Sources and Structures of Mitotic Crossovers That Arise When BLM Helicase Is Absent in Drosophila

14 Pages·2013·1.4 MB·English

INVESTIGATION
HIGHLIGHTED ARTICLE
Sources and Structures of Mitotic Crossovers That
Arise When BLM Helicase Is Absent in Drosophila
MatthewC.LaFave,*,1,2SabrinaL.Andersen,*,1,3EricP. Stoffregen,†JulieK.Holsclaw,*
KathrynP. Kohl,*,4LewisJ.Overton,†,5andJeffSekelsky*,†,6
*CurriculuminGeneticsandMolecularBiology,and†DepartmentofBiology,UniversityofNorthCarolina,
ChapelHill,NorthCarolina27599
ABSTRACTTheBloomsyndromehelicase,BLM,hasnumerousfunctionsthatpreventmitoticcrossovers.Weuseduniquefeaturesof
DrosophilamelanogastertoinvestigateoriginsandpropertiesofmitoticcrossoversthatoccurwhenBLMisabsent.Inductionoflesions
that block replication forks increased crossover frequencies, consistent with functions for BLM in responding to fork blockage. In
contrast,treatmentwithhydroxyurea,whichstallsforks,didnotelevatecrossovers,eventhoughmutantslackingBLMaresensitiveto
killingbythisagent.Tolearnaboutsourcesofspontaneousrecombination,wemappedmitoticcrossoversinmutantslackingBLM.In
themalegermline,irradiation-inducedcrossoversweredistributedrandomlyacrosstheeuchromatin,butspontaneouscrossoverswere
nonrandom.Wesuggestthatregionsofthegenomewithahighfrequencyofmitoticcrossoversmaybeanalogoustocommonfragile
sitesinthehumangenome.Interestingly,inthemalegermlinethereisapaucityofcrossoversintheintervalthatspansthepericentric
heterochromatin,butinthefemalegermlinethisintervalismorepronetocrossingover.Finally,oursystemallowedustorecoverpairs
ofreciprocalcrossoverchromosomes.Sequencingoftheserevealedtheexistenceofgeneconversiontractsanddidnotprovideany
evidenceformutationsassociatedwithcrossovers.Thesefindingsprovideimportantnewinsightsintosourcesandstructuresofmitotic
crossovers andfunctions ofBLMhelicase.
MEIOTIC recombination was discovered 100 years ago thatform at sites of crossovershelp to ensureaccurate seg-
byT.H.Morganandhisstudentsinclassicstudiesof regation of homologous chromosomes. In addition, cross-
Drosophilagenetics(Morgan1911).Sincethattime,agreat overs generate chromosomes with novel combinations of
dealhasbeenlearnedaboutthefunctions,molecularmech- alleles at linked loci, leading to increased genetic diversity.
anisms,andregulationofmeioticrecombination.Thisprocessis A quarter century after the discovery of meiotic recombi-
initiatedthroughtheintroductionofprogrammedDNAdouble- nation, Curt Stern, also working withDrosophila, found that
strandbreaks(DSBs),whicharethenrepairedthroughhighly crossoverscanoccurinsomaticcells(Stern1936).Thisphe-
regulatedhomologousrecombination(HR)pathwayssuchthat nomenonis usuallycalled“mitoticrecombination,”although
asubstantialfractionofrepaireventsproducereciprocalcross- most such events are thought to occur during interphase
overs (reviewed in Kohl and Sekelsky 2013). The chiasmata rather than in mitosis per se. Compared to meiotic recombi-
nation,littleisknownaboutmitoticrecombination.Exceptin
Copyright©2014bytheGeneticsSocietyofAmerica some specialized cases, like antibody gene rearrangement,
doi:10.1534/genetics.113.158618
mitotic recombination occurs in response to DNA damage
ManuscriptreceivedFebruary5,2013;acceptedforpublicationOctober17,2013;
publishedEarlyOnlineOctober22,2013. (spontaneous or exogenously induced). Mitotic recombina-
Supportinginformationisavailableonlineathttp://www.genetics.org/lookup/suppl/
tion, like meiotic recombination, can be initiated by DSBs,
doi:10.1534/genetics.113.158618/-/DC1.
1Theseauthorscontributedequallytothiswork. butitisunclearwhetherDSBsconstituteasubstantialfraction
2Presentaddress:GenomeTechnologyBranch,NationalHumanGenomeResearch oftheeventsthatinitiatespontaneousmitoticrecombination.
Institute,NationalInstitutesofHealth,Bethesda,MD20892-8004.
3Present address: Department of Molecular Genetics and Microbiology, Duke TherearecrucialdifferencesinhowDSBrepairproceeds
University,Durham,NC27708. in mitotically proliferating cells compared to meiotic cells
4Present address: Department of Biological Sciences, North Carolina State
(reviewed in Andersen and Sekelsky 2010). First, meiotic
University,Raleigh,NC27695.
5Present address: Department of Otolaryngology, University of North Carolina, DSB repair uses HR exclusively, whereas mitotically prolif-
ChapelHill,NC27599. eratingcellsusebothHRandhomology-independentmech-
6Correspondingauthor:DepartmentofBiology,303FordhamHall,UniversityofNorth
Carolina,ChapelHill,NC27599-3280.E-mail:[email protected] anisms.Second,mitoticHRtypicallyinvolvesuseofthesister
Genetics,Vol.196,107–118 January2014 107
chromatid as a repair template rather than the homologous ings reveal important new information about sources and
chromosome, as in meiosis. Third, a substantial fraction of structures of mitotic crossovers and functions of BLM
meiotic DSBs are repaired as crossovers, but HR in mitotic helicase.
cells tends to occur through pathways that do not produce
crossovers.
