Nova Southeastern University NSUWorks Biology Faculty Articles Department of Biological Sciences 12-2004 Phylogeography and Genetic Ancestry of Tigers (Panthera tigris) Shu-Jin Luo National Cancer Institute at Frederick; University of Minnesota - St. Paul Jae-Heup Kim National Cancer Institute at Frederick Warren E. Johnson National Cancer Institute at Frederick Joelle van der Walt National Cancer Institute at Frederick Janice S. Martenson National Cancer Institute at Frederick See next page for additional authors Follow this and additional works at:https://nsuworks.nova.edu/cnso_bio_facarticles Part of theBiodiversity Commons,Genetics and Genomics Commons, and theZoology Commons NSUWorks Citation Luo, Shu-Jin; Jae-Heup Kim; Warren E. Johnson; Joelle van der Walt; Janice S. Martenson; Naoya Yuhki; Dale Miquelle; Olga Uphyrkina; John M. Goodrich; Howard Quigley; R. Tilson; Gerald Brady; Paolo Martelli; Vellayan Subramaniam; Charles McDougal; Sun Hean; Shi-Qiang Huang; Wenshi Pan; Ullas K. Karanth; Melvin Sunquist; James L. D. Smith; and Stephen J. O'Brien. 2004. "Phylogeography and Genetic Ancestry of Tigers (Panthera tigris)."PLoS Biology2, (12 e442): 2275-2293. https://nsuworks.nova.edu/cnso_bio_facarticles/728 This Article is brought to you for free and open access by the Department of Biological Sciences at NSUWorks. It has been accepted for inclusion in Biology Faculty Articles by an authorized administrator of NSUWorks. For more information, please [email protected]. Authors Shu-Jin Luo, Jae-Heup Kim, Warren E. Johnson, Joelle van der Walt, Janice S. Martenson, Naoya Yuhki, Dale Miquelle, Olga Uphyrkina, John M. Goodrich, Howard Quigley, R. Tilson, Gerald Brady, Paolo Martelli, Vellayan Subramaniam, Charles McDougal, Sun Hean, Shi-Qiang Huang, Wenshi Pan, Ullas K. Karanth, Melvin Sunquist, James L. D. Smith, and Stephen J. O'Brien This article is available at NSUWorks:https://nsuworks.nova.edu/cnso_bio_facarticles/728 PLoS Openaccess,freelyavailableonline BIOLOGY Phylogeography and Genetic Ancestry of Tigers (Panthera tigris) Shu-Jin Luo1,2[, Jae-Heup Kim1[¤1, Warren E. Johnson1, Joelle van der Walt1¤2, Janice Martenson1, Naoya Yuhki1, Dale G. Miquelle3, Olga Uphyrkina1¤3, John M. Goodrich4, Howard B. Quigley3,4, Ronald Tilson5, Gerald Brady6, Paolo Martelli7, Vellayan Subramaniam8, Charles McDougal9, Sun Hean10, Shi-Qiang Huang11, Wenshi Pan12, Ullas K. Karanth13, Melvin Sunquist14, James L. D. Smith2, Stephen J. O’Brien1[* 1Laboratory of Genomic Diversity, National Cancer Institute, Frederick, Maryland, United States of America, 2Conservation Biology Graduate Program, University of Minnesota,St.Paul,Minnesota,UnitedStatesofAmerica,3WildlifeConservationSociety,RussianFarEastProgram,Bronx,NewYork,UnitedStatesofAmerica,4Wildlife ConservationSociety,HornockerWildlifeInstitute,Bozeman,Montana,UnitedStatesofAmerica,5MinnesotaZoo,AppleValley,Minnesota,UnitedStatesofAmerica, 6PotterParkZoo,Lansing,Michigan,UnitedStatesofAmerica,7SingaporeZoologicalGardens,Singapore,8ZooNegara,HuluKelang,Selangor,Malaysia,9TigerTops, Kathmandu,Nepal,10InternationalCooperationOffice,MinistryofAgricultureForestryandFisheries,PhnomPenh,Cambodia,11BeijingZoo,Beijing,China,12Collegeof Life Sciences, Peking University, Beijing, China, 13Wildlife Conservation Society—India Program, Bangalore, Karnataka, India, 14Department of Wildlife Ecology and Conservation,UniversityofFlorida,Gainesville,Florida,UnitedStatesofAmerica Eighttraditionalsubspeciesoftiger(Pantheratigris),ofwhichthreerecentlybecameextinct,arecommonlyrecognized onthebasisofgeographicisolationandmorphologicalcharacteristics.Toinvestigatethespecies’evolutionaryhistory and to establish objective methods for subspecies recognition, voucher specimens of blood, skin, hair, and/or skin biopsies from 134 tigers with verified geographic origins or heritage across the whole distribution range were examined for three molecular markers: (1) 4.0 kb of mitochondrial DNA (mtDNA) sequence; (2) allele variation in the nuclearmajorhistocompatibilitycomplexclassIIDRBgene;and(3)compositenuclearmicrosatellitegenotypesbased on 30 loci. Relatively