Simon et al. R1

22 Pages·2013·5.09 MB·English

by  Sebastian Peter Galuska

JBC Papers in Press. Published on May 13, 2013 as Manuscript M113.451112
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M113.451112

Polysialic acid is present in mammalian semen as a posttranslational modification of
NCAM and the polysialyltransferase ST8SiaII

Peter Simon1#, Sören Bäumner1#, Oliver Busch1#, René Röhrich1, Miriam Kaese1, Peter Richterich2,
Axel Wehrend2, Karin Müller3, Rita Gerardy-Schahn4, Martina Mühlenhoff4, Hildegard Geyer1,
Rudolf Geyer1, Ralf Middendorff5 and Sebastian P. Galuska1

From the 1Institute of Biochemistry, Faculty of Medicine, Justus-Liebig-University, Germany; 2Clinic
of Obstetrics, Gynecology and Andrology for Small and Large Animals, Justus-Liebig-University,
Frankfurter Str. 106, 35392 Giessen, Germany; 3Leibniz Institute for Zoo and Wildlife Research,
Alfred-Kowalke-Strasse 17, 10315 Berlin, Germany; 4Institute of Cellular Chemistry, Hannover
Medical School, Germany and the 5 Institute of Anatomy and Cell Biology, Faculty of Medicine,
Justus-Liebig-University, Giessen, Germany
#These authors contributed equally to the work
Running title: Polysialylated form of ST8SiaII and NCAM in mammalian semen
D
o
To whom correspondence should be addressed: Sebastian P. Galuska, Institute of Biochemistry, w
n
Faculty of Medicine, University of Giessen, Germany, Tel. [phone]; Fax. +49 (0) 641- loa
d
e
99-47419; E-mail: [email protected] d
fro
m
Keywords: Polysialic acid; mammalian sperm; Polysialyltransferase, ST8SiaII, NCAM http
://w
Background: Polysialylated glycoproteins play glyco-proteomics approach leads to the w
w
an import role during numerous biological identification of two polySia-carriers. .jb
c
processes. Interestingly, besides NCAM also the .org
Results: Polysialylated ST8SiaII and NCAM are polysialyltransferase ST8SiaII has been found b/
y
components of mammalian semen and are to be a target for polysialylation. Further gu
e
partially associated to spermatozoa. analysis of testis and epididymis tissue st o
n
Conclusion: Polysialic acid represents a further sections demonstrated that only epithelial M
a
glyco-motif in mammalian ejaculates, known to cells of the caput were polySia positive. rc
h
influence the immune system. During the epididymal transit polySia- 2
8
Significance: Administration of polysialic acid carriers were partially integrated into the , 20
1
during insemination might be useful to increase sperm membrane of the postacrosomal 9
the number of spermatozoa escaping the female region. Since polySia is known to counteract
immune system. histone- as well as neutrophil extracellular
trap (NET)-mediated cytotoxicity against host
SUMMARY cells, which plays a role after insemination,
we propose that polySia in semen represents a
Fertilization in animals is a complex sequence
cytoprotective element to increase the number
of several biochemical events beginning with
of vital sperms.
the insemination into the female reproductive
tract and, finally, leading to embryogenesis. In vertebrates, the highly negatively charged
Studies by Kitajima and co-workers carbohydrate polysialic acid (polySia) is known
demonstrated the presence of polysialic acid to influence e.g. the regulation of cell-cell
(polySia) on sea urchin sperms. Based on contact and repulsion (1). In mammalians,
these results, we became interested in the polySia consists of α2,8-linked N-
potential involvement of sialic acid polymers acetylneuraminic acid (Neu5Ac) residues and
in mammalian fertilization. Therefore, we chain length of these polymers can exceed 60
isolated human sperms and performed sialic acid residues (2-6). While most
analyses including Western blotting and mild extracellular glycoproteins are modified by
DMB-HPLC that revealed the presence α2,8- monosialyl residues, polysialylation is restricted
linked polySia chains. Further analysis by a to a small number of N- and O-glycosylated
1
Copyright 2013 by The American Society for Biochemistry and Molecular Biology, Inc.
proteins. The best characterized target for NCAM in mammalian semen. Thus, polySia
polysialylation is the neural cell adhesion carriers may influence processes localized in the
molecule NCAM (7). Here, glycans at the fifth female reproductive tract.
and sixth N-glycosylation site can be
posttranslationally modified with sialic acid EXPERIMENTAL PROCEDURES
polymers (8-11). The modification of NCAM
with polySia creates a bulky and highly
Materials – NCAM-specific monoclonal
negatively charged moiety, which leads to an
antibody (mAb) 123C3 (32,33) and polySia-
inhibition of the homophilic trans as well as cis
specific mAb 735 (33) as well as inactive and
interaction between NCAM molecules
active endoneuraminidase (endoN) were purified
modulating the adhesive properties of eukaryotic
as described previously (34,35). MAbs against
cells (12-17).
human ST8SiaII and ST8SiaIV were purchased
More recently, four additional polysialylated
from Sigma-Aldrich (Taufkirchen, Germany).