Structure-selective DNA helicases are major contributors Materials and Methods
to the prevention of crossovers in mitotic cells. Foremost
Mitotic crossoverassays
among these is BLM helicase, so-named because mutations
inBLMcausethehereditarydisorderBloomsyndrome.The Unless otherwise noted, mutants were heteroallelic or
predominant clinical features of Bloom syndrome are small hemizygous for amorphic alleles (supporting information,
size and a high risk for early onset of a broad range of Table S1). Premeiotic mitotic crossovers in the male germ-
cancers(GermanandEllis1998).Geneticandbiochemical lineweremeasuredasinMcVeyetal.(2007).Crosseswere
studies have shown that BLM and its orthologs can disas- done to generate males of the desired genotype that were
semble recombination intermediates that might otherwise heterozygous for st and e markers on chromosome 3. DNA
be processed through pathways that produce crossovers damagingagentswereaddedtofoodcontaininglarvaefrom
(van Brabant et al. 2000; Adams et al. 2003; Ira et al. thesecrosses,asinYıldızetal.(2002).Dosesused(expressed
2003; Wu and Hickson 2003; Oh et al. 2007; De Muyt asconcentrationofstocksolutionaddedtofood)were0.01%
et al. 2012). The strong anticrossover functions of BLm methyl methanesulfonate (MMS), 0.004% nitrogen mustard
are evident in cellular phenotypes associated with loss of mechlorethamine (HN2), 0.01% camptothecin (CPT) (in
BLM, including an elevation in crossovers between sister DMSO), and 120 mM hydroxyurea (HU). Ultraviolet (UV)
chromatids(sisterchromatidexchange,SCE),homologous dose was 100 J/m2. For HU, we also measured sensitivity
chromosomes, and heterologous chromosomes (German tokilling,sincethishadnotpreviouslybeenreported.Sensi-
1964; Chaganti et al. 1974). tivity was measured as in Yıldız et al. (2002). In untreated
Drosophila melanogaster has advantages as a metazoan vials,therewere357controladultsand228Blmmutants.In
model for studying mitotic crossovers. The absence of mei- vialstreatedwith100mMHU,therewere113controladults
otic crossovers in the males (Morgan 1912) means that and17mutants(two-tailedP,0.0001byFisher’sexacttest).
mitotic crossovers that occur in the male germline can be To score mitotic crossovers, single adult males of the
easilydetectedamongprogeny.Also,inDipteraninsects,pair- desired genotype that emerged from these cultures were
ing of homologous chromosomes is not restricted to meiotic crossedtostevirginfemalesandtheprogenywerescoredas
cells, but occurs in somatic and premeiotic germline cells being parental or recombinant (Figure 1A). An average of
(Stevens1908).Consequently,thehomologouschromosome 50–100 progeny were obtained from each male; vials with
isfrequentlyusedasatemplateduringDSBrepair(Rongand progeny counts at least two standard deviations below the
Golic 2003). Thus, a substantial fraction of recombination mean (generally ,10–15 progeny) were discounted. Be-
events that give rise to SCEs in other species may instead cause crossovers are predominantly or exclusively premei-
result in crossovers between homologous chromosomes in otic, single crossover events can give rise to clusters of
Drosophila; crossovers between homologous chromosomes progeny.Wethereforetreatedeachsinglemaleasaseparate
are much more amenableto genetic and molecular analyses experiment. One-way ANOVA tests were done using Prism
thanSCEs. 6.03 (GraphPad), with Bonferroni correction for multiple
We took advantage of these features of Drosophila to in- comparisons. MMS, UV, and HU treatments were done at
vestigate mitotic crossovers that occur in Drosophila BLM thesametimeastheuntreatedcontrolshowninFigure1B.
(formerlymus309)mutants.Spontaneousmitoticcrossovers HN2 was done several years later with a simultaneous un-
are highly elevated in Blm mutants (Johnson-Schlitz and treatedcontrol.Thiswasnotsignificantlydifferentfromthe
Engels 2006; McVey et al. 2007), suggesting that these original control, but statistical significance was determined
mutants may be a good model for discovering the origins by an unpaired t-test to the contemporaneous control set.
of spontaneous mitotic crossovers in Bloom syndrome cells. CPT treatment had its own untreated control in which
To investigate these origins, we treated Blm mutants with DMSO (the solvent used to dissolve CPT) was added to
avarietyofDNAdamagingagentstodeterminewhichtypes the food. An unpaired t-test was done to compare treated
of damage induce mitotic crossovers. As a complementary to control.
approach, we knocked out specific repair pathways in Blm
Crossoverdistributionassays
mutants to determine which of these remove spontaneous
damage that can lead to crossovers if left unrepaired. We Crossesbetweenbalancedstocksgeneratedmaleshomozygous
also mapped spontaneous mitotic crossovers that occur in orheteroallelicforBlmandheterozygousformarkerson2L.
Blmmutantsandfoundthatthedistributionisnonrandom, The experiment depicted in Figure 2A used males of geno-
suggesting that some sites or regions of the genome are type net dppd-ho dp b pr cn; BlmN1/TM6B and females of
more prone to damage than others. Finally, we sequenced genotype P{SUPor-P}GlcATSKG01446; BlmN1/TM6B. Male
theexchangesitesofpairsofreciprocalcrossovers.Ourfind- progenythatwerehomozygousforBlmN1andheterozygous
108 M.C.LaFaveetal.
for chromosome 2 were crossed to net dppd-ho dp b pr cn mosome 2 were crossed to y/y+Y; Pin/SM6a, al dp sp
females, and the progeny of this cross were scored for mi- females,andtheappropriateprogenywerecrossedtomake
totic crossovers. Crossovers that occurred between dp and a stock, as above.
b werefurther characterizedvia PCRtodetermine whether Males that were to be used for single nucleotide poly-
they occurred proximal or distal to the P-element. In such morphism (SNP) mapping via high-throughput sequencing
cases, DNAwas obtained via single-fly preps and amplified weretakenfromthesebalancedstocksandcrossedtoaldp
with the primers GTCTAGTGCCAGGCTACTCG and b pr cn. Progeny of the genotype al dp b pr cn/CO were
GCGGACCACCTTATGTTATTTC. collected and frozen at 280(cid:1). Genomic DNA was isolated
For the experiment depicted in Figure 3B, the marker and libraries were prepared for sequencing on the Illumina
chromosome stock was changed to net dppd-ho dp b pr cn; ru HiSeq2000.Foursequencinglibrariescorrespondedtoeach
BlmN1 DNApol-a180 ca/TM6B. Subsequent crosses remained half of two reciprocal crossovers. SNPs were detected by
thesame. comparison to the Drosophila reference sequence (release
The experiment depicted in Figure 2D began with pa- 5). The SNP information gleaned from the sequencing was
rentalmalesofgenotypealdpbprcn/SM6a;BlmD2/TM6B used to narrow down the location of these crossovers, first
and parental females of genotype w; cn bw sp; BlmN1/ by testing restriction fragment-length polymorphisms, and
TM6B. The 2nd chromosome 2 of the females is the refer- then by sequencing over regions with multiple SNPs. This
ence sequence chromosome, derived from stock no. 2057 SNP information was later used to characterize eight addi-
from the Bloomington Stock Center. Male progeny that tional reciprocal crossovers.