low genetic variation with mtDNA, DRB, and microsatellite loci was found, but significant populationsubdivisionwasnonethelessapparentamongfivelivingsubspecies.Inaddition,adistinctpartitionofthe Indochinese subspecies P. t. corbetti into northern Indochinese and Malayan Peninsula populations was discovered. Population genetic structure would suggest recognition of six taxonomic units or subspecies: (1) Amur tiger P. t. altaica;(2)northernIndochinesetigerP.t.corbetti;(3)SouthChinatigerP.t.amoyensis;(4)MalayantigerP.t.jacksoni, namedforthetigerconservationistPeterJackson;(5)SumatrantigerP.t.sumatrae;and(6)BengaltigerP.t.tigris.The proposedSouthChinatigerlineageistentativeduetolimitedsampling.Theageofthemostrecentcommonancestor for tiger mtDNA was estimated to be 72,000–108,000 y, relatively younger than some other Panthera species. A combinationofpopulationexpansions,reducedgeneflow,andgeneticdriftfollowingthelastgeneticdiminution,and the recent anthropogenic range contraction, have led to the distinct genetic partitions. These results provide an explicitbasisforsubspeciesrecognitionandwillleadtotheimprovedmanagementandconservationoftheserecently isolated but distinct geographic populations of tigers. Citation:LuoSJ,KimJH,JohnsonWE,vanderWaltJ,MartensonJ,etal.(2004)Phylogeographyandgeneticancestryoftigers(Pantheratigris).PLoSBiol2(12):e442. Introduction ReceivedFebruary10,2004;AcceptedOctober21,2004;PublishedDecember 7,2004 The tiger (Panthera tigris) is the largest felid species and a DOI:10.1371/journal.pbio.0020442 widely recognized symbol of wildlife conservation. Histor- Copyright:(cid:1)2004Luoetal.Thisisanopen-accessarticledistributedunder the terms of the Creative Commons Attribution License, which permits ically tigers inhabited much of Asia, including the regions unrestricteduse,distribution,andreproductioninanymedium,providedthe betweentheCaspianandAralSeas,southeasternRussia,and originalworkisproperlycited. the Sunda islands (Mazak 1981; Hemmer 1987; Herrington Abbreviations: AMOVA, analysis of molecular variance; CI, confidence interval; 1987). Since the early 1900s, however, habitat loss, fragmen- Cymt, cytoplasmic mitochondrial; Dkf, kinship coefficient; Dps, proportion of sharedalleles;ME, minimumevolution;MHC,majorhistocompatibilitycomplex; tation, and human persecution have reduced tiger popula- ML,maximumlikelihood;MP,maximumparsimony;mtDNA,mitochondrialDNA; tionsfromprobablyover100,000in1900tofewerthan7,000 MY(A),millionyears(ago);NJ,neighborjoining;Numt,nuclearmitochondrial;SSCP, free-rangingindividuals(NowellandJackson1996;Dinerstein singlestrandconformationpolymorphism etal. 1997;Kitchener and Dugmore 2000). Most populations AcademicEditor:CraigMoritz,UniversityofCalifornia,Berkeley consist of less than 120 animals, increasing the risk of local *Towhomcorrespondenceshouldbeaddressed.E-mail:[email protected] extirpation due to demographic and genetic factors (Smith [Theseauthorscontributedequallytothiswork. andMcDougal 1991; Dinersteinetal. 1997). ¤1Currentaddress:BiochipProjectTeam,SamsungAdvancedInstituteof There are eight generally accepted tiger subspecies in Technology,Suwon,Korea accordancewiththeirgeographicdistribution(Figure1).Bali ¤2Currentaddress:CenterforHumanGenetics,DukeUniversityMedicalCenter, (P.t.balica),Caspian(P.t.virgata),andJavan(P.t.sondaica)tiger Durham,NorthCarolina,UnitedStatesofAmerica subspecies were eradicated by the 1940s, 1970s, and 1980s ¤3Currentaddress:EvolutionaryZoologyandGeneticsLaboratory,Instituteof respectively (Nowell and Jackson 1996). Today an estimated BiologyandSoilSciences,Vladivostok,Russia PLoSBiology|www.plosbiology.org 2275 December2004|Volume2|Issue12|e442 TigerPhylogeography Figure1.HistoricandCurrentGeographicDistributionofTigersCorrespondingtotheEightTraditionalSubspeciesDesignation Geographicoriginofsamplesandsamplesize(circlesorsquares)fromeachlocationareindicated(seeTable3forsources).Three-lettercodes (TIG,ALT,etc.)areindicatedsubspeciesabbreviations.Dottedlinesareapproximateboundariesbetweentigersubspeciesstudiedhere.The IsthmusofKradividesthetraditionalIndochinesetigersintothenorthernIndochinesetigersP.t.corbettiIandtheMalayantigersP.t.corbettiII