary residues (36,37). Regular structural element has
encoded by redundant endo-nuclease sites in stabilizing contribution to enzyme
expression vectors as possible. thermostability (14). The dG values reflect
T , t , and T were assayed to describe global conformational changes, and consist with
opt 1/2 m
different thermal features of the xylanases. T the decreased mechanic strength induced by
opt
reflects enzymatic activity at a certain thermal denaturation (25). The GB1 decreased
temperature. An enzyme with a higher T is 64% of mechanics after elongation of the second
opt
commonly regarded having a higher loop for 46 residues (5). When N- terminus of D
o
w
thermostability (12), and it is often described by the GB1 was extended from its C-terminus, the n
lo
a
organism growth temperature optimum. t structure was damaged more easily by external d
1/2 ed
reflects thermal resistance of an enzyme at a force (4). Robust proteins have more mechanical fro
m
certain temperature, therefore, is more suitable stabilities and higher stiffness, hence, are less h
ttp
to indicate enzyme thermostability. Compared responsive to external perturbation (38). ://w
w
with the Xyn, the Xyn N had a lower T , but In summary, the A. niger xylanase terminal w
opt .jb
a longer t1/2. The difference indicates that the DRs were deleted based on the structural c.org
two parameters are not always consistent, analysis. The deletions enhanced the mesophilic b/
y
g
especially for mutant and wild type of a same xylanase thermostability for 2- – 4-fold, and u
e
s
enzyme, and that the two parameters connect increased its catalytic activity for 3.8- – 7.3-fold t o
n
D
with different structural features. Different from more than those of the wild type. The five e
c
e
m
the two previous parameters, the T s were N-terminal DR deletion decreased the xylanase b
m e
assayed to show 50% of the xylanases being Topt 6 °C, but the one C-terminal DR deletion r 31, 2
thermal inactivated after continuous incubation increased its Topt 6 °C, respectively. Thus, the N- 018
from 30 to 80 °C upon heating at a rate of 2 and C-terminal DR deletions had opposing
°C/min; therefore, the T s of three mutants are effects on the enzyme T , but had additive
m opt
differently higher than their T s. Moreover, the effects on its thermostability. CD analysis
opt
Photinus pyralis (firefly) luciferase T reflects a showed that the DR deletions increased contents
m
thermal deactivation intermediate state that of helix and strand within enzyme, hence, led to
includes reversible active and inactive states slow decreased dG in protein thermal
(35). denaturation process, and ultimately enhanced
Since the five N-terminal DR (Q1-S5) and the xylanase thermostability.
the one C-terminal DR (L302) do not form