were heteroallelic for Blm and heterozygous for chromo- Because each individual chromosome from a reciprocal
some 2werecrossedtoaldpbprcnfemales,andprogeny recombinationeventwascrossedtoareferencestock,itwas
of that cross were scored for mitotic crossovers. possible to narrow down the region where the crossover
To measure mitotic crossovers in the female germline event occurred by finding the region where known heter-
(Figure 2C), females, mutant for mei-P22, which is re- ologies switch from being heterozygous to homozygous or
quired to make meiotic DSBs (Liu et al. 2002) and Blm, vice versa. For each reciprocal recombination pair, primer
were used. To overcome the requirement for maternal sets were designed for SNPs located within the region
BLM protein in embryonic development, we expressed determined to contain the exchange based on phenotypic
BLM from a UASp::Blm transgene using a Mata::GAL4 mapping. PCR and sequencing of these SNP-containing
driverthatturnsonexpressionaftermeioticrecombination regions was performed until the site of exchange was
iscomplete,asinKohletal.(2012).Duetothelowfecundity narrowed to less than the distance between two available
ofmutantsthat donot domeioticrecombination, weplaced heterologies. Then, the region between the two nearest
18–22 females into each vial, but still counted each vial as heterologieswasamplifiedandsequencedtosearchforany
a separate experiment. insertions, deletions, inversions, or other heterologies that
We used the DEVIAT program (Cirulli et al. 2007) to could be used for further mapping.
perform bootstrapping to test whether crossover distribu-
tionsweresignificantlynonuniform.P-valuesreportedwere
obtained by running 100,000 bootstrapping trials. Correct- Results
ing for multiple tests did not affect the significance of any
Agentsthatblockreplicationforkprogressionincrease
results.
mitoticcrossovers inBlmmutants
Molecularanalysis ofreciprocalcrossover products
Spontaneous mitotic crossovers in the male germline are
Crossover structure analysis was carried out on reciprocal elevated by orders of magnitude in Blm mutants (Johnson-
crossovers derived from the experiment depicted in Figure Schlitz and Engels 2006; McVey et al. 2007). Treatment of
2B.Invialswheremalesiblingswithreciprocalmarkercon- larvae with ionizing radiation (IR), which generates DSBs,
figurations were present, each was crossed to y; Pin/SM6a, causes a further increase, suggesting that DSBs can be
al dp sp females. The al, dp, and sp markers on SM6a were a source of these crossovers (McVey et al. 2007). To deter-
used to identify presence of the crossover chromosome in mine whether BLM preventscrossovers induced by damage
progeny. Siblings that carried both the crossover chromo- otherthanDSBs,wetreatedBlmmutantlarvaewithavariety
some and SM6a were crossed to each other to make a bal- of agents: CPT, an inhibitor of topoisomerase I, which gen-
anced stock, which were later used to generate multiple erates replication-associated DSBs (Liu et al. 2000); MMS,
individuals with an identical chromosome 2 genotype of al whichalkylatesbases(Beranek1990);UVlight,whichindu-
dp b pr cn/CO. cesprimarilypyrimidinedimersand6,4-photoproducts;HN2,
Inthecasethatalanddpwerebothpresentontheinitial which generates base adducts and interstrand crosslinks
crossover chromosome, it was possible that sp had been (Wijen et al. 2000); and HU. HU inhibits ribonucleotide re-
crossed off in an unrelated mitotic crossover; as such, the ductase,leadingtodepleteddeoxyribonucleotidetriphosphate
malewasfirstcrossedtonetdppd-hodpwgSp-1bprcn/SM6a. (dNTP)poolsandconsequentslowingand/orstallingofrep-
Maleprogenyofthiscrossthatwerenotbalancedforchro- lication(Alvinoetal.2007).Blmmutantsarehypersensitiveto
MitoticCrossoversfromLossofBLMHelicase 109
Figure 1 Effects of DNA damagingagents and DNA
repairdefectsonmitoticcrossoverrateinBlmmutants.
(A) Schematic of method to measure mitotic cross-
overs. Single males heteroallelic for amorphic Blm
mutations andheterozygousfor st ande are crossed
totesterfemales.Progenyarescoredasbeingparental
(left) or recombinant (right) for st and e. The two
recombinant classes are drawn with a crossover in
thesameposition,becausewecansometimesrecover
the two reciprocal products of a single crossover. (B)
Frequencyofcrossoversbetweenstandeinwild-type
(pink)andBlm(blue)malegermlinesaftertreatmentof
larvaewiththeindicatedDNAdamagingagents.See
Materials and Methods for doses. (C) Frequency of
malegermlinecrossoversbetweenstandeinvarious
singlemutants(pink)andindoublemutantswithBlm
(blue). nd, not done. Error bars are standarderror of
the mean (n = 16, 35, 9, 14, 25, and 9 males for
treatments of Blm in B, left to right; n = 16, 22, 41,
33, 21, 22, 20, and 17 males for Blm mutant geno-
typesinC).One-wayANOVAtestweredonetocom-
pareeachtreatmenttountreatedBlm(B,P,0.0001)
andeachdoublemutanttotheBlmsinglemutant(C,
P , 0.0001), with Bonferroni correction for multiple
comparisons.DottedwhitelinesonHN2andCPTbars
indicate values of matched controls. In these cases,
unpairedt-testsweredonetocomparetothematched
control (see Materials and Methods). NS, P . 0.05;
*P,0.05;**P,0.01;***P,0.001.
killing by each of these agents (Boyd et al. 1981; McVey (HU) forks, and that broken or blocked forks may be pro-
et al. 2007). cessed through pathways that can lead to crossovers when
Treatment with CPT resulted in increased crossovers BLM is absent.