basedonthepresentstudy.WeproposetheMalayantigersubspecies,CORII,benamedP.t.jacksoni,tohonorPeterJackson,theformerChairof theIUCN’sCatSpecialistGroupwhohascontributedsignificantlytoworldwidetigerconservation. DOI:10.1371/journal.pbio.0020442.g001 3,200–4,500 Indian or Bengal tigers (P. t. tigris) exist in 1996).However,theadequacyofthesetraditionalsubspecies Bangladesh,Bhutan,westernChina,India,westernMyanmar, designations is tentative at best, since morphological dis- andNepal(Seidenstickeretal.1999).Fewerthan500Amuror tinctionsinmanycaseshavebeenbasedonafewspecimens, Siberian tigers (P. t. altaica) survive in eastern Russia, north- and because subsequent studies have failed to affirm these eastern China, and Korea (Matyushkin et al. 1999; Miquelle distinctions. Herrington (1987) and Kitchener (1999) have and Pikunov 2003), while approximately 50 Amoy or South revealedawiderangeofmorphologicalvariationswithinthe Chinatigers(P.t.amoyensis)nowexistincaptivityonly(Tilson subspecies and, to some extent, overlapping among the et al. 2004). An estimated 400–500 Sumatran tigers (P. t. subspecies. A previous molecular genetic assessment of 28 sumatrae) occur in Sumatra (Seidensticker et al. 1999); and tigershasindicatedalowlevelofgeneticvariation,revealing 1,200–1,800Indochinesetigers(P.t.corbetti)liveinCambodia, little evidence for subspecies distinctiveness (Wentzel et al. China,Laos,Malaysia,eastMyanmar,Thailand,andVietnam 1999). Moreover, ecological analyses of tiger habitat (Kitch- (Seidenstickeret al.1999) (Figure 1). ener and Dugmore 2000) indicate that there have been few Subspecies of tigers are traditionally defined by body size, geographic barriers (e.g., mountain ranges and deserts) to skull characters, pelage coloration, and striping patterns migration and gene flow that would have been sufficient for (Mazak 1981; Herrington 1987). It is generally believed that subspecies isolation. One ecology-based conservation ap- the largest tigers occur in the Russian Far East, and the proach emphasizes protection of about 160 continuous smallest are found in the Sunda Islands. The shape of the habitat patches or tiger conservation units regardless of occiput in the skull is characteristically narrow in the Javan subspeciesdesignation(Dinersteinetal.1997).Althoughthis and Bali tigers and much broader in Caspian tigers (Mazak strategy may be desirable, optimal tiger conservation may PLoSBiology|www.plosbiology.org 2276 December2004|Volume2|Issue12|e442 TigerPhylogeography also require additional interventions such as establishing corridorsandbufferzonesand/orimplementingreintroduc- tionprograms(Tilsonetal.2001).Tothisend,anassessment ofpopulationgeneticstructureoflivingtigersinterpretedin the context of traditional intraspecific taxonomy and the species’evolutionaryhistorywouldbenefitbothinsituandex situconservation managementdesign. Molecular genetic markers have been increasingly applied to assess genetic partitions among geographically isolated populations,todefinetheevolutionarysignificantunitbelow thespecieslevelforconservationmanagementpurposes,and to revise the traditional species and subspecies designations (Avise and Ball 1990; Moritz 1994; Fraser and Bernatchez 2001). Subspecies recognition is particularly relevant for tigers, because the current conservation strategy for this species has been inextricably bound to knowledge of its subspecific taxonomy. In this study we adhere to the subspecies concept as defined by Avise and Ball (1990) and O’Brien and Mayr (1991), to include populations below the species level that share a distinct geographic distribution, a group of phylogenetically concordant characters, and a unique natural history relative to other subdivisions of the species. Here we attempt to overcome several factors that have Figure2.SchematicofP.tigrismtDNA complicated previous efforts to fully describe patterns of ThepositionofPCRprimersusedforamplificationofCymtspecific genetic variation in tigers. Foremost among these has been sequencesandalignmentofthehomologousNumtsequence(outer, the limited