REFERENCES
1. Hakulinen, N., Turunen, O., Janis, J., Leisola, M., and Rouvinen, J. (2003) Eur J Biochem. 270,
1399-1412
2. Yano, J. K., and Poulos, T. L. (2003) Curr. Opin. Biotechnol. 14, 360-365
6
Terminal amino-acids disturb thermostability & activity
3. Zhukovsky, E. A., Mulkerrin, M. G., and Presta, L. G. (1994) Biochemistry. 33, 9856-9864
4. Sharma, D., Feng, G., Khor, D., Genchev, G., Lu, H., and Li, H. (2008) Biophys J. 95, 3935-3942
5. Li, H., Wang, H., Cao, Y., Sharma, D., and Wang, M. (2008) J. Mol. Biol. 379, 871-880
6. Nicholson, H., Anderson, D. E., Dao-pin, S., and Matthews, B. W. (1991) Biochemistry. 30,
9816-9828
7. Querol, E., Perez-Pons, J. A., and Mozo-Villarias, A. (1996) Protein Eng. 9, 265-271
8. Turunen, O., Etuaho, K., Fenel, F., Vehmaanpera, J., Wu, X., Rouvinen, J., and Leisola, M. (2001)
J. Biotechnol. 88, 37-46
9. Dumon, C., Varvak, A., Wall, M. A., Flint, J. E., Lewis, R. J., Lakey, J. H., Morland, C., Luginbuhl,
P., Healey, S., and Todaro, T. (2008) J. Biol. Chem. 283, 22557-22564
10. Goda, S., Takano, K., Yamagata, Y., Katakura, Y., and Yutani, K. (2000) Protein Eng. 13,
299-307
11. Ruller, R., Deliberto, L., Ferreira, T., and Ward, R. (2008) Proteins Struct. Funct. Bioinform. 70,
1280-1293
12. Leggio, L., Kalogiannis, S., Bhat, M., and Pickersgill, R. (1999) Proteins 36, 295-306 D
o
w
13. Schmidt, A., Schlacher, A., Steiner, W., Schwab, H., and Kratky, C. (1998) Protein Sci. 7, n
lo
a
2081-2088 d
e
d
14. Liu, L., Chen, H., and Jia, X. (2008) J. Biotechnol. 136s, s201-s201 fro
m
15. Shin, E. S., Yang, M. J., Jung, K. H., Kwon, E. J., Jung, J. S., Park, S. K., Kim, J., Yun, H. D., and h
ttp
Kim, H. (2002) Appl.Envir.Microbiol. 68, 3496-3501 ://w
w
16. Zhao, G., Ali, E., Araki, R., Sakka, M., Kimura, T., and Sakka, K. (2005) Biosci Biotech Bioch. 69, w
.jb
1562-1567 c.o
rg
17. Paloheimo, M., Mantyla, A., Kallio, J., Puranen, T., and Suominen, P. (2007) Appl. Envir. b/
y
g
Microbiol. 73, 3215-3224 u
e
s
18. Pel, H. J., de Winde, J. H., Archer, D. B., Dyer, P. S., Hofmann, G., Schaap, P. J., Turner, G., de t o
n
D
Vries, R. P., Albang, R., Albermann, K., Andersen, M. R., Bendtsen, J. D., Benen, J. A. E., van e
c
e
m
den Berg, M., Breestraat, S., Caddick, M. X., Contreras, R., Cornell, M., Coutinho, P. M., b
e
Danchin, E. G. J., Debets, A. J. M., Dekker, P., van Dijck, P. W. M., van Dijk, A., Dijkhuizen, L., r 31
, 2
Driessen, A. J. M., d'Enfert, C., Geysens, S., Goosen, C., Groot, G. S. P., de Groot, P. W. J., 01
8
Guillemette, T., Henrissat, B., Herweijer, M., van den Hombergh, J. P. T. W., van den Hondel, C.
A. M. J. J., van der Heijden, R. T. J. M., van der Kaaij, R. M., Klis, F. M., Kools, H. J., Kubicek,
C. P., van Kuyk, P. A., Lauber, J., Lu, X., van der Maarel, M. J. E. C., Meulenberg, R., Menke,
H., Mortimer, M. A., Nielsen, J., Oliver, S. G., Olsthoorn, M., Pal, K., van Peij, N. N. M. E., Ram,
A. F. J., Rinas, U., Roubos, J. A., Sagt, C. M. J., Schmoll, M., Sun, J., Ussery, D., Varga, J.,
Vervecken, W., van de Vondervoort, P. J. J., Wedler, H., Woesten, H. A. B., Zeng, A. -., van
Ooyen, A. J. J., Visser, J., and Stam, H. (2007) Nat. Biotechnol. 25, 221-231
19. Liu, L., Cheng, J., Chen, H., Li, X., Wang, S., Song, A., Wang, M., Wang, B., and Shen, J. (2011)
Process Biochem. 46, 395-398
20. Chiti, F., van Nuland, N. A. J., Taddei, N., Magherini, F., Stefani, M., Ramponi, G., and Dobson,
C. M. (1998) Biochemistry. 37, 1447-1455
21. Kaufmann, E., Geisler, N., and Weber, K. (1984) FEBS Lett. 170, 81-84
22. Millward-Sadler, S. J., Davidson, K., Hazlewood, G. P., Black, G. W., Gilbert, H. J., and Clarke, J.
H. (1995) Biochem. J. 312, 39-48
7
Terminal amino-acids disturb thermostability & activity
23. Wassenberg, D., Schurig, H., Liebl, W., and Jaenicke, R. (1997) Protein Sci. 6, 1718-1726
24. Ruiz-Arribas, A., Zhadan, G., Kutyshenko, V., Santamaria, R., Cortijo, M., Villar, E.,
Fernandez-Abalos, J., Calvete, J., and Shnyrov, V. (1998) Eur J Biochem. 253, 462-468
25. Lee, C., Allen, M., Bycroft, M., and Wong, K. (2005) J. Mol. Biol. 348, 419-431
26. Ihsanawati, Kumasaka, T., Kaneko, T., Morokuma, C., Yatsunami, R., Sato, T., Nakamura, S.,
and Tanaka, N. (2005) Proteins 61, 999-1009
27. Huang, B., Yu, B., Rogers, J., Byeon, I., Sekar, K., Chen, X., Sundaralingam, M., Tsai, M., and
Jain, M. (1996) Biochemistry. 35, 12164-12174
28. Wen, T., Chen, J., Lee, S., Yang, N., and Shyur, L. (2005) Biochemistry. 44, 9197-9205
29. Wang, S., Xin, F., Liu, X., Wang, Y., An, Z., Qi, Q., and Wang, P. (2009) PLoS ONE. 4, e8335
30. Niu, D., Zhou, X., Yuan, T., Lin, Z., Ruan, H., and Li, W. (2010) Biotechnol Lett. 32, 963-967
31. Hamana, H., and Shinozawa, T. (1999) J. Biochem. 125, 109-114
32. Ma, Y., Eglinton, J., Evans, D., Logue, S., and Langridge, P. (2000) Biochemistry. 39,
13350-13355
33. Phannachet, K., Raksat, P., Limvuttegrijeerat, T., and Promdonkoy, B. (2010) Curr Microbiol. 61, D
o
w
549-553 n
lo
a
34. Zhang, S., Zhang, K., Chen, X., Chu, X., Sun, F., and Dong, Z. (2010) Biochem. Biophys. Res. d
e
d
Commun. 395, 200-206 fro
m
35. Chen, N., Gregory, K., Sun, Y., and Golovlev, V. (2011) BBA-Proteins Proteom. 1814, http
1318-1324 ://w
w
36. Kumar, S., Tsai, C. J., and Nussinov, R. (2000) Protein Eng. 13, 179-191 w
.jb
37. Kumar, P. R., Eswaramoorthy, S., Vithayathil, P. J., and Viswamitra, M. A. (2000) J. Mol. Biol. c.o
rg
295, 581-593 b/
y
g
38. Guzman, D., Randall, A., Baldi, P., and Guan, Z. (2010) Pro Natl. Acad. Sci. USA 107, 1989-1994 u
e
s
39. Arnold, K., Bordoli, L., Kopp, J., and Schwede, T. (2006) Bioinformatics. 22, 195-201 t o
n
D
40. Schwede, T., Kopp, J., Guex, N., and Peitsch, M. (2003) Nucl Acids Res. 31, 3381-3385 e
c
e
m
b
e
Acknowledgement-The authors are grateful to the unknown reviewers for their sincere suggestions of r 31
, 2
the paper, and are grateful to Ian Riley for his advice on paper writing. 01
8

FOOTNOTES

* This work was supported by Natural Science Foundation of China (30972123).
1To whom correspondence should be addressed: The Life Science College, Henan Agricultural
University, 95 Wenhua Road, Zhengzhou 450002, Henan, China. Tel: [phone], Fax: (86)
371-63555790.
2The Department of Food Science and Engineering, Nanjing University of Economics, 128 Railway
Northern Road, Nanjing 210003, Jiangsu, China.
3 Key Laboratory of Enzyme Engineering of Agricultural Microbiology, Ministry of Agriculture.

FIGURE LEGENDS

FIGURE 1. Construction of the deletion mutants. Helix, strand, and non-regular region are shown in
8
Terminal amino-acids disturb thermostability & activity
box (red), arrow (blue), and line (white), respectively. The five N-terminal disordered residues (DR)
are Q1, A2, S3, V4, and S5, and the one C-terminal DR is L302 (upper). The xylanases Xyn, Xyn C,
Xyn N, and Xyn NC were amplified by using the primers p1/p2, p1/p4, p3/p2, and p3/p4
respectively. The three mutants produce specific DNA bands at about 1.3kb on gel-electrophoresis
(left), and specific protein bands at about 35kD on SDS-PAGE (right).
FIGURE 2. Optimum activity temperatures (left) and thermostabilities (right) of the xylanases.
Residual activities were assayed for the xylanases after incubation at 50 °C for 10-min interval from 0
to 100 min.
FIGURE 3. Unfolded fractions (left) and molar Gibbs free energy changes (dG) (right) in thermal
denaturation process of the xylanases. The denaturation CD data were measured at 222 nm from 303
to 336 K (Kelvin) upon heating at a rate of 2 °C/min, and were converted to unfolded fraction using
the equation (f = (y - y )/(y - y )), where y is the ellipticity observed at the given temperature, and y
u n d n n
and y are the characteristic ellipticities of the folded and unfolded protein. The f spreads to the
d u
vicinity of pre- and post-transition baselines at low and high temperatures. dG (J/mol) was calculated
according to the standard van’t Hoff equation( dG = -RT(f /(1-f )) using a two-state transition model. D
u u o
w
FIGURE 4. The CD spectra (left) and structure (right) of the xylanase. The CD spectra (left) were n
lo
a
determined from 195 to 260 nm. Protein concentrations were 0.699, 0.789, 0.697, and 0.777 mg/ml d
e
d
for the xylanases, Xyn, Xyn C, Xyn N, and Xyn NC, respectively. Similar to the Xyn, the three fro
m
mutants exhibit broad CD spectra bands with minima at 210 and 222 nm, consisting with (/ba )8 http
structure of GH10 xylanase having compact features of a -helix and b-sheet. Thereby, the three ://w
w
deletion mutants fold properly at room temperature. Since irregular-coil has characterized negative w
.jb
band at 195 nm, the shifts of minima at 210 nm toward higher wavelength show that irregular-coil c.o
rg
contents of the xylanase decrease after the DR deletions, and therefore, the contents of strand and b/
y
g
helix increase relatively in order of Xyn < Xyn N < Xyn NC < Xyn C, according to CD reference u
e
s
spectra by Dr. J. T. Yang (JASCO software package). t o
n
D
The A. niger Xyn structure (right) was modeled by using Swiss-model software (39,40), with e
c
e
b-sheet shown in arrow (blue), a -helix in spiral ribbon (red), and irregular coil in line (white). mb
e
According to sequence alignment with the T. maritima xylanase B and its structure (1VBR) (26), we r 31
, 2
found active-site residues (E132, proton donor and E238, nucleophile) and substrate-binding sites of 01
8
the A. niger Xyn. The N-terminal DRs (Q1, A2, S3, V4, and S5) and the helix containing the
C-terminal DR (L302) are close to the W276 (13), which was found forming a “lid” to partially shield
the active-site residues (E132 and E238). After the DR-deletions, substrate enters more easily to the
substrate-binding sites (K51, R82, W88, Q208, and W268) (blue). Additionally, new N- and
C-terminus become closer to each other after DR-deletions, which make the Xyn structure more
compact, therefore, increase its thermostability.

9
Terminal amino-acids disturb thermostability & activity
TABLE 1. Enzyme properties of the xylanases.
Number MM(kD) V
dH max
of Theory/ T dS dC T (umol.L-1.min-1) t
m *103 opt 1/2
residues Apparent /K (mg/ml)
m
34.1/ 659.6/
Xyn 312 50.5 4415.9 1225.4 1428.8 44 28.7
37.56 19.7
33.6/ 4860.8/
Xyn N 307 46.4 1456.6 -0.6 464.5 38 54.5
35.79 46.5
34.0/ 2714.3/
Xyn C 311 50.5 2618.2 -2.0 847.0 50 74.7
37.04 30.5
33.6/ 2503.8/
Xyn NC 306 50.8 2173.5 -4.2 703.8 44 114.3
35.55 26.5
dH (J/mol), dS (J/mol), dC (J/mol): molar enthalpy change, entropy change, heat capacity change
between native and denatured states of enzyme, t (min): thermal denaturation half-life, which was
1/2
assayed for residual activity after incubation at 50 °C for 10-min interval from 0 to 100min, and was D
o
w
compared with the un-incubated enzyme, T (°C): heat melting temperature, T (°C): optimal n
m opt lo
a
temperature for activity. Km and Vmax were calculated according to kinetic analysis by reaction at each ded
enzyme optimal condition. fro
m
http
://w
w
w
.jb
c
.o
rg
b/
y
g
u
e
s
t on
D
ec
e
m
b
e
r 3
1
, 2
0
1
8

10