(Figure 1B), consistent with a previous study that found
EffectsofeliminatingDNArepairpathways onmitotic
elevated crossovers after IR (McVey et al. 2007), and sug-
crossoverfrequenciesinBlmmutants
gestingthatDSBsthatoccurinthecontextofreplicationcan
lead to interhomolog crossovers when BLM is absent. We We next asked whether removing specific DNA repair
also detected elevated mitotic crossovers after treatment pathways would affect mitotic crossover frequencies in
withMMS,UV,andHN2(Figure1B).Therewasnoincrease Blmmutants.Wehypothesizedthatknockingoutnucleotide
in mitotic crossovers after treatment with HU (Figure 1B), excision repair (NER), a process responsible for removing
eventhoughBlmmutantsarehypersensitivetokillingbyHU damage caused by UV and some MMS and HN2 damage,
at the dose used (24% survival relative to control; P , would lead to increased crossover frequency. We used null
0.0001; see Materials and Methods). Together, our results mutationsinmei-9andmus201,whichencodetheorthologs
suggest that BLM is important in responding to broken ofXPF/Rad1andXPG/Rad2,endonucleasesthatmakenicks
(CPT),blocked(MMS,UV,andHN2),andslowedorstalled 59and39ofthedamagedbase,respectively (Sekelskyetal.
110 M.C.LaFaveetal.
Figure3 Distributionofirradiation-inducedcrossovers.(A)Distributionof
crossoversinBlmmutantmalesexposedto250radsofgammairradiation
during larval development; thick, dotted red line shows the mean fre-
quencyacrosstheintervalassayed(232crossoversfrom101males).The
thin, dashed blue line shows the distribution from unirradiated control
males done at the same time; the thick, dotted blue line is the mean
frequencyincontrols(202crossoversfrom140males).(B)Distributionof
crossoversresultingfromirradiation.Theunirradiatedfrequencywassub-
tracted from each interval in A, removing spontaneous crossovers and
leavingonlyirradiation-inducedcrossovers.(C)DatainBwereregraphed
toexcludethepericentricheterochromatinbetweenprandcn.
2000). Crossovers were significantly elevated in mei-9; Blm
Figure2 Mitoticcrossoverdistributiononchromosome2L.(A)Distribu- mutantsrelativetoBlmsinglemutants,butwerenotelevatedin
tioninBlmmutantmales(532crossoversfrom313males).Thedrawing mus201;Blmmutants(Figure1C).Rad1hasNER-independent
at the top depicts the region assayed. Circle, centromere; thick line,
DNA repair functions (Klein 1988; Fishman-Lobell and
pericentricheterochromatin.Barsindicatethecrossoverfrequencyineach
Haber 1992; Ivanov and Haber 1995); the crossover eleva-
interval. The dotted line shows the mean frequency across the entire
region. Scaleis inmillionsof basepairs (Mbp)from theleftend of 2L. tion caused by removing MEI-9 might be a consequence of
(B) Distribution in Blm mutant males (634 crossovers from 391 males) disrupting pathways other than NER. We also tested the
usingadifferentsetofchromosome2markers.(C)Distributionofmitotic effect of removing the NER damage recognition protein
crossoversinthefemalegermline(12crossoversfrom13vials).Notethe
XPC, which is encoded by the mus210 gene (Sekelsky
differentscalethaninotherpanels.(D)DistributioninBlmmutantmales
(334crossoversfrom157males)thatareheterozygousforaDNApola- et al. 2000). Removal of XPC, like removal of XPG, had no
180 mutation. The superimposed dashed blue line is the distribution effect on crossover rate (Figure 1C).
fromA. DSBs can be repaired by HR or by nonhomologous end
joining (NHEJ). We knocked out both HR and NHEJ to
determine the relative contributions of these pathways in
respondingtothespontaneouslesionsthatleadtocrossovers
MitoticCrossoversfromLossofBLMHelicase 111
inBlmmutants.ToknockoutHR,weusedmutationsinspn- We also mapped mitotic crossovers in the female germ-
A,whichencodesRad51(Staeva-Vieiraetal.2003),andokr, line. Previous mapping of crossovers in Blm mutants
which encodes Rad54 (Ghabrial et al. 1998). Crossovers revealed an apparently random distribution across the eu-
were eliminated in okr; Blm and significantly reduced in chromatin, but it is thought that most of these are meiotic
Blm spn-A mutants (Figure 1C). The residual crossovers in crossovers (McVey et al. 2007; Kohl et al. 2012). To deter-
Blmspn-Adoublemutants(only4of21maleshadrecombi- mine the contribution of mitotic recombination to this set,
nant progeny) probably result from maternally loaded we measured crossovers in double mutants with mei-P22,
Rad51 protein and/or transcript (McVey et al. 2004a). a gene whose product is required to generate meiotic DSBs
These data indicate that, as expected, most or all mitotic (Liu et al. 2002). Crossovers are not detected in mei-P22
crossovers are generated through HR pathways. single mutants (Liu et al. 2002), but do occur in mei-P22
We knocked out the canonical NHEJ pathway with Blm double mutants (Figure 2C). These occur at a much
a mutation in the DNA ligase 4 gene lig4. If some sponta- lower frequency than in the male germline (compare the
neousDSBsarerepairedthroughNHEJ,thenwhenNHEJ scales in Figure 2, A and C). The distribution of mitotic
is compromised, these DSBs might be channeled into crossovers in the male germline is strikingly different than
BLM-dependent HR pathways, leading to an elevation in the distribution in the female germline. The difference is
crossovers in double mutants with Blm. There was no sig- most prominent in the pr–cn interval, which consists of
nificant elevation in crossovers in these double mutants, (cid:1)6.6 Mb of euchromatin and 16 Mb of pericentric hetero-
suggesting that NHEJ does not normally play a major role chromatin. In the male germline, crossovers are least fre-
inrepairing damagethatleadstocrossing overwhenBLM quent in this interval, whereas in the female germline they
is absent. aremostfrequentinthisregion.Althoughwemappedonly
Finally,weeliminatedtheG2-MDNAdamagecheckpoint 12 independent crossovers in the female germline, com-
with a mutation in mei-41, which encodes the ortholog of pared to 532 in the male germline, the fraction occurring
ATR (Hari et al. 1995); this led to a significant increase in inthecentromere-spanningintervalissignificantlydifferent
crossovers (Figure 1C). betweenthesesamples(8of12inthefemalegermline,134
of532inthemalegermline;P=0.0034bytwo-tailedFish-
Thedistributionofmitoticcrossovers intheabsence er’s exact test).