sample size of ‘‘voucher specimens’’ (defined as dashedline)intigermitochondria.FifteenCymt-specificprimersets spanning 6,026 bp of mtDNA were designed and screened for individuals that were verified as wild-born from a specific polymorphism in tigers (inner, solid line). Five indicated segments geographic locale or captive-born from geographically showed no variation among fifteen tigers that represented five verified wild-born parents). In addition, the presence of traditional subspecies and therefore were excluded from further analysis.Thetenvariablesegments(4,078bp)wereamplifiedin100 Numt, a nuclear pseudogene insertion of cytoplasmic tiger individuals. Primer sequences are listed in Table 1. Diamonds mitochondrial DNA (mtDNA) in tiger autosomes (Lopez et indicate polymorphic mtDNA segments; brackets indicate mono- al.1994;Johnsonetal.1996;Cracraftetal.1998;J.H.Kim,A. morphic mtDNA segments among tigers that were excluded from phylogeneticanalysis. Antunes, S.-J. Luo, J. Menninger, W. G. Nash, et al., personal DOI:10.1371/journal.pbio.0020442.g002 communication) has made it difficult to utilize universal mammalian primer sets for mitochondrial genes, because (pelt or hair) by amplifying shorter fragments (less than 400 they will coamplify Numt. Furthermore, paucity of genetic bp) targeting selected variable sites to determine their diversity across tigers, especially in mtDNA (Wentzel et al. similarity to the previously characterized haplotypes. Com- 1999), has made it necessary to sequence a large portion of binedmtDNAsequenceswereobtainedfrom100tigersfrom the mtDNA genome and to assess genetic variation in Russian Far East (n = 13), south China (n = 4), northern multiplerapidly evolvingmicrosatellite loci. Indochina(n=30), Malayan Peninsula (n=22),Sumatra (n To establish proper biological reference specimens, sam- = 16), and the Indian subcontinent (n = 15). The mtDNA ples from 134 tigers of known geographic origin were sequences specified 54 variable sites defining 25 haplotypes collected. Three genetic markers were examined: (1) 4 kb of (Table 2). Thirty of the polymorphisms were observed in mtDNA sequence derived from primer pairs that excluded more than one individual and were thus phylogenetically Numt amplification, (2) allele variation in the major informative (Table 2), and 29 of the 30 changes were histocompatibility complex (MHC) DRB gene; and (3) allele transitions. sizevariationof30hypervariableshorttandemrepeatlocior Phylogenetic analyses of the mtDNA haplotypes using microsatellites. Observed patterns of population genetic maximum parsimony (MP), minimum evolution (ME), and variation replicated with different gene families form the maximum likelihood (ML) approaches produced congruent basisofinterpretationofthetiger’sevolutionaryhistoryand topologies that defined major geographic partitions (Figure recommendations forits management. 3A). Eight haplotypes (SUM1 to SUM8) generated from 16 Sumatrantigers(P.t.sumatrae)formedamonophyleticgroup Results (80% MP, 70% ME, and 66% ML bootstrap support). A Phylogenetic Analysis of mtDNA and Microsatellites secondmonophyleticclusterofsixhaplotypes(TIG1toTIG6) Mitochondrial gene fragments were amplified and se- from15Bengaltigers(P.t.tigris)alsoreceivedhighbootstrap quenced from DNA extracted from 72 blood or tissue support (93% MP, 82% ME, and 90% ML). The rest of the specimensusing10cytoplasmicmitochondria(Cymt)-specific mainlandAsianhaplotypesgroupedtogetherandpartitioned primer pairs (Figure 2 and Table 1). The fragments were into three distinct geographic groups: (1) a genetically concatenated in a 4,078-bp contiguous sequence. Additional invariant Amur tiger lineage (P. t. altaica) represented by a mtDNAsequencesweregeneratedfrom28historicalsamples singlehaplotypein13individuals,(2)anorthernIndochinese PLoSBiology|www.plosbiology.org 2277 December2004|Volume2|Issue12|e442 TigerPhylogeography Table1. PCRPrimers Specific forCytoplasmic Mitochondrial DNASequences Primer ID Mitochondrial Forwarda Reversea Size(bp) Segments C53F1/T598R ND5 CCCAGATCCCTATATTAACCAGT TATATCATTTTGTGTGAGGGCAC 546 C708F/T1300R