glycoproteins have been identified: (I) a not in
detail specified α-subunit of a voltage-gated
Separation of vital sperms – For enrichment
sodium channel in adult rat brain (18), (II) a
of vital human sperms a swim-up procedure was
soluble form of CD36 in murine and human milk
applied. For this purpose, 1 mL native ejaculate
(19), (III) neuropilin-2 on human mature
was stacked under 5 mL TALP medium (2 mM
dendritic cells (mDC) (20) as well as (IV) the D
CaCl , 3.1 mM KCl, 0.4 mM MgCl , 100 mM o
synaptic cell adhesion molecule SynCAM1 in 2 2 wn
postnatal murine brain (21). 1NmaCMl, s2o5d iummM p yNruavHaCteO, 31, 0 0m.3 Mm MHE PNEaSH, 2P2O1.46, loade
In mammalians, the generation of polySia mM sodium lactate, 20% fetal bovine serum d fro
depends on the presence of the α2,8- m
pDoellyestiioalny ltorfa nbsofethra seensz ySmTe8sS iianI I maincde lSeTad8sS iatoIV a. (6v0/ vm))i.n A, f3te rm iLn coufb atthioe ns uatp e3r7n°aCta annt do f5 %ea cChO w2 feolrl http://w
were isolated and centrifuged for 10 minutes at w
mortal phenotype since polySia is involved in w
the development of several essential organs like 700 × g. Enriched mobile sperms were used for .jbc
further analyses. .o
the brain, heart, kidney, pancreas and the rg
b/
respiratory tract (22-25). Interestingly, both y
Protein extraction and isolation of g
polysialyltransferases are able to polysialylate polysialylated proteins – Whole ejaculate was ues
their N-glycans in cell culture experiments (26- t o
diluted in water and homogenized. Precipitation n
28). However, such an autopolysialylation has M
of proteins was performed by adding four parts a
been, so far, not reported in vivo. acetone of -20°C per part sample. After rch 2
PolySia is not only expressed in vertebrates but 8
incubation at -20°C over night, protein pellet , 2
also in other clades (29) like sea urchins (30). In was isolated by centrifugation and lyophilized to 019
contrast to vertebrates, however, also α2,9- and dryness.
α2,5Oglycolyl-linked polySia exist in addition to Alternatively, polysialylated proteins were
the α2,8-linked form. Kitajima and co-workers isolated from enriched vital sperm by affinity
could show that polySia mediates important precipitation. To this end, samples were
functions of sea urchin sperms. For instance, homogenized in lysis buffer (50 mM Tris/HCl
α2,9-linked polySia is suggested to influence the (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1%
motility of sea urchin sperms (31) and TritonX-100 (w/v), 0.5 % sodium deoxycholate
α2,5O -linked polySia is discussed to (w/v), 1 mM PMSF, 1 mM Aprotinin and 1 mM
glycolyl
potentiate the acrosome reaction (30). The Leupeptin) on ice. Homogenized samples were
function of α2,8-linked polySia has not been incubated for 2 hours at 4°C on a shaker and
studied to date. centrifuged for 1 hour at 4°C. For affinity
Since benefiting organs are often independently precipitation, inactivated endoN was coupled to
developed in different species during evolution tosylactivated magnetic dynabeads® M-280
(e.g. eye of vertebrates and sepia) we (Invitrogen, Darmstadt, Germany) according to
investigated, in the present study, mammalian the manufacturer’s instructions and incubated
semen for the existence of polysialylated with the supernatant over night at 4°C on a
glycoproteins. Our data reveal the presence of shaker. Subsequently, beads were washed twice
polysialylated ST8SiaII besides polysialylated each with 1 mL washing buffer 1 (20 mM
2
Tris/HCl (pH 8.0), 150 mM NaCl, 0.5% Triton- adjusting the sample buffer to the final
X 100 (w/v)) and washing buffer 2 (20 mM concentration of 50 mM sodium phosphate, pH
Tris/HCl (pH 8.0), 150 mM NaCl). 7.5, 40 mM DTT, 0.5% SDS (w/v), and 1% NP-
Polysialylated proteins were disconnected from 40 (v/v), precipitates were incubated with
magnetic beads with elution buffer (100 mM PNGaseF (50 U/ml) (Roche Applied Science,
triethylamine, 150 mM NaCl) and dried down in Mannheim, Germany) for 16 h at 37°C. EndoN
a vacuum concentrator. digest (1 µg/ml) was performed in lysis buffer
for 16 h at 37°C.
HPLC analysis of sialic acid polymers – For
detection of internal, α2-8-linked sialic acid Glycoproteomics approach – Eluted
residues, the C7/C9 method described by Sato et polysialylated proteins were separated by
al. (36) was applied. After oxidation, reduction electrophoresis on 10% ready-to-use SDS gels
and fluorescence labeling resulting DMB- (Bio-Rad, Munich, Germany), followed by in-
derivatives were analyzed on a Superspher 100 gel digestion with trypsin (Promega, Mannheim,
C-18 column (250 × 40 mm, Merck-Hitachi, Germany) as described in detail previously (21).