ofBLMisnonrandom
Nonrandomdistributionofmitoticcrossoversmightarise
TheelevationinmitoticcrossoversduetolossofBLMoccurs ifsomeregionsofthegenomearemorelikelytoexperience
even in the absence of exogenous damage, presumably in spontaneousproblems.Inmammaliancells,commonfragile
response to spontaneous problems (Johnson-Schlitz and sites (CFSs) are regions with an elevated incidence of
Engels 2006;McVey etal. 2007).There are many potential chromosome breaks when DNA replication is partially
sources of spontaneous problems, including random DNA impeded, which is usually achieved by growing cells in the
damage, failure to complete replication before entry into presence of a low dose of the DNA polymerase inhibitor
mitosis, and collisions between replication forks and tran- aphidicholin(APH)(Debatisseetal.2012).Totesttheidea
scription complexes. Some of these events may be more that regions of higher mitotic crossovers in Blm mutants
prone to occur in some regions of the genome than others, might correspond to or contain CFSs, we genetically mim-
and thus crossovers might occur more frequently in these ickedAPHtreatmentbyreducingthedosageofthecatalytic
regions. To test this idea, we mapped the distribution of subunitofDNApolymerasea(Pola),aconditionthataffects
crossoverswithina43-Mbpregion((cid:1)20%oftheDrosophila genomestability(LaRocqueetal.2007).Heterozygosityfor
genome).Weusedvisiblemarkerstodividetheregionfrom a null mutation in DNApol-a180 caused an increase in the
net, at the left end of 2L, to cn, toward the left end of 2R, malegermlinecrossoverfrequencyofflieslackingBLM,but
into six intervals, and determined rates of crossing over in the distribution of crossovers remained strikingly similar
each interval (Figure 2A). We recovered 532 independent (Figure 2D). This result supports the hypothesis that many
crossovers from males that were homozygous for the dele- of the mitotic crossovers recovered in the absence of BLM
tionalleleBlmN1.Thesecrossoversweredistributednonran- result from problems encountered during replication.
domly(P,0.0001bybootstrapping),withthenet-dpand An alternative explanation for the nonrandom distribu-
b-pr intervals having the highest frequencies and the pr-cn tion of mitotic crossovers is that BLM-dependent pathways
region,whichincludesthecentromereand(cid:1)16Mbofperi- are used to different degrees in different regions of the ge-
centric heterochromatin, having a substantially lower fre- nome. For example, DSBs in highly repetitive sequences
quency than other intervals. Using a different set of might be repaired through single-strand annealing or end
markers, we mapped an additional 634 crossovers from joining pathways that would not be compromised by the
malesheteroallelicforBlmN1andthenonsensealleleBlmD2 absenceofBLM.Totestthispossibility,wetreatedBlmmu-
(Figure 2B). The distribution was also significantly nonran- tantlarvaewithionizingradiationtoinduceDSBsandthen
dom (P = 0.0002) in this background. Notably, the regions measured germlinemitotic crossoversinthe resultingadult
withthehighestfrequenciesofcrossingoverweresimilarin males. The distribution of IR-induced crossovers was sub-
the two experiments. stantially different from the distribution of spontaneous
112 M.C.LaFaveetal.
crossovers (Figure 3A). The distribution is still significantly somes, including the two analyzed previously by Illumina
nonrandom (P , 0.0001), but this appears to be driven by sequencing.Infourofthesepairstheexchangesitesonboth
the low number of crossovers recovered in the pr-to-cn in- chromosomes fell between the same pair of adjacent SNPs,
terval. Since the majority of this interval is made up of the supporting the inference that these are reciprocal products
centromere and the pericentric heterochromatin, we hy- of single crossover events. These crossovers did not have
pothesized that crossovers are either absent from or rare detectable gene conversion tracts. The distances between
within these regions. In support of this hypothesis, when SNPsinthesecases,whichrepresentsthemaximumpossible
we consider only the euchromatic distance between pr and size of undetectable conversion tracts, ranged from 573 bp
cn(6.6Mbinsteadof23Mb;Figure3C),thedistributionis to 4420 bp (mean = 2536 bp). In the other three pairs,
notsignificantlydifferentfromrandom(P=0.2133).Thisis crossoversiteswereindifferentSNPintervals,revealingthe
nottrueforthespontaneousevents(withoutIRtreatment), existence of gene conversion tracts associated with these
which are significantly nonrandomly distributed even if we crossovers. In CO5, the conversion tract, which includes
omit the heterochromatic length (P = 0.0011 for data in nineSNPs,isbetween1057and1748bp.InCO6,thetract
Figure 2A; P = 0.0020 for Pola reduction in Figure 2D) or includes only a single SNP, but the nearest identified
consider only the five intervals wholly within the euchro- polymorphisms are 5876 bp to the left and 7539 bp to the
matic part of 2L (P = 0.0005; P = 0.0019 for DNA Pola right; therefore, the length of this tract is between 1 and
reduction). These findings suggest that when a DSB is in- 13,415bp.CO7hasacomplextract.Theconversiontractis
duced by IR and repaired in the absence of BLM, the prob- between 6847 and 7831 bp long, but on one chromosome
ability that a crossover will be produced is the same across the converted region is interrupted by an unconverted
the euchromatin, at least at low resolution. In the hetero- segment of 697–2385 bp, spanning three SNPs. Potential
chromatin, however, either DSB repair is independent of origins of this structure are outlined in Discussion.
BLM or a noncrossover pathway is used (see Discussion). In this analysis, we sequenced .28,000 bp of DNA in
We conclude that the nonrandom distribution of spontane- regions encompassing crossover points (i.e., between the
ous crossovers that occurs in the absence of BLM is most nearest flanking SNPs), and .70,000 bp in regions within
likely due to a nonrandom distribution of initiating lesions. 10 kb of a crossover site. We did not detect any de novo
sequence changes, such as new SNPs, insertions, or dele-
Molecularstructuresofmitoticcrossovers
tions. Based on these data, the rate of mutation associated
Additionalinsightsintosourcesofmitoticcrossoverscanbe with these crossovers is ,1024 per base pair.
obtainedfrommolecularanalysisofcrossoverchromosomes.
In our male germline assays, crossovers arise during pre-
meiotic mitotic proliferation. This can result in an individual Discussion
crossover being recovered multiple times in a cluster of
FunctionsofBLMinpreventingmitoticcrossovers
progeny.Insomecases,thepresumptivereciprocalproductis
present in siblings. This permits molecular analysis of OurdataindicatethatDSBsanddamagethatispredictedto
reciprocal mitotic recombination products, something that blockreplicationforksinducemitoticcrossingoverinmutants
has not been possible in previous studies of metazoan lackingBLM.Similarly,treatmentofBloomsyndromepatient-
mitotic recombination. derived cells with the alkylating agent ethyl methanesulfo-
We isolated 10 independent pairs of siblings with re- nate (EMS) leads to elevated SCEs (Krepinsky et al. 1979).
ciprocal crossover marker configurations. Two pairs were ThesefindingssupportmodelsinwhichBLMisimportantin
subjected to Illumina sequencing. This allowed us to de- managing forks when DNA synthesis is blocked. Damage
termine crossover positions, which were within 10 kilobase that occurs outside of S phase can certainly also lead to
pairs (kbp) of one another in both cases (Figure 4), and to mitoticcrossovers.Forexample,DSBsgenerated enzymat-
identify SNPs between the two parental chromosomes. We icallyandgapsresultingfromP-elementexcisionareasso-
used these SNPs to determine crossover positions in the ciated with mitotic crossing over when BLM is absent
remaining 8 pairs. In two cases, the crossover sites were (Johnson-Schlitz and Engels 2006; S. L. Andersen and J.
separatedbyseveralmegabases,suggestingthatthesechro- Sekelsky, unpublished data). This is likely to reflect roles
mosomeswerederivedfromdifferentrecombinationevents of BLM in directing noncrossover outcomes of DSB repair.
in the same germline. These were not analyzed further. In Sincethistopicthathasbeendiscussedatlengthelsewhere
another example, both crossover sites fell within an 80-kb (e.g., Andersen and Sekelsky 2010), we restrict the discus-
region within which no additional SNPs were identified. sion below to the less well understood roles of BLM in rep-
This pair was also not analyzed further. In the remaining lication fork repair.
five cases, the two crossover sites were near one another, It has been proposed that BLM catalyzes regression of
consistent with them being bona fide reciprocal crossover blocked forks, a process that is thought to both stabilize
products. the fork against breakage and allow repair complexes to
We used Sanger sequencing to sequence crossover access the damage (Ralf et al. 2006; Wu and Hickson
regions for the seven pairs of reciprocal crossover chromo- 2006). An alternative suggested by genetic experiments in
MitoticCrossoversfromLossofBLMHelicase 113
Figure4 Structuresofreciprocalmitoticcrossoverproducts.(A)Theeuchromaticleftarmofchromosome2isdepictedwiththelocationsofcrossovers
analyzedatthesequencelevel.Themarkerchromosomeisblueandthereferencechromosomeispink.(B)Molecularstructuresofreciprocalcrossover
productsinwhichgeneconversiontractswerenotdetected.Eachlinerepresentsa10-kbregionsurroundingthecrossoversite.Regionsinferredtobe
derivedfromthemarkerchromosomeareshadedinblueandthosefromthereferencechromosomeinpink.Yellowsegmentsrepresentregionswithin
which the chromosomal origin cannot be determined; exchanges occurred with these regions.Vertical lines indicate polymorphisms that were de-
finitively genotyped. In some cases, DNA samples were exhausted before all polymorphisms could be genotyped on both products. (C) Molecular
structuresofreciprocalcrossoverproductswithevidenceforassociatedgeneconversiontracts.ColorsareasinB.Greenboxesindicateregionsofgene
conversion.NotethatforCO6,theregionincludedis17kbinsteadof10kbasinallothercasesinpanelsBandC.
Drosophila is that another enzyme catalyzes regression and fork progression. There are a number of possible explana-
that BLM reverses the regression to allow fork restart after tions. One is that BLM-independent mechanisms of dealing
repair (Andersen et al. 2011). Both models propose that with stalled forks do not involve DSB induction and there-
forksthatcannotberegressedorreversedmayeitherbreak foreareunlikelytoresultincrossovers.Theremaybeoneor
spontaneously or be cleaved by structure-selective endonu- more other helicases that can partially compensate for the
cleases. In the absence of BLM, DSB repair often leads to absenceofBLMatpausedforksinsteadofnuclease-mediated
crossing over, resulting in elevated SCEs (for repair using DSBformation.CandidatesincludeFANCMandMARCAL1,
the sister) or mitotic crossing over (for repair using the as orthologs of these proteins have been implicated in fork
homologous chromosome). reversalinvertebrates(Garietal.2008;Bétousetal.2012).
Interestingly, treatment with hydroxyurea, which is AnotherpossibilityisthatHU-inducedrecombinationoccurs
thoughttosloworstallforkprogression,wasnotassociated only between sister chromatids and would therefore not be
with increased crossover frequency in our studies. Blm detectedinourassay.Itisalsopossiblethatthereductionin
mutants are hypersensitive to killing by the doses used, so dNTP pools precludes recombinational processes that re-
BLM does participate in the response to slowed or stalled quire DNA synthesis. Given that about half the Blm larvae
114 M.C.LaFaveetal.
survive to adulthood at the HU doses used, extensive DNA mitotic crossovers were highly elevated by removal of Dro-
replication must be possible, although recombination may sophila ATR (Figure 1C), although we did not measure dis-
still be inhibited by local or transient reductions in dNTP tribution in this background.
pools. Finally, cells that lack BLM may have no other path- The relationship between BLM, CFSs, and crossovers is
way for managing HU-stalled forks, triggering apoptosis. complex. Sister chromatid exchange is elevated at CFSs
Our assay requires that cells go through meiosis and make (Glover and Stein 1987; Hirsch 1991; Gaddini et al.
mature,functionalsperm.Wedidnotobserveanydecrease 1995). Elevated SCEs is a hallmark of Bloom syndrome cells
inthenumberofprogenyproducedbyBlmmaleswhenthey (Chaganti et al. 1974), but whether the elevation occurs
weretreatedwithHU(datanotshown),suggestingthatcell preferentially at CFSs has not been reported. Nonetheless,
deathwasnotpervasive,butmodestelevationsincelldeath there is a clear connection between BLM and CFSs. Mam-
frequency might still go undetected due to rapid prolifera- maliancellsinculturefrequentlyhaveultrafineDNAbridges
tion in the germline. (UFBs) that are decorated with BLM protein (Chan et al.
KnockingoutNHEJhadnoeffectoncrossoverfrequency 2007). One class of UFB is associated with CFSs and is in-
(Figure1C),despitepreviousstudiesinDrosophilathathave duced by APH (Chan et al. 2009). BLM is present at these
revealed roles for both NHEJ and HR in repairing DSBs in sites in the absence of DSBs and the number of UFBs
the male germline (Preston et al. 2006; Bozas et al. 2009; increases in cells lacking BLM. Because of this, Chan et al.
Beumeretal.2013).Theseexperimentsinvolvedenzymatic (2009)hypothesizedthatBLMhelpstoresolveconnections
induction of DSBs, probably throughout the cell cycle. Nu- betweensisterchromatidsthatariseafterreplicationstress,
merous studies in yeast and mammalian cells indicate that particularly at regions with intrinsic replication difficulties,
NHEJpredominatesduringG1andHRpredominatesduring likeCFSs.IntheabsenceofBLM,linkagesatCFSsaremore
SandG2(reviewedinChapmanetal.2012),soitisperhaps likelyto persistandbreak. Inthis scenario,the elevation in
not surprising that roles for both NHEJ and HR are ob- crossovers is due to a combination of increased DSBs and
served. NHEJ is rarely used to repair breaks produced by differences in the outcome of DSB repair. This is similar to
P-elementexcision,exceptintheabsenceofRad51(McVey the models for fork blockage described above, where BLM
etal.2004a).Itwassuggestedthatexcisionoccursprimarily mayhavearolefirstinpreventingDSBsandsecondinpro-
or exclusively during S and G2, when HR predominates. moting noncrossover repair of any DSBs that do arise.
Similarly, if our crossover assay is responding to DSBs or TheexistenceofCFSsinDrosophilaoffersaparsimonious
other lesions that occur during S phase, they would nor- explanationforthenonrandomdistributionofmitoticcross-
mally be repaired by HR. overs in Blm mutants. Given the resolution of our mapping
Basedonthisdiscussionandpreviouslyproposedmodels, we cannot say whether each of the elevated regions has
we hypothesize that the extreme elevation in crossovers a single CFS or merely a higher density of CFSs than other
observedwhenBLMisabsentisexplainedbyacombination regions. High-resolution mapping of a large number of mi-
of altered processing of replication fork lesions (e.g., pro- toticcrossoverswillanswerthequestionofCFSdensityand
duction of DSBs by cleavage of regressed forks that cannot perhaps provide unique insights into causes of fragility.
bereversed,asinAndersenetal.2011)andlossofamajor In the male germline, crossovers were lowest in the
anticrossoveractivityduringDSBrepairbyHR(reviewedin region that spans that centromere and pericentric hetero-
Andersen and Sekelsky 2010). chromatin(Figure2andFigure3).Chanetal.(2007)noted
that BLMdoes decorate aclass of UFB associated with cen-
Common fragilesitesandthedistribution
tromere regions. They hypothesized that these occur at
ofspontaneousmitotic crossovers
regions that have not completed replication due to the late
We mapped spontaneous mitotic crossovers in the germlines timingofreplicationofheterochromaticsequences,andthat
of males that lack BLM (Figure 2 and Figure 3). Within the BLMhelpstodecatenatesuchunreplicatedregionstoallow
regionanalyzed((cid:1)20%ofthegenome)crossoverdistribution mitosis to proceed. The absence of BLM would be expected
washighlynonrandom.Crossoverslikelyoccurneartheloca- to lead to more DSBs in heterochromatin, and therefore
tionoftheinitiatingevent,suggestingthatsomeregionsofthe more crossovers. The paucity of crossovers in heterochro-
genome are more prone to experiencing these initiating matic regions may result from the use of BLM-independent
events. We hypothesize that these regions may constitute DSB repair pathways in these regions. Given the repetitive
CFSs in Drosophila. In mammalian cells, CFSs are defined natureofheterochromaticsequences,onemightexpectthat
asregionsthatfrequentlyexperiencechromosomebreakage most HR repair of DSBs in heterochromatin will occur
when cells experience inhibition of DNA polymerases, typi- through the single-strand annealing (SSA) pathway, which
cally accomplished by growing cells in a low dose of APH does not require BLM (Johnson-Schlitz and Engels 2006).
(reviewed in Durkin and Glover 2007). In support of our However, Chiolo et al. (2011) found that repair of hetero-
hypothesis, genetically reducing DNA polymerase alpha chromatic DSBs in Drosophila Kc167 cells is dependent on
resultedinahigherrateofmitoticcrossoverswhileretaining Rad51 and Rad54, suggesting that repair occurs through
the same nonrandom distribution. Breakage at CFSs is also HR.Interestingly,breaksweremovedoutoftheheterochro-
increased in ATR mutants (Casper et al. 2002); similarly, matincompartmentofthenucleusbeforeloadingofRad51,
MitoticCrossoversfromLossofBLMHelicase 115
possibly to prevent recombination with other chromosome ated with CFSs or produced in backgrounds that lack BLM
regions with the same repetitive sequences. The authors and additional DNA repair proteins, is therefore likely to
suggest that HR using sister chromatids or perhaps homol- yield important insights into both sources of spontaneous
ogous chromosomes, if they are relocated with the broken lesions and mechanisms of repair.
chromosome,will ensuregenome stability. Our finding that
crossovers between homologous chromosomes are rare in
Acknowledgments
heterochromatic regions suggests that the homolog is not
a frequent template for repair, at least in the male mitotic We thank Mohamed Noor for providing the DEVIAT pro-
germline,perhapsbecauseitdoesnotrelocatewiththebro- gram, Susan Cheek for technical assistance, and Xiaojun
ken chromosome. Guan for analysis of Illumina sequence for identification of
In contrast to the situation in the male germline, cross- SNPs. This work was supported by grants from the National
overs in the female germline appear to be elevated in the InstituteofGeneralMedicalSciences(NIGMS)oftheNational
intervalthatspansthecentromere.Themarkersweuseddid InstitutesofHealthtoJ.S.,underawardsR01GM099890and
not allow us to determine whether these crossovers are R01 GM061252. M.C.L., S.L.A., J.K.H., and K.P.K. were
occurring within the heterochromatin vs. the centromere- supported in part by NIGMS award T32 GM007092. E.P.S.
proximal euchromatin. Likewise, we cannot say what frac- was supported by a grant from the NIGMS division of
tion of the male germline crossovers in this interval are in Training, Workforce Development, and Diversity under the
euchromatin vs. heterochromatin. Nonetheless, we specu- Institutional Research and Academic Career Development
latethatdifferencesinchromatinstructure,perhapsrelated award K12 GM000678.
to the fact that chromosomes undergo synapsis and recom-
bination only in female meiosis, are a major contributor to
differences in mitotic crossover maps. Literature Cited
Molecularstructuresofmitoticcrossovers Adams,M.D.,M.McVey,andJ.Sekelsky,2003 DrosophilaBLMin
double-strand break repair by synthesis-dependent strand an-
Our system for studying spontaneous mitotic crossovers nealing.Science299:265–267.
allowedustosequencebothreciprocalproductsofindividual Alvino,G.M.,D.Collingwood,J.M.Murphy,J.Delrow,B.J.Brewer
crossover events. Most of the crossovers we analyzed had et al.,2007 Replication in hydroxyurea: it’s a matter of time.
Mol.Cell.Biol.27:6396–6406.
structures compatible with current models of crossover
Andersen,S.L.,andJ.Sekelsky,2010 Meioticvs.mitoticrecom-
formation via an intermediate with Holliday junctions—
bination: two different routes for double-strand break repair:
either no detectable gene conversion tract or a single tract the different functions of meiotic vs. mitotic DSB repair are
of conversion. The exception is CO7, which had a complex reflected in different pathway usage and different outcomes.
conversion tract. This type of tract could be the result of Bioessays32:1058–1066.
Andersen, S. L., H. K. Kuo, D. Savukoski, M. H. Brodsky, and J.
multiple cycles of strand invasion, synthesis, and dissocia-
Sekelsky,2011 Threestructure-selectiveendonucleasesarees-
tion.Inthiscase,therewouldhavebeenatleastoneround
sential in the absence of BLM helicase in Drosophila. PLoS
ofDNArepairsynthesisusingthehomologouschromosome Genet.7:e1002315.
asatemplate,followedbyatleastoneroundusingthesister Beranek, D. T., 1990 Distribution of methyl and ethyl adducts
chromatid, and then again using the homologous chromo- followingalkylationwithmonofunctionalalkylatingagents.Mu-
tat.Res.231:11–30.
some. Previous studies demonstrated that repair of large
Bétous, R., A. C. Mason, R. P. Rambo, C. E. Bansbach, A. Badu-
double-stranded gaps in Drosophila involves multiple such
Nkansahetal.,2012 SMARCAL1catalyzesforkregressionand
cycles (McVey et al. 2004a). Although BLM is required for Hollidayjunctionmigrationtomaintaingenomestabilityduring
the dissociation step, there is residual dissociation in Blm DNAreplication.GenesDev.26:151–162.
mutants,dueeithertomaternallyloadedBLMthathasper- Beumer, K. J., J. K. Trautman, K. Mukherjee, and D. Carroll,
2013 DonorDNAutilization duringgenetargeting withzinc-
sisted in the germline or to other helicases that can weakly
fingernucleases.G33:657–664.
compensate for the absence of BLM (Adams et al. 2003).
Boyd,J. B.,M.D. Golino, K. E. S.Shaw, C.J. Osgood,and M.M.
Asdiscussedabove,BLMisthoughttohelptodecatenate Green,1981 Third-chromosomemutagen-sensitivemutantsof
replicationforksthatexperienceproblemswhenconverging Drosophilamelanogaster.Genetics97:607–623.
in regions susceptible to replication difficulties, such as Bozas, A., K. J. Beumer, J. K. Trautman, and D. Carroll,
2009 Genetic analysis of zinc-finger nuclease-induced gene
CFSs. In the absence of BLM, such regions may spontane-
targetinginDrosophila.Genetics182:641–651.
ously break during anaphase or they may be cut by struc-
Casper,A.M.,P.Nghiem,M.F.Arlt,andT.W.Glover,2002 ATR
ture-selective endonucleases. If cuts are introduced at both regulatesfragilesitestability.Cell111:779–789.
forks,thismayleadtoadouble-strandedDNAgap.Repairof Chaganti, R.S.,S.Schonberg, andJ.German, 1974 Amanyfold
gaps in the absence of BLM often results in deletions ex- increase in sister chromatid exchanges in Bloom’s syndrome
lymphocytes.Proc.Natl.Acad.Sci.USA71:4508–4512.
tended into adjacent sequences (Adams et al. 2003; McVey
Chan,K.L.,P.S.North,andI.D.Hickson,2007 BLMisrequired
et al. 2004b). We did not detect any deletions among the
for faithful chromosome segregation and its localization de-
crossovers we analyzed, but our sample size was small. fines a class of ultrafine anaphase bridges. EMBO J. 26:
Analysis of additional crossovers, particularly those associ- 3397–3409.
116 M.C.LaFaveetal.