ND5 CCTTGTCTTCCTGCATATCTG CCATTGGAAAGTACCCGAGGAGGT 593 C1494F/T1936R ND6 TCTCCTTCATAATCACCCTGA TGGCTGGTGGTGTTGGTTGCGG 443 C2339F/T2893R CytB TTGCCGCGACGTAAACCACG GTTGGCGGGGATGTAGTTATC 555 CR-UPF/CR-R2B CR TCAAAGCTTACACCAGTCTTGTAAACC CGTGTTGTGTGTTCTGTAT 250 C4979F/T5424Rb 12S GCACTGAAAATGCCTAGATGAGT CCAGTTTGGGTCTTAGCTATCG 446 C-12S-F/N/C-12S-R 12S AAAGCCACAGTTAACGTAA TACGACTTGTCTCCTCTTGTGG 577 T7812F/C8294Rb ND1 CGTCGTAGGACCATACGGCC CTCAGTCTCCTTCTGTTAAAT 483 C8276F/T8620R ND1 CGAAGCGAGCTCCATTTGATTTA GTGGAATGCTTGCTGTAATGATGGG 345 T8942F/C9384R ND2 CTTATAGTCTGAATCGGCTTCG AGCTATGATTTTTCGTACCT 443 C9366F/T9882R ND2 GGGGAGTTAACCAAACCGAG CAAGGACGGATAGTATTGGTG 517 C10525F/T11013Rb COI GGAGGATTCGGAAACTGGCGA CCAGAAGTCTATATCTTAATCCCG 489 C11020F/T11428R COI CCAGAAGTCTATATCTTAATCCCG GCTCCTATTGACAAGACGTAGTGGA 409 T11988F/C12414b COII GGCATACCCCTTCCAACTAGGT TGCACACTTCTATTGCTAGT 427 C12618F/T12920Rb ATP8 TTGTCCATGAACTAGTCCCATCAT GGAAACAGCTATGACCGGCG 303 aPrimersarelistedinthe59-to-39direction bPCRproductsamplifiedusingtheseprimersetsshownovariationamongallsamples DOI:10.1371/journal.pbio.0020442.t001 lineage (P. t. corbetti I) of individuals originating from south 3B). Haplotypes from the same geographic group tended to China to the Indochinese countries north of the Isthmus of be interrelated, and intergroup distances among haplotypes Kra,and(3)aparaphyleticassemblyofhaplotypesfromtigers weregenerallylargerthanbranchlengthswithineachgroup from Malayan Peninsula (P. t. corbetti II). Support for (1–4 bp). The exceptions were two lineages within the subdividingtheconventionalIndochinesesubspeciesoftigers Malayan P. t. corbetti II cluster that were separated by 7 bp, P.t.corbettiintotwoclusterswashigh(bootstrapvaluesforP.t. whichmaybearesultoftheexistenceoffurtherpopulation corbetti I were 94% MP, 96% ME, and 94% ML). The COR1/ substructure or, alternatively, of limited sampling in the AMO3 haplotype, represented by 22 individuals from region.Eachofthesixtigersubspeciesgroupswasconnected Vietnam (n = 2), Cambodia (n = 14), northeast Thailand (n to other groups in close but not exact correspondence to =5),andsouthChina(n=1),wastheonlyhaplotypefound their geographic location. For instance, P. t. altaica was the in two classical subspecies lineages (P. t. amoyensis and P. t. sistertaxontoP.t.corbettiIwhichwasconnectedtoP.t.corbetti corbetti) (Table2). II. P. t. sumatrae haplotypes were linked to P. t. tigris by 7 bp Voucher samples of five captive tigers collected in China, andtoP.t.amoyensisby10bp.Nonetheless,thephylogenetic designatedSouthChinasubspeciesP.t.amoyensis,fellintotwo relationships among the subspecies were not resolved to a very distinct phylogenetic origins. Two tigers from the robust hierarchy, and therefore were consistent with a Suzhou Zoo (Pti-217 and Pti-218; Table 3) carried the contemporaneous divergence of extant phylogeographic COR1/AMO3 haplotype, and the third (Pti-222) contained lineages. haplotype AMO2, which differed by a single nucleotide Composite genotypes from 30 felid-specific microsatellite substitution from COR1/AMO3 (Table 2). The two South loci(Menotti-Raymondetal.1999)wereobtainedin113tiger China tiger haplotypes grouped phylogenetically with the samples. Neighbor joining (NJ) analyses of individual tiger northernIndochineseP.t.corbettiIhaplotypes(COR1–COR3) genotypesbasedontheproportionofsharedallele(Dps)and in all phylogenetic analyses (Figure 3A and 3B), and likely kinship coefficient (Dkf) genetic distances produced con- indicate that the maternal (mitochondrial) lineages of these cordanttopologies(Figures4andS1)thatlendsupporttothe tigers derived from individuals from the P. t. corbetti I same phylogeographic population subdivisions observed in phylogenetic lineages. In contrast, two P. t. amoyensis tigers the mtDNA analysis. Tigers from Sumatra (P. t. sumatrae) (Pti-219andPti-220)fromtheChongqingZoocollectionhad formed a monophyletic clade with 97% bootstrap support, ahaplotype (AMO1) that formed aseparate lineage that was and Amur tigers (P. t. altaica) grouped with 76% bootstrap ten nucleotide substitutions from its nearest sequence