Platelet Factor 4-CXCL4

8 Pages·2000·0.286 MB·English

by  Neufeld G., Vadasz Z., Akiri G.

Platelet Factor 4
Gera Neufeld*, Gal Akiri and Zehava Vadasz
Department of Biology, Technion, Israel Institute of Technology, Technion City, Haifa, 32000, Israel
*corresponding author tel: [phone], fax: [phone], e-mail: [email protected]
DOI: 10.1006/rwcy.2000.10006.
SUMMARY oftheCXCfamilyofchemokines,PF4doesnotshare
certain proinflammatory properties of other CXC
family members because it lacks a critical N-terminal
Platelet factor 4 (PF4) is a heparin-binding pisasu
Glu-Leu-Arg sequence, the ‘ELR motif’, which pre-
CXC chemokine, which is expressed in megakaryo-
cedes the first cysteine residue. These three amino
cytes and stored in the (cid:11) granules of platelets.
acids appear to be important in ligand/receptor
However, other cell types such as activated human
interactions on neutrophils, and in the determination
leukocytes can also synthesize PF4. PF4 does not
of the effect of PF4 on angiogenesis (Strieter et al.,
share certain proinflammatory properties of other
1995; Petersen et al., 1996). The N-terminal of PF4
CXC family members because it lacks a critical N-
contains highly negatively charged amino acids and
terminalGlu-Leu-Argsequence,the‘ELRmotif’.Itis
protrudes out of the protein in the crystal structure
an inhibitor of angiogenesis but it is unclear what its
(Zhangetal.,1994).IncontrasttheC-terminalregion
other functions are. It can promote clotting through
of the polypeptide is unusual in that it contains a
the sequestration of heparin but can also act as an
repetitive motif (KKIIKKLL) containing positively
anticoagulant because it promotes the generation of
charged and hydrophobic pairs of amino acids. This
activated protein C, a potent anticoagulant.
repetitive sequence is the core of the heparin-binding
domain of PF4.
Structurally, mature human PF4 is a symmetrical,
BACKGROUND
tetrameric molecule made up of four identical PF4
subunits. A positively charged ring of lysine and
Discovery arginine side-chains encircles the PF4 tetramer
sphere, presenting multiple potential sites and orien-
tations for heparin binding. N-terminal residues,
Platelet factor 4 (PF4) was first mentioned in 1965 as
previously defined as an extended loop region, form
a platelet-derived anti-heparin factor (Niewiarowski
antiparallel (cid:12) sheet-like structures that form non-
etal.,1965).Theaminoacidsequencesofbovineand
covalent associations between PF4 dimers. These
humanPF4weredeterminedin1985(Ciaglowskiand
antiparallel (cid:12) sheet-like structures are positioned
Walz, 1985) and the cDNA was cloned in the same
lateral to the (cid:12)-bilayer motif and stabilize the tetra-
year (Poncz et al., 1987). The crystal structure of
mericunit(Zhangetal.,1994).PF4isreleasedfrom(cid:11)
human PF4 was solved by 1994 (Zhang et al., 1994).
granulesofplateletsasacomplexwithchondroitin-4-
sulfateproteoglycan(Levineetal.,1990),butdisplays
Structure a higheraffinitytowards heparinand heparan sulfate
glycosaminoglycans (Stringer and Gallagher, 1997).
Mature human PF4 is composed of 70 amino acids.
PF4isamemberofthechemokinefamily.Inaddition Main activities and
two homologous genes coding for closely related
pathophysiological roles
proteins called PF4alt and PF4var1 have also been
identified (Green et al., 1989; Eisman et al., 1990).
Although its structure places it among the members See section on Normal physiological roles.
1096 Gera Neufeld, Gal Akiri and Zehava Vadasz
GENE AND GENE REGULATION Chromosome location
Accession numbers
ThegeneforhumanPF4islocatedonchromosome4
at the q12-21 region (Griffin et al., 1987).
See Table 1.