Darmstadt, Germany) at 40°C using a Merck- Extracted peptides were separated on a C18
Hitachi HPLC system (37). Mobile phases column (PepMap, 3 µm, 75 µm×100 mm,
methanol / acetonitrile / water / trifluoracetic Dionex) using an Ultimate nanoLC system
acid (TFA) (4:4:92:0.1) (M ) and methanol / (Dionex) with a linear gradient from 10% D
1 o
w
acetonitrile / water / TFA (45:45:10:0.1) (M ) acetonitrile/0.1% formic acid to 60% n
2 lo
were used for separation of DMB-labeled sialic acetonitrile/0.1% formic acid. Peptides were ad
e
acids. A linear gradient was applied from 0% to directly spotted by a Probot (Dionex) onto a d fro
20% M in 35 min at a flow rate of 0.3 mL/min. matrix-assisted laser desorption / ionization m
2 h
The degree of polymerization (DP) of time-of-flight (MALDI-TOF) steel target ttp
polySia chains was analyzed by DMB-HPLC (Bruker Daltonics, Bremen, Germany) and ://w
w
analysis (38,39). To this end, purified polySia- mixed with an equal volume of 2,5- w
carriers were dissolved in 80 µl DMB reaction dihydrobenzoic acid (DHB) matrix (7.5 mg .jbc
.o
buffer, and incubated for 24 h at 4°C. The DHB/ml, 1% phosphoric acid, 50% acetonitrile). rg
reaction was stopped by adding 20 µl 1 mM Peptide mass fingerprints of tryptic digests were by/
g
NaOH, and released polySia chains were generated by MALDI-TOF-MS using an ue
s
separated on a DNAPac PA-100 column Ultraflex I TOF/TOF mass spectrometer (Bruker t o
n
(Dionex, Idstein, Germany) by HPLC (37). Daltonics). MS and MS/MS spectra were M
a
MilliQ water (E1) and 1 M NaNO3 (E2) were acquired in positive reflector mode using rch 2
used as eluents at a flow rate of 1 ml/min. FlexControl 2.4 software, and analyzed by the 8
, 2
Elution was performed by the following FlexAnalysis software 3.0 (both Bruker 01
9
gradient: T = 0% E2; T = 1% E2; T = Daltonics). External calibration of mass spectra
0 min 5 min 15 min
10% E2; and T = 50% E2. was carried out using peptide calibration
60 min
standard for MS (Bruker-Daltonics), and
SDS-PAGE and Western Blotting – Total annotations of fragment ions in the MS/MS
protein lysates as well as purified polysialylated mode was performed according to (40).
proteins were separated by 10% SDS-PAGE
under reducing conditions and, subsequently, Immunhistochemistry / Immunofluorescence
transferred onto a PVDF membrane. Binding of – Paraffin embedded testis and epididymis tissue
anti-polySia, anti-NCAM as well as anti- (formalin fixed) sections were cut into 5 µm
ST8SiaII and ST8SiaIV mAbs was detected by serial sections. After rehydration in xylene and a
use of horseradish peroxidise-conjugated following ascending ethanol series, sections
secondary antibodies (Dako, Hamburg, were incubated with blocking solution for 5 min,
Germany) and chemiluminescence SuperSignal followed by incubation with the primary
kit (Thermo Fisher, Kehl, Germany). Prior to antibody mAb 735 (10 µg/ml PBS containing
SDS-PAGE, a part of the samples were treated 2% (w/v) bovine serum albumin (BSA))
with endoN or peptide-N-glycosidase F (PNGase overnight at 4°C. As negative control for the
F). For the release of N-glycans polySia-staining, before incubation with mAb
immunoprecipitates were resuspended in 40 mM 735 tissue sections were pretreated with endoN
DTT, 0.5% SDS and boiled for 10 min. After (3 µg/ml in PBS containing 0.1% BSA)
3
overnight at 37°C. For staining the Envision+ AGCCTTGTACGGAATGTTGG -
System HRP Kit (Dako) was used. The stained 3´.
sections were counterstained with hemalaun cDNA samples were denatured at 95°C for
(Roth, Karlsruhe, Germany). 3:30 min, followed by 35 cycles of each 20 s at
For immunofluorescence, sperms were washed 95°C, 20 s at 60°C and 20 s at 72°C. For
with PBS/0.1% BSA pH 7.4 and centrifuged at meltcurve analysis PCR samples were slowly
700 × g by discarding the supernatant. Purified heated from 72°C to 95°C and finally stored at
sperms were fixed in PBS pH 7.4 containing 2% 20°C. Amplified products were separated by gel
formaldhyde (v/v) for 30 minutes at 22°C. After electrophoresis using 2% agarose gel.
fixation, sperms were washed with PBS/0.1%
BSA. For negative control of the polySia RESULTS
staining as well as the staining against NCAM
and ST8SiaII sperms were pre-treated with Detection of polySia in human semen. For
endoN (3 µg/ml in PBS/0.1% BSA) overnight at the detection of internal sialic acid residues in
37°C. Primary antibodies were incubated over human semen proteins thereof were subjected to
night at 4 °C. For the visualization of the C7/C9 analysis after acetone precipitation. To
acrosome biotinylated peanut agglutinin (PNA) this end, all terminal sialic acid molecules were
(20 µg/ml in PBS/0,1% BSA) (Vector transformed into C7 residues by periodate
Laboratories Burlingame, CA) was used. FITC oxidation. Due to the α2,8-linkage, internal sialic D
o
w
(fluoresceinisothiocyanate) or Rhodamin residues are protected against oxidation because n
lo
(Dianova, Hamburg, Germany) conjugated no vicinal hydroxyl groups exist, which are ad
e
d
secondary antibodies against mouse IgG and necessary for oxidation. In a last step, all sialic fro
biotin were used for visualization of the primary acid residues were released under acidic m
h
antibodies. All images were taken with a Leica conditions and labeled with DMB. Resulting C7- ttp
DMR Microscope and processed by Neu5Ac-DMB and C9-Neu5Ac-DMB were ://w
w
MetaMorph® Microscopy Automation & Image separated by RP-HPLC (Figure 1A). The w
Analysis Software ©2012 Molecular Devices, detection of C9-Neu5Ac-DMB after periodate .jbc
.o
LLC. oxidation indicated the presence of internal α2,8- rg
b/
linked sialic acid residues linked to proteins of y
g
mRNA analyses of ST8SiaII and ST8SiaIV and human semen. However, the analysis of di-, tri- ue
s
NCAM – Total cellular RNA was prepared from and oligomers of Neu5Ac might also lead to t o
n
rat epididymis at the time of explantation by comparable chromatograms. Hence, detection of M
a
RNAeasy micro kit (Qiagen, Hilden, Germany). internal sialic acid residues is not an rch
2
Subsequently, first strand cDNA was generated unambiguous proof for the presence of polySia. 8
, 2
by iScript cDNA Synthesis Kit (Bio Rad For this reason, the chain length was 01
9
Laboratories). analyzed in more detail. Therefore, polySia
Intron spanning primers were used to amplify chains were cleaved off the glycans under mild
ST8Sia II, ST8Sia IV and NCAM targets using acidic conditions and tagged directly with DMB
SYBR Green Real-Time PCR Master Mixes at the reducing end. Fluorescently labeled chains
(Invitrogen life technologies) according to were separated by anion exchange
manufacturers introductions. Primers used in chromatography according to the DP (3,41,42).
quantitative PCR expression analysis: NCAM As shown in figure 1B, obtained
for 5´- CAAAAATGACGAAGCCGAAT chromatographic profiles show that polySia
- 3´; NCAM rev 5´- chains can comprise more than 40 sialic acid
GTGGACGTTCTCCAGGTGAT - residues.
3´, ST8Sia II for 5´- In addition to the chemical detection of
GTGGAGTGGGTCAATGCTCT - polySia, we performed a dot blot analysis with a
3´; ST8Sia II rev 5´- mAb against α2,8-linked polySia (Figure 1C).
GGTACTTGACGGGGTTCTGA - The protein fraction of human ejaculate revealed
3´; ST8Sia IV for 5´- a strong polySia signal, whereas the immune
GGACTGAGGAGCACCAAGAG - staining was abolished after the degradation of
3´; ST8Sia IV rev 5´- polySia by endoN. Taken together, the chemical
and immunological analyses of human semen
disclosed the existence of α2,8-linked polySia
4
chains, which can reach a length of more than 40 N- or O-glycans of ST8SiaII were modified by
sialic acid residues. polySia, purified polysialylated glycoproteins of
human semen were treated with PNGaseF.
ST8SiaII and NCAM are polysialylated. For Resulting de-N-glycosylated proteins were
identification of the polysialylated proteins rat exposed to Western blotting using a mAb against
epididymis was used storing maturated polySia. After the release of N-glycans the
spermatozoa. At first polySia-carriers were immunostaining was abolished indicating that
purified from epididymal lysates using magnetic polySia chains together with the N-glycans were
beads, which were coated with enzymatically released with PNGaseF (Figure 4 A).
inactive endoN. EndoN contains an extended To identify the polysialylated N-
binding site for polySia and targeted mutation of glycosylation sites polysialylated tryptic
active site residues gives rise to an inactive form glycopeptides were purified using magnetic
that works as an efficient polySia-specific lectin endoN beads. The isolated polysialylated
(35,43). Purified polySia-carriers were subjected glycopeptides were separated by nanoLC and
to Western blotting against polySia. As shown in analyzed by MALDI-TOF-MS with or without
Figure 2A polySia-immunostaining displayed a previous PNGaseF treatment. In comparison to
typical diffuse band for polysialylated proteins the untreated sample, de-N-glycosylation with
in a region between 100 - 200 kDa. To generate PNGaseF resulted in the detection of one
peptide mass fingerprints of the polysialylated additional mass at m/z 1322.8 (Figure 4B). This D
o
w
glycoproteins a SDS-PAGE was performed and peptide signal matched to the calculated n
lo
two gel slices in the area of the immune signal deglycosylated peptide mass of the fifth N- ad
e
against polySia were used for tryptic in gel glycosylation site after conversion of Asn to Asp d fro
digest. Resulting peptides were extracted, by the enzymatic reaction of PNGaseF (Asn ; m
219 h
separated by RP-nanoLC and directly spotted A213FEDLVNATWR223). The peptide sequence ttp
onto a MALDI-TOF-MS carrier for MS(/MS)- was, additionally, proofed by MALDI-TOF- ://w
w
analysis. Resulting mass spectra were utilized MS/MS (Figure 4C). The analysis estimated that w
for data base search leading to the identification the signal at m/z 1322.8 represents the .jbc
.o
ofifn dSinTg8sS iaIwI eraen d cNonCfAirMme d( Figbuyr e 2aBdd).i tioTnhael wdehgilcyhc oissy llaotceadt edN -bgelytwcoeseynl atthioen sisaitley ltarat nAsfsenra21s9e, byrg/
g
fragmentation analyses of selected peptides motif L (SiaM-L) and the polysialyltransferase ue
s
(Suppl. 1). domain (PSTD) (Figure 4D). t o
n
After MS(/MS) based identification of ST8SiaII M
a
and NCAM in rat epididymal tissue, their PolySia-carriers are detectable in the rch
2
presence in human semen was approved by postacrosomal region of mammalian sperms. 8
, 2
Western blotting. Purification of the polySia- Formalin fixed human, bovine and rat sperms 0
1
9
carriers with magnetic endoN-beads and were used for the visualization of polySia. The
immunostaining against ST8SiaII as well as immunostaining displayed a polySia positive
NCAM were employed. Whereas the area on the surface of the head (Figure 5A and
polysialylated forms of both glycoproteins were B). However, more than 90% of all sperms were
hardly (NCAM) or not (ST8SiaII) detectable, the polySia negative in all analyzed species. When
underlying proteins NCAM-140 and ST8SiaII sperms were pretreated with endoN, no polySia
could be visualized after removal of polySia by positive sperms were detectable.
endoN treatment (Figure 3). The poor visibility Immunostaining with mAb against NCAM and
of the polysialylated forms of NCAM and ST8SiaII using human sperms provided
ST8SiaII can be explained by the bulky and comparable results (Figure 5C and D). For the
highly negative properties of polySia. The detection of the protein backbone of both
antibody-protein binding might be similarly polySia carriers a degradation of polySia with
inhibited as the NCAM-NCAM interaction. endoN was necessary.
For a more detailed localization of the
PolySia chains are attached to N-glycans of polySia-carriers the acrosome was visualized
the 5th potential N-glycosylation site of ST8SiaII. using the lectin PNA demonstrating that the
In the case of NCAM it is well known that N- polysialylated proteins were located in the
glyans at the fifth and sixth N-glycosylation site postacrosomal area of the head as exemplary
can be polysialylated (8-11). To dissect whether shown for human and bovine sperms (Figure
5
5E). In the case of human sperms, polysialylated DISCUSSION
proteins were primarily present on a part of the
postacrosomal area close to the tail. In contrast
to human sperms, the complete bovine In adult mammals the carbohydrate polymer
postacrosomal area was polySia positive. polySia is mainly expressed in neuronal tissue
Comparable results were obtained with rat (1,22-24). However, more and more reports
sperms (data not shown). associate polysialylated glycoconjugates also
with other physiological systems (20,46-49).
Epithelial cells of the epididymis express Since different polySia species contribute to the
polysialylated proteins. Spermatogenesis takes sperm motility and the acrosome reaction of sea
place in the testis resulting in the generation and urchin sperms (30), we investigated human
release of morphologically differentiated ejaculates for the presence of polysialylated
spermatids (44). However, these are neither proteins. Thereby, α2,8-linked polySia could be
motile nor capable to fertilize. Therefore, detected in human semen attached to two
maturation of sperms in the epididymis is different glycoproteins. One of these polySia-
essential, which comes along, amongst others, carriers was NCAM. Surprisingly, the second
with a change of the cell surface distribution of identified target for polysialylation was the
glycoconjugates. Consequently, it is possible polysialyltransferase ST8SiaII. More than
that polySia is present on the surface of all sixteen years ago, autopolysialylation of D
o
w
sperms when they leave the testis and that during polysialyltransferases was first observed in vitro n
lo
the maturation in the epididymis the sialic acid and later also in cell culture experiments ad
e
polymers are degraded. A second possibility is (26,28,50,51). The observed autopolysialylation d fro
that polysialylated NCAM and ST8SiaII reach occurred only in the absence of NCAM and was m
h
the postacrosomal region during the transfer never observed in vivo so far. Consequently, ttp
through the epididymis. Many essential proteins polysialylation of ST8SiaII and ST8SiaIV was ://w
w
are integrated into the plasma membrane of often declared as a biochemical phenomenon, w
sperms during the epididymal transit, which are which takes place only under artificial .jbc
.o
generated and released in so-called conditions. However, by identifying ST8SiaII as rg
epididymosomes by epithelial cells (45). To polySia carrier in mammalian semen, we now by/
g
address this point, paraffin embedded tissue demonstrate for the first time that polysialylation ue
s
sections of testis as well as epididymis from of polysialyltransferases occurs also in vivo. t o
n
mice were examined for polySia. In tubuli of the Besides polysialylated NCAM and ST8SiaII no M
a
testis no specific immune signal against polySia further polysialylated glycoproteins could be rch
2
occurred including spermatogonia, identified although. Nevertheless, a proteomics 8
, 2
spermatocytes, spermatids and sertoli cells approach can never completely assure that all 0
1
9
(Figure 6A). In contrast, a vesicular staining proteins were identified.
against polySia was visible in epithelial cells of In agreement with in cellulo as well as in
epididymis (Figure 6B). The polySia expressing vitro experiments concerning the polysialylated
epithelial cells were located in the caput of the glycosylation sites of ST8SiaII, we detected
epididymis. Comparable results were obtained polySia chains on N-glycans of glycosylation
when rat and roebuck epididymis were analyzed site 5 in vivo (52). In addition to this
(data not shown). glycosylation site, N-glycans of the third
Furthermore, gene transcripts of glycosylation were discussed to be a target for
polysialyltransferases ST8SiaII and ST8SiaIV autopolysialylation. However, we never
were analyzed by RT-PCR demonstrating observed a peptide signal corresponding to de-
expression of ST8SiaIV in addition to the targets N-glycosylated glycosylation site 3.
for polysialylation ST8SiaII and NCAM in the Interestingly, polysialylated NCAM and
epididymis (Suppl. 2). The signal intensity of ST8SiaII were present in the postacrosomal
ST8SiaIV was comparable with the signal region of mammalian sperms. To determine the
intensity of NCAM. However, expression level origin of polySia, tissue sections of testis and
of ST8SiaII was lower than the obtained signal epididymis were investigated demonstrating that
for ST8SiaIV and NCAM gene transcripts. polySia was expressed by epithelial cells of the
caput. It is well known, that epithelial cells in all
parts of the epididymis release so-called
6
epididymosomes containing a number of from this system. Interestingly, high levels of
different glycoproteins, which are integrated into DNase in seminal plasma have been associated
the membrane of sperms during maturation (53- with higher fertility in bovine systems (66,67).
56). Epididymosomes contain, e.g., proteins, The most cytotoxic entities of NET for
which are necessary to prevent a killing of endogenous cells, however, are the extracellular
sperms by the innate and adaptive immune histones (68). Consequently, sperms and
system of females. Many studies indicated that epithelial cells would be negatively influenced
insemination leads to a recruitment of immune by exaggerated NET formation and the
cells (57-59). Mammalian seminal plasma and formation of nucleosomes after degradation of
sperms contain different components to DNA. Recently, we could show that α2,8-linked
counteract this activation of the female immune polySia of bacteria and humans can diminish the
system. For example, N-glycans in semen cytotoxicity of extracellular histones as well as
containing the Lewisx and Lewisy epitope are nucleosomes and, therefore, may represent a
discussed to inhibit the innate and adaptive cytoprotective component (68-70). Thus,
immune system of women (60). Intriguingly, polySia attached to NCAM and ST8SiaII as a
α2,8-linked polySia influences also the immune content of mammalian ejaculates may act in the
system. For example, tissue macrophages same manner in the female reproductive tract
express siglec-11 that is capable to bind α2,8- increasing the number of surviving sperms as
linked polySia (61). In this way polySia illustrated in Figure 7. In terms of declining D
o
w
suppresses the immune response of tissue semen quality in men (71,72) administration of n
lo
macrophages in the brain (microglia) after polySia during insemination could represent a ad
e
lipopolysaccharide (LPS) stimulation (62). Thus, useful strategy to increase number of sperms, d fro
secreted and partially integrated polySia-carriers which are able to escape the innate immune m
h
may also contribute to the immune suppression. system of women. ttp
The main population of invading immune In summary, we were able to show that ://w
w
cells after insemination consists of neutrophils. polysialylated ST8SiaII as well as NCAM are w
One mechanism of neutrophils against invading partially integrated in the postacrosomal region .jbc
.o
microorganisms is the formation of neutrophil of a subfraction of sperms. Based on previous rg
extracellular traps (NET). Thereby, neutrophils findings, these polySia carriers may represent a by/
g
sacrifice themselves and histone containing cytoprotective and/or immune modulatory ue
s
DNA forms together with anti-microbial element of mammalian ejaculates. However, the t o
n
enzymes and peptides a meshwork to capture precise role of polySia and, particularly, the M
a
and kill pathogens (63,64). After insemination reason for the polysialylation of ST8SiaII in rch
2
neutrophils generate NET and sperms entangle addition to NCAM needs to be further 8
, 2
in this network of DNA and histones (65). investigated. 0
1
9
DNase of the seminal plasma, however,
degrades DNA and spermatozoa can escape

7
REFERENCES

1. Rutishauser, U. (2008) Polysialic acid in the plasticity of the developing and adult
vertebrate nervous system. Nat Rev Neurosci 9, 26-35
2. Galuska, S. P., Oltmann-Norden, I., Geyer, H., Weinhold, B., Kuchelmeister, K.,
Hildebrandt, H., Gerardy-Schahn, R., Geyer, R., and Mühlenhoff, M. (2006)
Polysialic acid profiles of mice expressing variant allelic combinations of the
polysialyltransferases ST8SiaII and ST8SiaIV. J Biol Chem 281, 31605-31615
3. Inoue, S., and Inoue, Y. (2001) A challenge to the ultrasensitive chemical method for
the analysis of oligo- and polysialic acids at a nanogram level of colominic acid and a
milligram level of brain tissues. Biochimie 83, 605-613
4. Inoue, S., and Inoue, Y. (2001) Developmental profile of neural cell adhesion
molecule glycoforms with a varying degree of polymerization of polysialic acid
chains. J Biol Chem 276, 31863-31870
5. Inoue, S., Lin, S. L., and Inoue, Y. (2000) Chemical analysis of the developmental
pattern of polysialylation in chicken brain. Expression of only an extended form of
polysialyl chains during embryogenesis and the presence of disialyl residues in both
D
embryonic and adult chicken brains. J Biol Chem 275, 29968-29979 o
w
n
6. Nakata, D., and Troy, F. A., 2nd. (2005) Degree of polymerization (DP) of polysialic lo
a
d
acid (polySia) on neural cell adhesion molecules (N-CAMS): development and e
d
application of a new strategy to accurately determine the DP of polySia chains on N- fro
m
CAMS. J Biol Chem 280, 38305-38316 h
ttp
7. Finne, J. (1982) Occurrence of unique polysialosyl carbohydrate units in ://w
w
glycoproteins of developing brain. J Biol Chem 257, 11966-11970 w
8. Angata, K., Suzuki, M., and Fukuda, M. (1998) Differential and cooperative .jbc
.o
polysialylation of the neural cell adhesion molecule by two polysialyltransferases, rg
b/
PST and STX. J Biol Chem 273, 28524-28532 y
g
u
9. Nelson, R. W., Bates, P. A., and Rutishauser, U. (1995) Protein determinants for e
s
t o
specific polysialylation of the neural cell adhesion molecule. J Biol Chem 270, 17171- n
M
17179 a
rc
h
10. Liedtke, S., Geyer, H., Wuhrer, M., Geyer, R., Frank, G., Gerardy-Schahn, R., 2
8
Zahringer, U., and Schachner, M. (2001) Characterization of N-glycans from mouse , 2
0
1
brain neural cell adhesion molecule. Glycobiology 11, 373-384 9
11. von Der Ohe, M., Wheeler, S. F., Wuhrer, M., Harvey, D. J., Liedtke, S., Muhlenhoff,
M., Gerardy-Schahn, R., Geyer, H., Dwek, R. A., Geyer, R., Wing, D. R., and
Schachner, M. (2002) Localization and characterization of polysialic acid-containing
N-linked glycans from bovine NCAM. Glycobiology 12, 47-63
12. Bruses, J. L., and Rutishauser, U. (2001) Roles, regulation, and mechanism of
polysialic acid function during neural development. Biochimie 83, 635-643
13. Fujimoto, I., Bruses, J. L., and Rutishauser, U. (2001) Regulation of cell adhesion by
polysialic acid. Effects on cadherin, immunoglobulin cell adhesion molecule, and
integrin function and independence from neural cell adhesion molecule binding or
signaling activity. J Biol Chem 276, 31745-31751
14. Rutishauser, U. (1992) NCAM and its polysialic acid moiety: a mechanism for
pull/push regulation of cell interactions during development? Dev Suppl, 99-104
15. Rutishauser, U. (1996) Polysialic acid and the regulation of cell interactions. Curr
Opin Cell Biol 8, 679-684
16. Tang, J., Landmesser, L., and Rutishauser, U. (1992) Polysialic acid influences
specific pathfinding by avian motoneurons. Neuron 8, 1031-1044
8
17. Walsh, F. S., and Doherty, P. (1997) Neural cell adhesion molecules of the
immunoglobulin superfamily: role in axon growth and guidance. Annu Rev Cell Dev
Biol 13, 425-456
18. Zuber, C., Lackie, P. M., Catterall, W. A., and Roth, J. (1992) Polysialic acid is
associated with sodium channels and the neural cell adhesion molecule N-CAM in
adult rat brain. J Biol Chem 267, 9965-9971
19. Yabe, U., Sato, C., Matsuda, T., and Kitajima, K. (2003) Polysialic acid in human
milk. CD36 is a new member of mammalian polysialic acid-containing glycoprotein.
J Biol Chem 278, 13875-13880
20. Curreli, S., Arany, Z., Gerardy-Schahn, R., Mann, D., and Stamatos, N. M. (2007)
Polysialylated neuropilin-2 is expressed on the surface of human dendritic cells and
modulates dendritic cell-T lymphocyte interactions. J Biol Chem 282, 30346-30356
21. Galuska, S. P., Rollenhagen, M., Kaup, M., Eggers, K., Oltmann-Norden, I., Schiff,
M., Hartmann, M., Weinhold, B., Hildebrandt, H., Geyer, R., Muhlenhoff, M., and
Geyer, H. (2010) Synaptic cell adhesion molecule SynCAM 1 is a target for
polysialylation in postnatal mouse brain. Proc Natl Acad Sci U S A 107, 10250-10255
22. Lackie, P. M., Zuber, C., and Roth, J. (1990) Polysialic acid and N-CAM localisation
D
in embryonic rat kidney: mesenchymal and epithelial elements show different patterns ow
n
of expression. Development 110, 933-947 lo
a
d
23. Lackie, P. M., Zuber, C., and Roth, J. (1991) Expression of polysialylated N-CAM ed
during rat heart development. Differentiation 47, 85-98 from
h
24. Lackie, P. M., Zuber, C., and Roth, J. (1994) Polysialic acid of the neural cell ttp
adhesion molecule (N-CAM) is widely expressed during organogenesis in ://w
w
mesodermal and endodermal derivatives. Differentiation 57, 119-131 w
.jb
25. Weinhold, B., Seidenfaden, R., Rockle, I., Muhlenhoff, M., Schertzinger, F., c
.o
Conzelmann, S., Marth, J. D., Gerardy-Schahn, R., and Hildebrandt, H. (2005) brg/
y
Genetic ablation of polysialic acid causes severe neurodevelopmental defects rescued g
u
by deletion of the neural cell adhesion molecule. J Biol Chem 280, 42971-42977 es
t o
26. Close, B. E., and Colley, K. J. (1998) In vivo autopolysialylation and localization of n M
the polysialyltransferases PST and STX. J Biol Chem 273, 34586-34593 arc
h
27. Close, B. E., Mendiratta, S. S., Geiger, K. M., Broom, L. J., Ho, L. L., and Colley, K. 2
8
J. (2003) The minimal structural domains required for neural cell adhesion molecule , 20
1
9
polysialylation by PST/ST8Sia IV and STX/ST8Sia II. J Biol Chem 278, 30796-
30805
28. Muhlenhoff, M., Eckhardt, M., Bethe, A., Frosch, M., and Gerardy-Schahn, R. (1996)
Autocatalytic polysialylation of polysialyltransferase-1. Embo J 15, 6943-6950
29. Troy, F. A., 2nd. (1992) Polysialylation: from bacteria to brains. Glycobiology 2, 5-23
30. Miyata, S., Sato, C., and Kitajima, K. (2007) Glycobiology of Polysialic Acid on Sea
Urchin Gametes. TIGG 19, 85-98
31. Miyata, S., Sato, C., Kumita, H., Toriyama, M., Vacquier, V. D., and Kitajima, K.
(2006) Flagellasialin: a novel sulfated alpha2,9-linked polysialic acid glycoprotein of
sea urchin sperm flagella. Glycobiology 16, 1229-1241
32. Gerardy-Schahn, R., Eckhardt, M., Ledermann, J., and Kemshead, J. T. (1994)
Topography of NCAM antigenic epitopes recognized by SCLC-cluster-1 antibodies.
A consensus view. Int J Cancer Suppl 8, 27-29
33. Moolenaar, C. E., Muller, E. J., Schol, D. J., Figdor, C. G., Bock, E., Bitter-
Suermann, D., and Michalides, R. J. (1990) Expression of neural cell adhesion
molecule-related sialoglycoprotein in small cell lung cancer and neuroblastoma cell
lines H69 and CHP-212. Cancer Res 50, 1102-1106
9
34. Frosch, M., Gorgen, I., Boulnois, G. J., Timmis, K. N., and Bitter-Suermann, D.
(1985) NZB mouse system for production of monoclonal antibodies to weak bacterial
antigens: isolation of an IgG antibody to the polysaccharide capsules of Escherichia
coli K1 and group B meningococci. Proc Natl Acad Sci U S A 82, 1194-1198
35. Stummeyer, K., Dickmanns, A., Muhlenhoff, M., Gerardy-Schahn, R., and Ficner, R.
(2005) Crystal structure of the polysialic acid-degrading endosialidase of
bacteriophage K1F. Nat Struct Mol Biol 12, 90-96
36. Sato, C., Inoue, S., Matsuda, T., and Kitajima, K. (1998) Development of a highly
sensitive chemical method for detecting α2-8-linked oligo/polysialic acid residues in
glycoproteins blotted on the membrane. Anal Biochem 261, 191-197
37. Galuska, S. P., Geyer, H., Mink, W., Kaese, P., Kuhnhardt, S., Schafer, B.,
Muhlenhoff, M., Freiberger, F., Gerardy-Schahn, R., and Geyer, R. (2012) Glycomic
strategy for efficient linkage analysis of di-, oligo- and polysialic acids. J Proteomics
75, 5266-5278
38. Galuska, S. P., Oltmann-Norden, I., Geyer, H., Weinhold, B., Kuchelmeister, K.,
Hildebrandt, H., Gerardy-Schahn, R., Geyer, R., and Muhlenhoff, M. (2006)
Polysialic Acid Profiles of Mice Expressing Variant Allelic Combinations of the
D
Polysialyltransferases ST8SiaII and ST8SiaIV. J. Biol. Chem. 281, 31605-31615 ow
n
39. Inoue, S., Lin, S. L., Lee, Y. C., and Inoue, Y. (2001) An ultrasensitive chemical lo
a
d
method for polysialic acid analysis. Glycobiology 11, 759-767 ed
40. Roepstorff, P., and Fohlman, J. (1984) Proposal for a common nomenclature for from
h
sequence ions in mass spectra of peptides. Biomed Mass Spectrom 11, 601 ttp
41. Galuska, S. P., Oltmann-Norden, I., Geyer, H., Weinhold, B., Kuchelmeister, K., ://w
w
Hildebrandt, H., Gerardy-Schahn, R., Geyer, R., and Muhlenhoff, M. (2006) w
.jb
Polysialic acid profiles of mice expressing variant allelic combinations of the c
.o
polysialyltransferases ST8SiaII and ST8SiaIV. J Biol Chem 281, 31605-31615 brg/
y
42. Galuska, S. P., Geyer, R., Gerardy-Schahn, R., Muhlenhoff, M., and Geyer, H. (2008) g
u
Enzyme-dependent Variations in the Polysialylation of the Neural Cell Adhesion es
t o
Molecule (NCAM) in Vivo. J Biol Chem 283, 17-28 n M
43. Haselhorst, T., Stummeyer, K., Muhlenhoff, M., Schaper, W., Gerardy-Schahn, R., arc
h
and von Itzstein, M. (2006) Endosialidase NF appears to bind polySia DP5 in a helical 2
8
conformation. Chembiochem 7, 1875-1877 , 20
1
9
44. Gatti, J. L., Castella, S., Dacheux, F., Ecroyd, H., Metayer, S., Thimon, V., and
Dacheux, J. L. (2004) Post-testicular sperm environment and fertility. Anim Reprod
Sci 82-83, 321-339
45. Sullivan, R., Frenette, G., and Girouard, J. (2007) Epididymosomes are involved in
the acquisition of new sperm proteins during epididymal transit. Asian J Androl 9,
483-491
46. Drake, P. M., Nathan, J. K., Stock, C. M., Chang, P. V., Muench, M. O., Nakata, D.,
Reader, J. R., Gip, P., Golden, K. P., Weinhold, B., Gerardy-Schahn, R., Troy, F. A.,
2nd, and Bertozzi, C. R. (2008) Polysialic acid, a glycan with highly restricted
expression, is found on human and murine leukocytes and modulates immune
responses. J Immunol 181, 6850-6858
47. Drake, P. M., Stock, C. M., Nathan, J. K., Gip, P., Golden, K. P., Weinhold, B.,
Gerardy-Schahn, R., and Bertozzi, C. R. (2009) Polysialic acid governs T-cell
development by regulating progenitor access to the thymus. Proc Natl Acad Sci U S A
106, 11995-12000
10