support.Theremainingtigergenotypespartitionedintotwo (Sumatran; Figure 3B and Table 2). If affirmed by larger weakly supported monophyletic lineages (Indian Subconti- sampling, this lineage would reflect a unique P. t. amoyensis nent P. t. tigris and Malayan Peninsula P. t. corbetti II) and a genetichaplotype. paraphyleticassemblageofnorthernIndochineseP.t.corbetti A statistical parsimony network of the tiger mtDNA I.Forexample,threeindividualsfromThailand(Pti-296,Pti- sequences provided additional analytical support for the 297, and Pti-301) clustered with samples from the India differentiation of P. t. sumatrae, P. t. tigris, P. t. altaica, P. t. subcontinent, blurring the distinction between P. t. corbetti I corbettiI,P.t.corbettiII,andP.t.amoyensis(AMO1only)(Figure andP.t.tigris.ThethreeSouthChinatigersfromtheSuzhou PLoSBiology|www.plosbiology.org 2278 December2004|Volume2|Issue12|e442 TigerPhylogeography FR 7304 G – –––– ––––– –––––AAA –––––– 08 22 O1 110114 7287 C T TTTT TTTTT TTTTTTTT TTTTTT C CT 5737 C – –––– ––––– –––––––– T––––T 5728 G A –––– ––––– –––––––– –––––– 5674 T C –––– ––––– –––––––– –––––– 5608 C – –––– ––––– TTTTTTTT –––––– 5533 G – –––– ––––– –––––––– AAAAAA FR 5518 G A –––– ––––– –––––––– –––––– 6682 5515 A – –––– ––GGG –––––––– –––––– 9398 5349 T C –––– ––––– –––––––– –––––– CT 5332 C T TTTT TTTTT TTTTTTTT TTTTTT 5186 A – ––G– ––––– –––––––– –––––– 2F4R 5155 T C –––– ––––– CCCCCCCC CCCCCC D2 894938 5050 C – –––– ––––– –––––––– TTTTTT N TC 4963 G – –––– ––––– –––––––– A––––– 4442 T – –––– ––––– CCCCCCCC –CCCCC 6F0R 4406 A – –––– ––––– ––––––GG –––––– D1 827862 4357 A G –––– ––––– –––––––– –––––– N CT T – –––C ––––– –––––––– –––––– 1712 A – –––– GG––– –––––––– –––––– R FS- 1671 T C –––– CCCCC CCCCCCCC CCC–CC S 12S-C-12 1577 A – –––– ––––– G––G–––– –––––– s 12 C-N/ 1420 T – –––– ––––– C––––––– –––––– e c quen UPFR2B 1166331999 TC –– –––––––– –T–TC–C–C– –––––––––––––––– –––––––––––– Se R R-R- A C CC 16315 C – TTTT ––––– –––––––– –––––– N 15756 C T –––– TTTTT TTTTTTTT TTTTTT mtD 1155679413 CA –– –––––––– T–T––––––– –G–G–G–G–G–G–G–G –––––––––––– 3). gris) 1155569052 GG –– A–A–A–A– –A–––––––– –––––––––––––––– –––––––––––– able Table2.HaplotypesandVariableSitesinCombinedAnalysisof4,078bpofTiger(P.ti GeneND5ND6CytB PrimersC53F1C708FC1494FC2339FT598RT1300RT1936RT2893R a11111111111111111111111Position333333333334444444555550113347999900156773334523717420788481911857908bcN98387728136688181069038SubspeciesHaplotype dACCCCCCTCACTTTGTP.t.altaicaALT13GCACCGT P.t.amoyensisAMO12A–G–––C––T–––TC–G–––––– P.t.corbettiIAMO21––––––C–––––––––G––––A–e22–T––––C–––––––––G––––A–COR1/AMO3COR22–T––––C–––––––––G––––A–COR37–T––––C–––––––––G––––A– P.t.corbettiIICOR411––G–––C–––––––––G––––––(P.t.jacksoni)COR51––G–––C–––––––––G––––––COR62––GT––CT––––––––G––––––COR75––GT––CT––––––––GT–––––COR83––G–––CT––––––––GT––C–– P.t.sumatraeSUM14A–G–––C––––––T––G––––––SUM24A–G–––C––––––T––G––––––SUM31A–G–––C––––––T––G–––––CSUM41––G–––C––––––T––G––––––SUM51A–G–––C––––––T––G––C–––SUM61A–G–––C––––––T––G–C––––SUM73A–G–––C––––––T––G–C––––SUM81A–G–––C–T––TTT––G–C–––– P.t.tigrisTIG11––G–T–C–––T––––TG––C–––TIG21––G––AC––––––––TG––C–––TIG31––G–––C––––––––TG––––––TIG41––G–––C––––––––TG––C–––TIG56––G–––C––––––––TG––C–––TIG65––G–––C––––––––TG––C––– aNucleotidepositionscorrespondtothecompletereferenceFeliscatusmtDNAsequence(Lopezetal.1996).bSubspeciesabbreviationcodeasinFigure1.BasepairsidenticaltohaplotypeALTareindicatedbyadash.cNumberofindividualswitheachhaplotype.IndividualtigermtDNAhaplotypesarelistedinTable3.dRednucleotidesaresubspecies-specificsites.eCOR1/AMO3isahaplotypesharedby21tigersthatareinitiallydesignatedasCORandoneAMO(textandTDOI:10.1371/journal.pbio.0020442.t002 PLoSBiology|www.plosbiology.org 2279 December2004|Volume2|Issue12|e442 TigerPhylogeography PLoSBiology|www.plosbiology.org 2280 December2004|Volume2|Issue12|e442 TigerPhylogeography Figure3.PhylogeneticRelationshipsamongTigersfrommtDNAHaplotypes (A)PhylogeneticrelationshipsbasedonMPamongthetigermtDNAhaplotypesfromthecombined4,078bpmitochondrialsequence(Table2). Branchesofthesamecolorrepresenthaplotypesofthesamesubspecies.TreesderivedfromMEandMLanalyseshaveidenticaltopologies. Numbersabovebranchesrepresentbootstrapsupportfrom100replicatesusingtheMPmethod,followedbybootstrapvaluesusingtheME-ML