Relevant linkages
Sequence
The subfamily of polypeptide chemoattractants
See Figure 1. known as CXC chemokines to which PF4 belongs is
Table 1 Available PF4 and PF4-related cDNA sequences
Species Accession no. Name GenBank locus Reference
Human NM_002619 Homo sapiens PF4 mRNA Poncz et al., 1987
M25897 Human PF4 mRNA, complete CDS HUMPF4A
NM_002620 Homo sapiens PF4 variant 1 (PF4V1) mRNA PF4V1 Green et al., 1989
M26167 Human PF4 variation 1 (PF4var1) gene HUMPF4V1A Green et al., 1989
Mouse BAA75660 PF4 BAA75660
Rat M15254 Rat PF4 gene RATPF4 Doi et al., 1987
Bovine g130303 PF4 PLF4_BOVIN Ciaglowski et al., 1986
Sheep g266800 PF4 PLF4_SHEEP Shigeta et al., 1991
Pig P30034 PF4 PLF4_PIG Proudfoot et al., 1995
Figure 1 Nucleotide sequences of PF4 in human, mouse, and rat.
Human
cDNA
ATGAGCTCCGCAGCCGGGTTCTGCGCCTCACGCCCCGGGGCTGCCTTCCTGGGGGTTGCTGCTGCCTGCCACTTGTGGTCGCCTTCGC
CAGCGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGGAAGACCACCTCCCAGGTCCGTCCCAGGCACATCACCAGCCTGGAG
GTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTGATAGCCACGCTGAAGAATGGAAGGAAAATTTGCTTGGACCTGCAAGCCC
CGCTGTACAAGAAAATAATTAAGAAACTTTTGGAGAGTTAG
Mouse
cDNA
ATGAGCGTCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGTCCTGAGCTGCTGCTTCTGGGCCTGTTGTTTCTGCCAGCGGTGGTTGCTG
TCACCAGCGCTGGTCCCGAAGAAAGCGATGGAGATCTTAGCTGTGTGTGTGTGAAGACCATCTCCTCTGGGATCCATCTTAAGCACAT
CACCAGCCTGGAGGTGATCAAGGCAGGACGCCACTGTGCGGTTCCCCAGCTCATAGCCAACCCTGAAGAATGGGAGGAAAATTTGCCT
GGACCGGCAAGCACCCCTATATAAGAAAGTAATCAAGAAAATCCTGGAGAAGTTAG
Rat
cDNA
ATGAGTGCCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGCCCTGAGCTGCTTCTTCTGGGTCTGCTGTTGCTGCCAGCTGTGGTTGCTG
TCACCAGGGCTAGTCCTGAAGAAAGCGACGGAGATCTTAGCTGTGTGTGTGTGAAGACCAGTTCTTCCAGGATCCATCTCAAACGCAT
CACCAGCCTGGAGGTGATCAAAGCAGGACCCCACTGTGGCGGGTTCCCCAGCTCATAGCCACGCTGAAGAATGGGAGCAAAATTTGCC
TGGACCGGCAAGTACCTCTGTTATAAGAAAATAATCAAGAAACTCCTGGAGAGTTAG
Platelet Factor 4 1097
characterized by the ability to induce concentration- domain possesses three positively acting subdomains
dependent directional migration and activation of from(cid:255)380to(cid:255)362,(cid:255)270to(cid:255)257,and(cid:255)137to(cid:255)120,
leukocytes. The genes for CXC chemokines map to as well as a negatively acting subdomain at (cid:255)184 to
human chromosome 4q13-21, with the exception of (cid:255)151whichisabletoreduceoveralltranscriptionbut
SDF-1, which is on chromosome 10 (Tunnacliffe has no effect on tissue specificity. The subdomain
et al., 1992; Shirozu et al., 1995). The family displays from (cid:255)380 to (cid:255)362 (P ) is most critical in restricting
3
four highly conserved cysteine residues, with the first geneexpressiondriveneitherbythe PF4promoteror
two cysteines separated by one nonconserved amino by a heterologous promoter to the megakaryocytic
acidresidue.Thepercentidentitybasedonnucleotide lineage.Deletionofeitherthewholeenhancer/silencer
sequence between family members is not strong (43– domain or the sub-domain from (cid:255)380 to (cid:255)362 or
24%) (Figure 1). (cid:255)137 to (cid:255)120 reduces transcription in megakaryo-
cytes by 10- to 30-fold.
Regulatory sites and corresponding
transcription factors PROTEIN
Sequence
The human PF4 gene contains three exons and spans
approximately 1000 bp (Eisman et al., 1990). Exon 1
encodes the 50 UTR and the signal sequence for See Figure 2.
secretionuptothelast2bp.Exon2encodes41amino
acids and about two-thirds of the 70 amino acids of
Description of protein
the mature PF4, and exon 3 contains the rest and the
30 UTR (Eisman et al., 1990).
Transgenic mice expressing prokaryotic (cid:12)-galacto- See Figure 3.
sidase coupled to 1.1kb of the 50 upstream region of
thePF4geneexpressthisconstructalmostexclusively
Discussion of crystal structure
inmegakaryocytes.However,lowlevelsofexpression
arealsofoundinadrenalglands(Ravidetal.,1991a).
Two important control elements were identified up- The structure of PF4 consists of four polypeptide
stream to the translation start site. A GATA element chains that form a tetrameric unit. N-terminal resi-
is located at (cid:255)31 whose conversion to a TATA box dues,previouslydefinedasarandomcoilorextended
decreases tissue specificity, and a megakaryocyte-spe- loop region, form antiparallel (cid:12) sheet-like struc-
cific enhancer/silencer domain located between (cid:255)448 tures that form noncovalent associations between
and(cid:255)112(Ravidetal.,1991b).Theenhancer/silencer dimers. These antiparallel (cid:12) sheet-like structures are
Figure 2 Amino acid sequences for human, mouse, and rat PF4. The signal sequence for secretion is underlined.
1098 Gera Neufeld, Gal Akiri and Zehava Vadasz
Figure3 Crystalstructureof Posttranslational modifications
aPF4dimerandaPF4tetra-
mer(fromZhangetal.,1994).
PF4 is cleaved between Thr16 and Ser17, a site
located downstream from the highly conserved and
structurally important CXC motif, by a protease
present in activated human leukocyte culture super-
nates. The N-terminal processed PF4 exhibited a 30-
to 50-fold greater growth inhibitory activity on
endothelial cells as compared with intact PF4
(Gupta et al., 1995).
CELLULAR SOURCES AND
TISSUE EXPRESSION
Eliciting and inhibitory stimuli,
including exogenous and
endogenous modulators
positioned lateral to the (cid:12)-bilayer motif and stabilize The cytokine IL-6 increases PF4 expression in
thetetramericunit.Apositivelychargedringoflysine megakaryocytes. This is probably the result of the
and arginine side-chains encircles the PF4 tetramer presence of an IL-6-responsive element CTGGGA in
sphere, presenting multiple potential sites and orien- the PF4 promoter (Ravid et al., 1995). The hemato-
tations for heparin binding. The electrostatic interac- poietic transcription factor GATA-1, which binds to
tions of multiply charged amino acid side chains and the GATA box, and the transcription factor Ets-1
hydrogen bonding interactions at the AB/CD dimer increase PF4 expression (Minami et al., 1998). The
interface serve to stabilize the tetrameric structure T-cluster-binding protein (TCBP) has a 78% homol-
further(Zhangetal.,1994).PF4bindstochondroitin ogytothatofnucleolysin.TCBPspecificallybindsto
sulfate and to heparin and heparan sulfate (Stringer the T-cluster and the proximal T-rich region of the
and Gallagher, 1997). PF4 binds with high affinity PF4 promoter and represses PF4 transcription (Doi
andspecificitytoanapproximately9kDasequencein et al., 1997).
heparan sulfate. This protected fragment is enriched
in N-sulfateddisaccharidesand iduronate2-O-sulfate
residues, the latter being important for binding to
RECEPTOR UTILIZATION
PF4. The major structural motif of the fragment
appears to consist of a pair of sulfated domains
positionedatbothendsseparatedbyacentralmainly A definite receptor for PF4 has not been described.
N-acetylated region. According to a proposed model PF4 binds to cell surface heparan sulfate proteo-
the heparan sulfate fragment wraps around the ring glycans which also function as receptors for IP-10,
of positive charges on PF4 with the iduronate 2-O- another chemokine that inhibits angiogenesis (Luster
sulfates within the sulfated domains binding strongly et al., 1995; Petersen et al., 1999). A cell surface
to lysine clusters on opposite faces of the PF4 chondroitin sulfate proteoglycan has been found to
tetramer (Stringer and Gallagher, 1997). act as a receptor for tetrameric PF4 on neutrophils
(Petersen et al., 1998).
Important homologies
IN VITRO ACTIVITIES
PF4hasahomolognamedPF4altorPF4var1(Green
et al., 1989; Eisman et al., 1990). (cid:12)-Thromboglobulin
In vitro findings
is also a platelet (cid:11) granule protein released in large
amounts following platelet activation. (cid:12)-Thrombo-
globulin has approximately 70% amino acid identity PF4 is not chemotactic, it has anti-angiogenic effects
with PF4 (Majumdar et al., 1991). in vitro and in vivo.
Platelet Factor 4 1099
Bioassays used Angiogenesis
AnotherimportantactivityofPF4istheinhibitionof
Inhibition of DNA synthesis or cell proliferation
angiogenesis (Maione et al., 1990). This antiangio-
assays: a variety of cells are used for this assay
genic capability makes PF4 an inhibitor of tumor
including fibroblasts (Jouan et al., 1999) and endo-
growth (Maione et al., 1990; Sharpe et al., 1990;
thelial cells (Gengrinovitch et al., 1995). Cells are
Tanaka et al., 1997). The mechanism by which PF4
stimulated with bFGF or with VEGF and inhib-
inhibits angiogenesis is unclear, and the subject of
ition of proliferation or thymidine incorporation is
ongoing research. PF4 binds heparin very strongly,
measured.
and it was shown that peptides derived from its
heparin-binding C-terminal domain also possess
anti-angiogenic properties. However, high concentra-
IN VIVO BIOLOGICAL tions of these peptides are required for the anti-
angiogenic activity as compared with the PF4
ACTIVITIES OF LIGANDS IN
concentrations required for similar effects (Maione
ANIMAL MODELS
et al., 1990). The mitogenic activities of angiogenic
growthfactors,suchasbasicfibroblastgrowthfactor
Normal physiological roles
(bFGF), are potentiated by heparin and heparan
sulfates (Fannon and Nugent, 1996). It was postu-
Clotting
lated that PF4 may sequester cell surface heparan
Despite more than two decades of research, the role sulfate proteoglycans that potentiate the receptor-
of PF4 in clotting is not yet completely understood. bindingabilityofbFGF,resultingintheinhibitionof
It may act as a procoagulant by virtue of its high bFGF activity. Indeed, there is some experimental
affinity towards heparin and heparan sulfate gly- proofsupportingthishypothesis(Watsonetal.,1994).
cosaminoglycans, resulting in the sequestration of However, a PF4 mutant that lacks the heparin-bind-
heparinandthuspreventingthebindingofheparinto ing domain also inhibits angiogenesis (Maione et al.,
antithrombinIII.Acommoncomplicationofheparin 1991),indicatingthattheheparin-bindingmechanism
anticlotting treatment is heparin-induced thrombo- is not the only mechanism by which PF4 affects
cytopenia. Thiscomplicationseems tobethe resultof angiogenesis.
PF4 binding to heparin. The immune system can It was subsequently found that heparin-binding
recognize this complex and generate antibodies di- proteins such as bFGF, keratinocyte growth factor,
rected against PF4/heparin complexes, leading to the protamine, the 165 amino acid form of vascular
development of this autoimmune disease (Shoenfeld, endothelial growth factor (VEGF ), and acidic
165
1997; Horne and Hutchison, 1998). fibroblast growth factor bind directly to PF4. The
PF4 also binds directly to thrombomodulin and to binding may be mediated by the very acidic N-
protein C. Thrombomodulin is an anionic protein terminal ofPF4and mayleadtothe inhibition ofthe
cofactor that promotes thrombin cleavage of protein angiogenic activity of heparin-binding angiogenic
C to generate activated protein C, a potent anti- factors (Gengrinovitch et al., 1995). The binding
coagulant.TheinteractionsofPF4withbothproteins depends upon the ability to bind heparin since basic
activate the interaction of protein C with thrombin proteins that do not bind to heparin – such as
and the generation of activated protein C. Since cytochrome C – do not bind to PF4. Recently, the
proteinCactsasananticoagulant,itfollowsthatPF4 binding between bFGF and PF4 was found to result
can also act as an anticoagulant in addition to its in the inhibition of the interaction of bFGF with its
procoagulant activity that is based upon its heparin- receptors (Perollet et al., 1998).
binding capability (Slungaard and Key, 1994; Dudek Nevertheless, these mechanisms cannot be the
et al., 1997). PF4 also inhibits factor XII activation only mechanisms by which PF4 inhibits the activity
during contact activation of plasmatic coagulation, of angiogenic growth factors. They do not explain,
leading to inhibition of coagulation (Dumenco et al., for example, how PF4 inhibits the activity of
1988). VEGF , a VEGF form that does not bind to
121
heparin and does not require heparan sulfate proteo-
glycans to bind to VEGF receptors. Interestingly,
Megakaryocyte Differentiation
PF4 inhibits the biological activity of VEGF
121
PF4 was reported to inhibit differentiation of mega- without affecting the binding of VEGF to VEGF
121
karyocytes from CD34-expressing cells (Xi et al., receptors (Gengrinovitch et al., 1995). These results
1996). arealsosupportedbyotherindependentobservations
1100 Gera Neufeld, Gal Akiri and Zehava Vadasz
which indicate that inhibition by PF4 is independent Griffin, C. A., Emanuel, B. S., LaRocco, P., Schwartz, E., and
of the type of stimulus used for the induction of Poncz, M. (1987). Human platelet factor 4 gene is mapped to
4q12-q21.Cytogenet.CellGenet.45,67–69.
cell proliferation and that PF4 inhibits the activity of
Gupta, S. K., and Singh, J. P. (1994). Inhibition of endothelial
nonheparin-binding growth factors (Gupta and
cellproliferationbyplateletfactor-4involvesauniqueactionon
Singh, 1994). It was found that PF4 induces changes Sphaseprogression.J.CellBiol.127,1121–1127.
intheexpressionofcellcycleregulatoryproteinssuch Gupta,S.K.,Hassel,T.,andSingh,J.P.(1995).Apotentinhib-
as P-21/waf-1 regardless of the growth-stimulating itorofendothelialcellproliferationisgeneratedbyproteolytic
cleavage of the chemokine platelet factor 4. Proc. Natl Acad.
factorused(Gentilinietal.,1999).Theseobservations
Sci.USA92,7799–7803.
indicate that alternative nonheparin-binding mechan-
Horne,M.K.,andHutchison,K.J.(1998).Simultaneousbinding
isms by which PF4 inhibits angiogenesis may exist. of heparin and platelet factor-4 to platelets: Further insights
This notion is also supported by experiments which into the mechanism of heparin-induced thrombocytopenia.
haveshownthatanonheparin-bindingmutantofPF4 Am.J.Hematol.58,24–30.
Jouan, V., Canron, X., Alemany, M., Caen, J. P., Quentin, G.,
is still able to inhibit angiogenesis (Maione et al.,
Plouet,J.,andBikfalvi,A.(1999).Inhibitionofinvitroangio-
1991).
genesisbyplateletfactor-4-derivedpeptidesandmechanismof
action.Blood94,984–993.
Levine,S.P.,Knieriem,L.K.,andRager,M.A.(1990).Platelet
References factor 4 and the platelet secreted proteoglycan: immunologic
characterization by crossed immunoelectrophoresis. Blood 75,
902–910.
Ciaglowski,R.E.,andWalz,D.A.(1985).Aminoacidsequence Luster,A.D.,Greenberg,S.M.,andLeder,P.(1995).TheIP-10
homologybetweenbovineandhumanplateletproteins.Comp. chemokine binds to a specific cell surface heparan sulfate site
Biochem.Physiol.[B]82,715–719. shared with platelet factor 4 and inhibits endothelial cell pro-
Ciaglowski,R.E.,Snow,J.,andWalz,D.A.(1986).Isolationand liferation.J.Exp.Med.182,219–231.
aminoacidsequenceofbovineplateletfactor4.Arch.Biochem. Maione,T.E.,Gray,G.S.,Petro,J.,Hunt,A.J.,Donner,A.L.,
Biophys.250,249–256. Bauer,S.I.,Carson,H.F.,andSharpe,R.J.(1990).Inhibition
Doi,T.,Greenberg,S.M.,andRosenberg,R.D.(1987).Structure of angiogenesis by recombinant human platelet factor-4 and
of the rat platelet factor 4 gene: a marker for megakaryocyte relatedpeptides.Science247,77–79.
differentiation.Mol.CellBiol.7,898–904. Maione,T.E.,Gray,G.S.,Hunt,A.J.,andSharpe,R.J.(1991).
Doi, T., Minami, T., Itoh, M., Aburatani, H., Kawabe, Y., Inhibition oftumor growth in mice byananalogue of platelet
Kodama, T., Kondo, N., Satoh, Y., Asayama, T., and factor4thatlacksaffinityforheparinandretainspotentangio-
Imanishi, T. (1997). An alternative form of nucleolysin binds staticactivity.CancerRes.51,2077–2083.
toa T-cluster DNA in thesilencerelement ofplatelet factor 4 Majumdar, S., Gonder, D., Koutsis, B., and Poncz, M. (1991).
gene.Biochem.Biophys.Res.Commun.235,625–630. Characterization of the human beta-thromboglobulin gene.
Dudek, A. Z., Pennell, C. A., Decker, T. D., Young, T. A., Comparison with the gene for platelet factor 4. J. Biol. Chem.
Key, N. S., and Slungaard, A. (1997). Platelet factor 4 binds 266,5785–5789.
to glycanated forms of thrombomodulin and to protein C – Minami,T.,Tachibana,K.,Imanishi,T.,andDoi,T.(1998).Both
A potential mechanism for enhancing generation of activated Ets-1andGATA-1areessentialforpositiveregulationofplate-
proteinC.J.Biol.Chem.272,31785–31792. letfactor4geneexpression.Eur.J.Biochem.258,879–889.
Dumenco, L. L., Everson, B., Culp, L. A., and Ratnoff, O. D. Niewiarowski, S., Farbiszewski, R., and Poplawski, A. (1965).
(1988). Inhibition of the activation of Hageman factor (factor Neutralization of antithrombin VI (fibrinogen breakdown
XII)byplateletfactor4.J.Lab.Clin.Med.112,394–400. products) with platelet antiheparin factor (platelet factor 4).
Eisman, R., Surrey, S., Ramachandran, B., Schwartz, E., and Thromb.Diath.Haemorrh.14,490–499.
Poncz, M. (1990). Structural and functional comparison of Perollet,C.,Han,Z.C.,Savona,C.,Caen,J.P.,andBikfalvi,A.
the genes for human platelet factor 4 and PF4alt. Blood 76, (1998). Platelet factor 4 modulates fibroblast growth factor 2
336–344. (FGF-2) activity and inhibits FGF-2 dimerization. Blood 91,
Fannon, M., and Nugent, M. A. (1996). Basic fibroblast growth 3289–3299.
factor binds its receptors, is internalized, and stimulates DNA Petersen, F., Ludwig, A., Flad, H. D., and Brandt, E. (1996).
synthesis in balb/c3T3 cells in the absence of heparan sulfate. TNF-alpha renders human neutrophils responsive to platelet
J.Biol.Chem.271,17949–17956. factor4–ComparisonofPF-4andIL-8revealsdifferentactiv-
Gengrinovitch,S.,Greenberg,S.M.,Cohen,T.,Gitay-Goren,H., ityprofilesofthetwochemokines.J.Immunol.156,1954–1962.
Rockwell,P.,Maione,T.E.,Levi,B.,andNeufeld,G.(1995). Petersen, F., Bock, L., Flad, H. D., and Brandt, E. (1998). A
Platelet factor-4 inhibits the mitogenic activity of VEGF-121 chondroitinsulfateproteoglycanonhumanneutrophilsspecifi-
and VEGF-165 using several concurrent mechanisms. J. Biol. cally binds platelet factor 4 and is involved in cell activation.
Chem.270,15059–15065. J.Immunol.161,4347–4355.
Gentilini,G.,Kirschbaum,N.E.,Augustine,J.A.,Aster,R.H., Petersen, F., Brandt, E., Lindahl, U., and Spillmann, D. (1999).
andVisentin,G.P.(1999).Inhibitionofhumanumbilicalvein Characterizationofaneutrophilcellsurfaceglycosaminoglycan
endothelial cell proliferation by the CXC chemokine, platelet that mediates binding of platelet factor 4. J. Biol. Chem. 274,
factor 4 (PF4), is associated with impaired downregulation of 12376–12382.
p21Cip1/WAF1.Blood93,25–33. Poncz,M.,Surrey,S.,LaRocco,P.,Weiss,M.J.,Rappaport,E.F.,
Green,C.J.,Charles,R.S.,Edwards,B.F.,andJohnson,P.H. Conway,T.M.,andSchwartz,E.(1987).Cloningandcharac-
(1989).IdentificationandcharacterizationofPF4varl,ahuman terization of platelet factor 4 cDNA derived from a human
genevariantofplateletfactor4.Mol.CellBiol.9,1445. erythroleukemiccellline.Blood69,219–223.
Platelet Factor 4 1101
Proudfoot,A.E.,Magnenat,E.,Haley,T.M.,Maione,T.E.,and (1995). The functional role of the ELR motif in CXC
Wells, T. N. (1995). The complete primary structure of glyco- chemokine-mediated angiogenesis. J. Biol. Chem. 270, 27348–
sylatedporcineplateletfactor4.Eur.J.Biochem.228,658–664. 27357.
Ravid, K., Beeler, D. L., Rabin, M. S., Ruley, H. E., and Stringer, S. E., and Gallagher, J. T. (1997). Specific binding of
Rosenberg,R.D.(1991a).Selectivetargetingofgeneproducts the chemokine platelet factor 4 to heparan sulfate. J. Biol.
with the megakaryocyte platelet factor 4 promoter. Proc. Natl Chem.272,20508–20514.
Acad.Sci.USA88,1521–1525. Tanaka,T.,Manome,Y.,Wen,P.,Kufe,D.W.,andFine,H.A.
Ravid, K., Doi, T., Beeler, D. L., Kuter, D. J., and (1997). Viral vector-mediated transduction of a modified
Rosenberg, R. D. (1991b). Transcriptional regulation of the plateletfactor4cDNAinhibitsangiogenesisandtumorgrowth.
rat platelet factor 4 gene: interaction between an enhancer/ NatureMed.3,437–442.
silencer domain and the GATA site. Mol. Cell Biol. 11, 6116– Tunnacliffe, A., Majumdar, S., Yan, B., and Poncz, M. (1992).
6127. Genesforbeta-thromboglobulinandplateletfactor4areclosely
Ravid, K., Kuter, D. J., and Rosenberg, R. D. (1995). rmIL-6 linked and form part of a cluster of related genes on chromo-
stimulates the transcriptional activity of the rat PF4 gene. some4.Blood79,2896–2900.
Exp.Hematol.23,397–401. Watson, J. B., Getzler, S. B., and Mosher, D. F. (1994). Platelet
Sharpe, R. J., Byers, H. R., Scott, C. F., Bauer, S. I., and factor 4 modulates the mitogenic activity of basic fibroblast
Maione, T. E. (1990). Growth inhibition of murine melanoma growthfactor.J.Clin.Invest.94,261–268.
and human colon carcinoma by recombinant human platelet Xi, X. D., Caen, J. P., Fournier, S., Schlegel, N., Amiral, J.,
factor4.J.NatlCancerInst.82,848–853. Sibony, O., Blot, P., and Han, Z. C. (1996). Direct and rever-
Shigeta, O., Lu, W. Q., Holt, J. C., Edmunds, L. H. J., and sible inhibition of platelet factor 4 on megakaryocyte devel-
Niewiarowski, S. (1991). Ovine platelet factor 4: purification, opment from CD34(+) cord blood cells: Comparative studies
aminoacidsequence,radioimmunoassay andcomparisonwith with transforming growth factor beta 1. Br. J Haematol. 93,
plateletfactor4ofotherspecies.Thromb.Res.64,509–520. 265–272.
Shirozu, M., Nakano, T., Inazawa, J., Tashiro, K., Tada, H., Zhang, X. H., Chen, L. Q., Bancroft, D. P., Lai, C. K., and
Shinohara, T., and Honjo, T. (1995). Structure and chromo- Maione, T. E. (1994). Crystal structure of recombinant
somal localization of the human stromal cell-derived factor 1 humanplateletfactor4.Biochemistry33,8361–8366.
(SDF1)gene.Genomics28,495–500.
Shoenfeld, Y. (1997). Heparin-induced thrombocytopenia as an
autoimmune disease – Idiotypic evidence for the role of anti-
heparin/PF4autoantibodies.Isr.J.Med.Sci.33,243–245.
ACKNOWLEDGEMENTS
Slungaard,A.,andKey,N.S.(1994).Plateletfactor4stimulates
thrombomodulin protein C-activating cofactor activity – A
structure-functionanalysis.J.Biol.Chem.269,25549–25556.
This work was supported by grants from the Israel
Strieter, R. M., Polverini, P. J., Kunkel, S. L., Arenberg, D. A.,
Academy of Sciences and the Israel Cancer Research
Burdick,M.D.,Kasper,J.,Dzuiba,J.,Vandamme,J.,Walz,A.,
Marriott, D., Chan, S. Y., Roczniak, S., and Shanafelt, A. B. Fund (ICRF) to G.N.