analyses(onlythose over 70% are indicated). Numbersbelow branches show numberof MP steps pernumberof homoplasiesfrom a strict consensustree.Numbersinparenthesesrepresentnumbersofindividualssharingthesamehaplotype.MPanalysisusingheuristicsearchand tree-bisection-reconnectionbranch-swappingapproachresultsintwoequallymost-parsimonioustreesandtheoneresemblingtheMEandML trees is shown here (tree length = 60 steps; CI = 0.900). The ME tree is constructed with PAUP using Kimura two-parameter distances (transitiontotransversionratio=2)andNJalgorithmfollowedbybranch-swappingprocedure(ME=0.0142).TheMLapproachisperformed usingaTrN(Tamura-Nei)þI(withproportionofinvariablesites)model,andallnodesoftheMLtreeweresignificant(aconsensusof100trees,– Lnlikelihood=5987.09). (B)StatisticalparsimonynetworkoftigermtDNAhaplotypesbasedon4,078mtDNAsequencesconstructedusingtheTCSprogram(Clementet al.2000).Theareaofthecircleisapproximatelyproportionaltothehaplotypefrequency,andthelengthofconnectinglinesisproportionalto theexactnucleotidedifferencesbetweenhaplotypeswitheachunitrepresentingonenucleotidesubstitution.Missinghaplotypesinthenetwork arerepresentedbydots.Haplotypecodesandthenumberofindividuals(inparentheses)witheachhaplotypeareshown(seeTable2). DOI:10.1371/journal.pbio.0020442.g003 Zoo, China, that had clustered with P. t. corbetti I by mtDNA very high (0.838), indicating that 84% of the variation was (Pti-217, Pti-218, and Pti-222) also associated more closely partitionedamongthedifferentphylogeographicsubspecies. withP.t.corbettiIfromnorthernIndochinabymicrosatellite Each of the five subspecies showed highly significant analysis(Figure4).Thetwodistinct(bymtDNA)P.t.amoyensis population genetic differentiation (p , 0.0001) by pairwise individuals (Pti-219 and Pti-220) from the Chongqing Zoo, F and R with 10,000 permutations (Table 5). The contrast st st China,likewiseformedadistinctlineageinthemicrosatellite between the mtDNA and microsatellite genetic variation analysis(Figure 4). probably reflects the difference in the effective population size assessed by these two different markers and/or, to some Population Subdivision Analysis extent, theintersexual differences indispersal. To quantify the extent of population differentiation in Analternativeanalysisofthecombinedmicrosatelliteand modern tigers, we evaluated four different geographic mitochondrial haplotype data using a Bayesian approach subdivision scenarios and compared them on the basis of (Figure S2 and Table S1) as implemented in the program analysis of molecular variance (AMOVA) with both mtDNA STRUCTURE(Pritchardetal.2000)supportedthepartition- haplotypes and microsatellite genotypes (Table 4). P. t. ingofP.t.altaica,P.t.sumatrae,P.t.tigris,andP.t.corbettiII,but amoyensis individuals (Pti-219 and Pti-220) were excluded in further split the 33 P. t. corbetti I individuals into three thissubdivision analysisdue toour small samplesize.In our distinctivepopulationgroups:(1)fourtigersfromChinaand firsthypothesis,twogroupswereconsidered:theP.t.sumatrae Vietnam; (2) nine tigers from Cambodia; and (3) 20 tigers island population and all contemporary mainland popula- from Cambodia and northern Thailand (K = 7, Pr[K] = tions(P.t.altaica, P.t.corbettiI,P.t.corbettiII,P.t.tigris).This 0.993). In this scenario, most individuals were assigned to a recently proposed model (Cracraft et al. 1998; Kitchener cluster with high probability (q . 0.90), indicating very low 1999; Kitchener and Dugmore 2000) presumes continuous levelofgeneflowbetweenthegroups.However,becausethis habitat distribution on the mainland. The second scenario additional substructure within P. t. corbetti I had little considered tigers as three groups: the Sumatran population geographicorecologicalbasis,andbecauseAMOVAanalysis (P. t. sumatrae), the Amur tigers (P. t. altaica), which presently basedonthispopulationsubdivisionresultedinlowerF and st areisolatedfromothertigerpopulationsbymorethantheir R values than that in the five-group scenario (unpublished st maximum known dispersal distance (Mazak 1996), and a data), the distinction was not considered to be a consistent group of the other mainland tigers subspecies. The third basis for subspecies classification and may reflect additional hypothesis followed the division of the four traditional populationdifferentiation withinasubspecies. subspecies: (1) Amur tigers (P. t. altaica), (2) P. t. corbetti, including Indochina and part of south China, (3) Bengal Genetic Variation in Tigers tigers(P.t. tigris), and(4) Sumatrantigers(P.t. sumatrae). The Quantitative estimates of mtDNA diversity in tigers with fourth scenario, based on the results of the mtDNA comparableestimatesfromselectedfelidspeciesdemonstra- phylogenetic analyses (see Figure 3) and the hypothesis that ted that overall, tigers had moderate levels of mtDNA the Isthmus of Kra may serve as a potential geographic diversity(Table6),substantiallylessthanleopards (P.pardus) barrier (Kitchener 1999), further subdivided classical P. t. (Uphyrkina et al. 2001), Geoffroy’s cat (Oncifelis geoffroyi), corbetti into the northern Indochina region P. t. corbetti I and Pampascat(O.colocolo),ortigrina(Leopardustigrinus)(Johnson theMalayanPeninsulaP.t.corbettiII,resultinginfivegroups. etal.1999),butcomparabletopumas(Pumaconcolor)(Culver The AMOVA results for each of the four scenarios are et al. 2000) in percent variable sites, mean pairwise distance presented inTable 4. among individuals, and average nucleotide diversity. Four Forbothmitochondrialhaplotypeandmicrosatellitedata, tigersubspecies(P.t.tigris,P.t.sumatrae,P.t.corbettiI,andP.t. the five-group scenario yielded the highest F (for mtDNA, corbetti II) showed moderate nucleotide diversity (p), ranging st defined as the proportion of total genetic variation that is from0.0001to0.0070(Table6).TheP.t.altaiasamplingof13 attributabletogeneticdifferencesbetweenpopulations)and individuals showed no mtDNA haplotype variation. Of the R (formicrosatellites, anF analogy suitedforthestepwise five individuals originally designated as P. t. amoyensis, three st st mutation model that applies to microsatellite data) values. weregeneticallyindistinguishablefromP.t.corbettiI,resulting Under this model, 31% of the microsatellite variation in an inadequate sample size for a meaningful estimation of discriminated between the five groups, while the balance, populationvariation. 69%, occurred within each group. For mtDNA the F was Parameters ofmicrosatellite variationhavebeenshownto st PLoSBiology|www.plosbiology.org 2281 December2004|Volume2|Issue12|e442 TigerPhylogeography 2) 2 R ., 2 O bPtiCode(mtDNAcHaplotype)d,.MHC-DRB f,.111(ALT),112(ALT),113(ALT)AA,,.,114AA,115,117,118,120(ALT),121AA,.122,123AA,,.124,125AA,126,127,128(ALT),130(ALT),131(ALT),133(ALT),134,135,137(ALT),138,142,143,145,146,147148 151(ALT),152 153(ALT),154 156(ALT),158,161157,15965(ALT) 219(AMO1),220(AMO1) ,.,.217(AMO2)AA,218(AMO3/COR1)AA,2 315(COR2),316(COR3) 249(AMO3/COR1),250(AMO3/COR1) 290TH(AMO3/COR1),291(AMO3/COR1),292(C 296(AMO3/COR1) 297(AMO3/COR1)301(AMO3/COR1) 305(AMO3/COR1) 306(AMO3/COR1)307(COR3) a s hu tt ra BiSt W C W W CWU C C W W W W UU U WW Source;Contact HornockerWildlifeResearchInstitute,USA;H.QuigleyandD.Miquelle MinnesotaZoo,USA;F.WrightandA.ShimaMoscowZoo,Russia;V.SpitsinTallinZoo,Estonia;V.FainsteinKievZoo,Ukraine;L.Korotkaya PhiladelphiaZoo,USA;K.Hinshaw ChongqingZoo,China;W.PanandS.Huang SuzhouZoo,China;W.PanandS.HuangKunmingInstituteofZoology,China;Y.ZhangHanoiZoologicalGardens,Vietnam;D.G.TungKhaoKheoOpenZoo,Thailand;W.TunwattanaChiangmaiZoo,Thailand;W.Tunwattana SongkalaZoo,Thailand;W.TunwattanaNhimVauda,Kamput,Cambodia;R.Marx PhnomTamao,Cambodia;R.Marx e c r u g o 8 1 2 2 5 1 2 3 2 2 3 2 1 2 1 S 2 s al r u eStudy NumbeofIndivid(Total) (39) (2) (33) h t n sedi gin st china ntheratigrisU LocaleofOri RussianFarEa SouthChina NorthernIndo a P Table3.Samplesof Subspecies(Common)Name P.t.altaica(Amurtiger) P.t.amoyensis(SouthChinatiger) P.t.corbettiI(Indochinesetiger) PLoSBiology|www.plosbiology.org 2282 December2004|Volume2|Issue12|e442
Description: