New data on the family Blaberidae (Dictyoptera) from Southeast Asia: new species, morphological diversity and phylogeny on the base of ribosomal DNA sequences

2015·1.1 MB·

by  V. A. Mavropulo

ZOOSYSTEMATICA ROSSICA, 24(1): 14–30 25 JUNE 2015
New data on the family Blaberidae (Dictyoptera) from Southeast Asia:
new species, morphological diversity and phylogeny on the base of
ribosomal DNA sequences
Новые данные о семействе Blaberidae (Dictyoptera) из
Юго-Восточной Азии: новые виды, морфологическое разнообразие
и филогения на основании последовательностей рибосомальной ДНК
V.A. MAVROPULO, L.N. ANISYUTKIN*, M.V. ZAGOSKIN, A.S. ZAGOSKINA,
S.V. LUKYANTSEV & D.V. MUKHA
В.А. МАВРОПУЛО, Л.Н. АНИСЮТКИН, М.В. ЗАГОСКИН, А.С. ЗАГОСКИНА,
С.В. ЛУКЬЯНЦЕВ, Д.В. МУХА
V.A. Mavropulo, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow,
119991, Russia
L.N. Anisyutkin, Zoological Institute, Russian Academy of Sciences, 1 Universitetskaya Emb., St Petersburg 199034,
Russia. E-mails: [email protected], [email protected]. Corresponding author
M.V. Zagoskin, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow 119991,
Russia
A.S. Zagoskina, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow
119991, Russia
S.V. Lukyantsev, Tomsk State University, 36 Lenina Str, Tomsk 634059, Russia
D.V. Mukha, Vavilov Institute of General Genetics, Russian Academy of Sciences, 3 Gubkin Str., Moscow 119991,
Russia. E-mail: [email protected]
New cockroaches of the family Blaberidae are described from Southern Sumatra: two new spe-
cies of the genus Cyrtonotula Uvarov, 1939, C. secunda sp. nov. and C. tertia sp. nov. (Epilam-
prinae); and one new species of the genus Paranauphoeta J.W.H. Rehn, 1951, P. pullata sp. nov.
(Paranauphoetinae). Detailed morphological descriptions of the new species are given. Struc-
tures of the male genitalia of the genus Cyrtonotula are described for the first time. Hypothesis
on the relationships of these new taxa as well as Morphna maculata Brunner von Wattenwyl,
1865, Rhabdoblatta sp. and Pseudophoraspis sp. based on 28S ribosomal DNA sequences is
discussed.
Из Южной Суматры описываются новые тараканы семейства Blaberidae: два новых вида
рода Cyrtonotula Uvarov, 1939, C. secunda sp. nov. и C. tertia sp. nov. (Epilamprinae), и один
новый вид из рода Paranauphoeta J.W.H. Rehn, 1951, P. pullata sp. nov. (Paranauphoetinae).
Для новых видов дается детальное морфологическое описание. Строение гениталий сам-
цов впервые описывается у представителей рода Cyrtonotula. Обсуждается выдвинутая
на основании изучения 28S рибосомальной ДНК гипотеза о родственных отношениях
новых таксонов, а также Morphna maculata Brunner von Wattenwyl, 1865, Rhabdoblatta sp.
и Pseudophoraspis sp.
Key words: cockroaches, taxonomy, morphology, phylogeny, 28S ribosomal DNA, Southeast
Asia, Dictyoptera, Blaberidae, Epilamprinae, Paranauphoetinae, Cyrtonotula, Paranauphoeta,
new species
Ключевые слова: тараканы, таксономия, морфология, филогения, 28S рибосомальная
ДНК, Юго-Восточная Азия, Dictyoptera, Blaberidae, Epilamprinae, Paranauphoetinae, Cyr-
tonotula, Paranauphoeta, новые виды
© 2015 Zoological Institute, Russian Academy of Scienсes
V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 15
INTRODUCTION The ratio of “distance between eyes”
to “length of eye” was measured as the in-
In the present paper, new representatives
terocular distance on the vertex (i.o. in Fig.
of the family Blaberidae Brunner von Wat- 1A) to the dorsoventral length of eye (d.e.
tenwyl, 1865 are described from Southeast in Fig. 1A). Types of the anterior margin of
Asia. There are two new species of the genus fore femur armament are given according to
Cyrtonotula Uvarov, 1939, belonging to the Bey-Bienko (1950) and Roth (2003). The
subfamily Epilamprinae Brunner von Wat- terminology of the male genital sclerites fol-
tenwyl, 1865, and one new species of Pa- lows Klass (1997) but with some modifica-
ranauphoeta Brunner von Wattenwyl, 1865, tions (Anisyutkin, 2014; Anisyutkin et al.,
belonging to the subfamily Paranauphoeti- 2013). The terminology used by Grandcolas
nae J.W.H. Rehn, 1951. Ribosomal DNA se- (1996) for genital structures is given in pa-
quence data of the described taxa and males rentheses following the author’s designa-
of the genus Cyrtonotula are considered for tions. The terms introduced by the author
the first time. A provisional hypothesis re- are given in quotation marks.
garding the relationships in the studied taxa The material studied (including type
is proposed on the base of the consensus specimens) is deposited at the Zoological
cladogram that was inferred from the 28S Institute of the Russian Academy of Sci-
ribosomal DNA fragment sequence data. ences, St Petersburg, Russia.
The subfamily Epilamprinae is one of
the largest and most diverse subfamilies Abbreviation used in figures
of Blaberidae. It is widely distributed in (see text for further details):
regions with wet tropical climate and is
a.s., “additional spines”, i.e. spines bor-
known since at least the Paleocene epoch
dering euplantulae from inside and outside;
(Vršansky et al., 2013). The subfamily Pa-
ap.scl., “apical sclerite” of sclerite L2D in
ranauphoetinae includes a single genus of
the male genitalia;
uncertain systematical position, Paranau- b.hla., basal membranous part of sclerite
phoeta. It undoubtedly belongs to Blaberi- L3;
dae, but its relationships within the fam- b.L2D, basal part of sclerite L2D in the
ily are unclear (for details see: Anisyutkin, male genitalia;
2003a). There are no paleontological data b.L3, basal subsclerite of sclerite L3 in
on Paranauphoeta yet. the male genitalia;
c.b.m.a., “chaetae-bearing membranous
MATERIAL AND METHODS area” located between right phallomere and
sclerite L2D;
The material studied was collected in c.b.m.l., “chaetae-bearing membranous
tropical forests at light or during night lobe” located above basal part of sclerite
work with the use of a flashlight on the L2D;
leaves of trees and bushes. The material was c.p.R1T, caudal part of the sclerite R1T
preserved in 70% ethanol. in the male genitalia;
The male genitalia were processed with cr.p.R1T, cranial part of the sclerite R1T
alkali by means of a standard procedure in the male genitalia;
(Anisyutkin et al., 2013) for 12–24 hours d.e., dorsoventral length of the eye;
for maceration of the soft tissues. The il- f.s., “folded structure” of the sclerite L3
lustrations were sketched by means of a in the male genitalia;
drawing tube on a Leica MZ 16 binocular hge., groove of the sclerite L3 in the male
microscope; further drawing and examina- genitalia (= hge);
tion were made with an MBS–10 binocular hla, sclerotized apical part of the sclerite
microscope. L3 in the male genitalia (sensu Klass, 1997);
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
16 V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA
hl., hollow on the sclerite R2 in the male QIAquick Gel Extraction Kits (QIAGEN,
genitalia; Hilden, Germany). Cleaned products were
i.o., interocular distance on the vertex; cloned into pGEM-T Easy vectors (Pro-
L2D, L3, L4U, sclerites in the male geni- mega), and transformed into Escherichia coli
talia; JM109 competent cells (Promega) follow-
Par., paraproct; ing the manufacturer’s protocol. Amplified
pr.s., preputial spines located at the “api- DNA fragments and several clones were se-
cal sclerite” of sclerite L2D of the male geni- quenced for each specimen.
talia; Automated sequences were generated
pv., sclerite at the base of the cerci (= pv- on an ABI PRISM® 310 Genetic Analyzer
sclerite); according to Sanger et al. (1977) with a Big-
r.plm., right phallomere of the male geni- Dye Termination kit (Applied Biosystems).
talia; Opposite strands were confirmed for all
R1T, R2, R3, R4, R5, sclerites in the male templates. ABI trace files were edited and
genitalia. contigs were assembled using the program
ChromasPro v. 1.7.6 (http://technelysium.
DNA analysis com.au/?page_id=27).
DNA extraction, PCR amplification
Nucleotide alignment and phylogenetic
and sequencing
analysis
Total genomic nucleic acids were ex- Sequences from this study for Paranau-
tracted from ethanol-fixed insects using phoeta pullata sp. nov., Cyrtonotula tertia
a standard DNA extraction buffer (Tris– sp. nov., C. secunda sp. nov., Pseudophoras-
HCl, proteinase K, SDS) according to the pis sp. and Rhabdoblatta sp. are under the
protocol described in Mukha et al. (1995). accession numbers KJ194457, KJ184844,
DAMS-18 (gtccctgccgtttgtacaca) and KJ194458, KJ194459 and KJ194460, re-
DAMS-28 (ctactagatggttcgattagtc) prim- spectively. Furthermore for the reconstruc-
ers were used for DNA amplification and tion of the phylogenetic tree, the following
sequencing. The priming sites for DAMS- rDNA sequences were used: Archiman-
18 and DAMS-28 are highly conserved in drita tesselata J.A.G. Rehn, 1903 (acc. #
eukaryotes; these primers are “universal” GU384924), Blaberus atropos (Stoll, 1813)
and may be used for the amplification of the (acc. # AF321252), Morphna maculata (acc.
corresponding ribosomal DNA fragments # KM659175), Symploce pallens (Stephens,
across a broad taxonomic range of organ- 1835) (acc. # KF922887), Parathemnop-
isms (Mukha & Sidorenko, 1995, 1996; teryx couloniana (Saussure, 1863) (acc. #
Mukha et al., 2000; Mukha et al., 2002). KF922888), Parcoblatta lata (Brunner von
PCR amplification of the analyzed rDNA Wattenwyl, 1865) (acc. # AF321247), Blat-
fragments was carried out using Master Mix tella vaga Hebard, 1935 (acc. # AF321246),
(2X) (Fermentas, Vilnius, Lithuania) ac- Blattella lituricollis (Walker, 1868) (acc. #
cording to the manufacturer’s recommenda- AF321245), Blattella asahinai Mizukubo,
tions and performed using a Primus 25 ad- 1981 (acc. # AF321253), Blattella german-
vanced Thermocycler (PEQLAB, Erlangen, ica (Linnaeus, 1767) (acc. # AF005243),
Germany). The PCR regimen was as fol- Archiblatta sp. (acc. # KM659176), Peri-
lows: initial template denaturation at 95°C planeta americana (Linnaeus, 1758) (acc. #
for 5 min, followed by 30 cycles at 94°C for 1 AF321248), Periplaneta brunnea Burmeis-
min, 55°C for 2 min, and 72°C for 3 min, and ter, 1838 (acc. # AF321249), Periplaneta
a final 7 min elongation cycle at 72°C. PCR- fuliginosa Serville, 1838 (acc. # AF321250),
amplified single bands were resolved on and Mantis religiosa (Linnaeus, 1758) (acc.
1.0% agarose gels and were extracted with # AY859585).
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 17
A fragment of the 28S gene from each Branch support was assessed by the
of the analyzed species was used for analy- bootstrap method (Felsenstein, 1985)
sis. Alignment was constructed using the (1000 replicates) using the close-neighbor-
MAFFT v.7 (Q-INS-I method) (http:// interchange (CNI) algorithm with the heu-
mafft.cbrc.jp/alignment/server/) (Katoh ristic search for the ML analysis, and by
& Standley, 2013) and Gblocks v.0.91b calculation of the percentage of replicate
(http://www.phylogeny.fr/version2_cgi/ trees in which the associated taxa clustered
one_task.cgi?task_type=gblocks) (Cas- together for the MP analysis.
tresana, 2000; Dereeper et al., 2008) soft- Bayesian analysis was conducted us-
ware programs. The combination of these ing MrBayes version 3.2.2. We performed
two approaches allowed us to align the se- two replicate analyses of 1 million genera-
quences and eliminate the poorly aligned tions each for each data set, sampling every
and highly divergent regions. Default 100 generations. The hierarchical likeli-
parameters were used for both of these hood ratio test (hLRT) implemented in the
methods. MrModeltest version 2.3 (Nylander, 2004)
rDNA-based phylogenetic trees were was used to find the best fitting GTR+G
estimated using probabilistic (maximum model. Trees from the first 2500 generations
likelihood [ML], Bayesian [MrBayes]) and were discarded as burn-in. The Bayesian
parsimony (maximum parsimony [MP]) tree was estimated from the majority-rule
methods (Fitch, 1971; Felsenstein, 1981; consensus of the post-burn-in trees.
Huelsenbeck et al., 2001; Huelsenbeck &
Ronquist, 2001). MP and ML analyses were SYSTEMATIC PART
conducted using the program MEGA ver-
Order DICTYOPTERA Clairville, 1798
sion 6.05 (Tamura et al., 2013). MrBayes
analysis was conducted using the program Family Blaberidae
MrBayes version 3.2.2 (Ronquist et al., Brunner von Wattenwyl, 1865
2012).
Subfamily Epilamprinae
The MP tree was obtained using the
Brunner von Wattenwyl, 1865
Subtree-Pruning-Regrafting (SPR) algo-
rithm (Nei & Kumar, 2000) with search Tribe Morphnini McKittrick, 1964
level 1, in which the initial trees were ob- Genus Morphna Shelford, 1910
tained by the random addition of sequences
(10 replicates). Type species Epilampra maculata Brun-
For the ML analysis, the evolutionary ner von Wattenwyl, 1865, by subsequent
history was inferred by using the Maxi- designation.
mum Likelihood method based on the Gen- Note. The genus includes 13 species from
eral Time Reversible model (Nei & Kumar, South and Southeast Asia (Beccaloni, 2015;
2000). The initial trees for the heuristic Anisyutkin, 2014; Anisyutkin & Gorochov,
search were obtained automatically by ap- 2001).
plying the Neighbor-Joining and BioNJ al-
gorithms to a matrix of pairwise distances, Morphna maculata
estimated using the Maximum Compos- Brunner von Wattenwyl, 1865
ite Likelihood (MCL) approach, and then
Material. Male (prep. 141012/03); Malay-
selecting the topology with superior log
sia, Borneo I., Sarawak State, environs of Kuch-
likelihood value. A discrete Gamma distri-
ing City, Bako National Park, lowland forest
bution was used to model the evolutionary
and forest on hills, near sea bank, 18–22 March
rate differences among the sites (2 catego- 2012, A. Gorochov, M. Berezin, E. Tkatsheva,
ries (+G, parameter = 0.2790)). I. Kamskov.
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
18 V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA
Note. Data on this specimen are here in- cockroaches: shortening of the tegmina and
dicated, as it was used in the present mo- wings due to sexual dimorphism is always
lecular analysis. more expressed in females. Since the males
have somewhat reduced organs of flight, it
Genus Cyrtonotula Uvarov, 1939 can be concluded that their females are also
brachypterous (possibly apterous).
=Cyrtonota Hanitsch, 1929 Composition. The type species; C. se-
cunda sp. nov.; C. tertia sp. nov.
Type species Cyrtonota lata Hanitsch,
1929, by monotypy.
Note. The genus Cyrtonota Hanitsch, Cyrtonotula secunda sp. nov.
1929 was described from Sumatra as mono- (Figs 1A–N, 4A, B)
typical one from a single female (Hanitsch,
Holotype. Male (prep.: Epil. ex 1908/01),
1929). Later, it was renamed by Uvarov
Indonesia, Sumatra I., Bengkulu Prov., 25 km
(1939) due to the preoccupation of the
S of Bintuan Town, environs of Tanjung Baru
name “Cyrtonota”. Males of C. lata remain Maje vill., 04°50.279´S 103°28.071´E, ~100 m,
undescribed to the present. 2–3 May 2009, A. Gorochov, M. Berezin,
Three complexes of diagnostic charac- E. Tkatsheva.
ters were indicated in the original descrip- Description. Male. General colour yel-
tion of the genus (Hanitsch, 1929): a com- lowish brown with scattered brown spots
paratively large, semicircular, anteriorly (Figs 1A, 4A, B); facial part of head and
and posteriorly produced pronotum; short- eyes black; vertex speckled with black;
ened tegmina and wings, not reaching the upper and lateral parts of head yellowish;
abdominal apex; and the following struc- ocellar spots, clypeus and labrum whit-
ture of the hind tarsi: “tarsi moderately ish; pronotum with central part darker;
long; posterior metatarsus barely as long as tegmina yellowish brown, lighter in apical
the succeeding joints, biseriately spined be- parts, with pale spots; legs reddish brown,
neath, its pulvillus apical; remaining joints but with coxae and femora darker (partly
also biseriately spined beneath, with apical blackish) and tarsi yellowish; abdomen
pulvilli; tarsal arolia present” (Hanitsch, brownish, but its sternites darker and with
1929: 281, 282). The increasing size of the dark (nearly black) dots; anal plate in cau-
pronotum and the simultaneous shortening dal part pale; cerci light yellow with ulti-
of the tegmina and wings are common in mate segment darkened. Surfaces smooth
cases when there is a shift from a compara- and lustrous. Head in front with rounded
tively open mode of life to more hidden one. vertex (Figs 1A, 4B); ocellar spots distinct;
The type of hind tarsi described here is very facial part without impressions or wrin-
common in epilamprines and is probably kles; distance between eyes about equal
plesiomorphic. Thus, the present diagnosis to length of eye; distance between anten-
of the genus is insufficient, and possibility nal sockets approximately 1.7 times the
of the independent appearance of these di- length of the scape (1.0 mm); approximate
agnostic characters in C. lata and in the spe- length ratio of 3rd–5th segments of max-
cies described below cannot be excluded. illary palps 1.1 : 1.0 : 1.6. Pronotum as in
Thus, description of male and its genitalia Figs 1B, 4A. Tegmina and wings weakly
in C. lata elucidates the taxonomic position abbreviated, not reaching abdominal apex.
of the genus Cyrtonotula. Venation of tegmina distinct; Sc thickened
Females of both new species of the ge- (easily visible on ventral side of tegmen);
nus Cyrtonotula described below are un- branches of R, M and CuA numerous and
known, but we can deduce that they have parallel; CuP distinct; apices of tegmina
an expressed reduction of the tegmina and rounded. Anterior margin of fore femur
wings, which is the general rule for the armed according to type B (sensu Bey-Bi-
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 19
Fig. 1. Cyrtonotula secunda sp. nov., holotype. A – facial part of head; B – pronotum and head from
above; C – right hind tarsus from below; D – abdominal apex from above; E – hypandrium from be-
low; F – sclerites L2D, L4U and adjacent structures of the male genitalia from above; G – sclerite R3
from below; H – right phallomere from above; I – sclerites R1T and R2 of the right phallomere from
side; J – caudal part of sclerite L2D from above; K – left hook (hla) in everted station and sclerite
L4U; L–N – apical part of hook hla. Dotted area shows dark colour (A) or membranous parts (C, E,
F, H, J–N). Abbreviations: a.s.; b.L3; c.b.m.a.; c.p.R1T; cr.p.R1T; d.e.; f.s.; i.o.; L2D; L3; L4U; R1T; R2;
R3; R4; R5 – see text. Scale bars 1 mm (a for A; b for B; c for C; d for D; e for E; f for F; g for G–I; h
for J; i for K; j for L–N).
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
20 V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA
enko, 1950; Roth, 2003): with 6–7 spines men width (in place where CuP running
including two apical ones. Fore tibiae not into anal margin of tegmen) 5.5.
thickened distally. Structure of hind tar- Comparison. The new species readily
sus (Fig. 1C): metatarsus distinctly longer differs from C. lata (the single previously
than other segments combined; metatarsus known species of the genus Cyrtonotula) in
and 2nd segment with two relatively equal the colour of the head (partly black in C.
rows of spines along lower margin; 1st–4th secunda sp. nov. but testaceous in C. lata)
segments with “additional spines” border- and in a comparatively longer hind metatar-
ing euplantulae from inside and outside sus [distinctly longer than the other tarsal
(Fig. 1C: a.s.); euplantula small and api- segments combined in C. secunda sp. nov.;
cal; claws symmetrical and simple; arolium in C. lata, this metatarsus is “as long as the
well developed, slightly shorter than claw. remaining joints” (Hanitsch, 1929: 283)].
Abdomen without visible specializations.
Anal plate (tergite X) wide and rounded, Cyrtonotula tertia sp. nov.
with weak caudal incision (Fig. 1D). Cerci (Figs 2A–O, 4C, D)
slightly flattened dorsoventrally, with seg-
ments distinctly separated (Fig. 1D). Para- Holotype. Male (prep.: Epi1 1908/02); In-
donesia, Sumatra I., Bengkulu Prov., environs
procts of blaberid type; pv–sclerites indis-
of Curup Town (not far from Bengkulu City),
tinct. Hypandrium asymmetrical (as in Fig.
03°28–29’S, 102°31–38’E, 1000–1500 m, 24
1E); styli slender, more or less equal in size,
April – 2 May 2009, A. Gorochov, M. Berezin,
cylindrical (Fig. 1E).
E. Tkatsheva.
Male genitalia (Fig. 1F–N). Right phal- Paratypes. Three males; same data as for ho-
lomere (R+N) with caudal part of sclerite lotype.
R1T subrectangular in shape (Fig. 1H: Description. Male (holotype). General
c.p.R1T), covered with few bristles; cra- colour yellowish brown, with scattered
nial part of R1T nearly straight (Fig. 1H: brown spots (Figs 2A, 4C, D); facial part of
cr.p.R1T); R2 distinctly curved (Fig. 1I); head and eyes black; vertex and occiput with
R3 elongated (Fig. 1G, H); R4 and R5 yellowish striation; ocellar spots, anteclype-
large (Fig. 1H); R5 fused with sclerite R3 us and labrum pale yellowish; pronotum bor-
in caudal part (Fig. 1H). Small “chaetae- dered with yellow, with scattered black dots;
bearing membranous area” located between tegmina yellowish brown, with dark spots
right phallomere and sclerite L2D (Fig. 1F: along costal margins; coxae partly black-
c.b.m.a.). Sclerite L2D (L1) divided into ish; tarsi yellowish; abdomen brownish; anal
basal and apical parts (Fig. 1F, J); basal plate pale, speckled with small brownish
part rod-like, moderately widened crani- dots; cerci yellowish, with proximal (partly)
ally (Fig. 1F); apical part in shape of curved and ultimate segments darkened. Surfaces
sclerotized plate (Fig. 1F, J); very weak smooth and lustrous, only costal area of teg-
bristles present (visible at high magnifica- mina moderately punctured. Head in front
tion) on membranous lobe located in poste- with rounded vertex, about as long as wide
rior part of sclerotized plate (not shown in (Figs 2A, 4C); ocellar spots distinct; facial
Fig. 1F, J). Sclerite L3 (L2d) with distinct part without impressions or wrinkles; dis-
basal subsclerite (Fig. 1K, N: b.L3); “folded tance between eyes approximately 0.9 of eye
structure” distinct, with bristles (Fig. 1K, length; distance between antennal sockets
N: f.s.); hge absent. Sclerite L4U (L3d) approximately 1.8 times as great as scape
large (Fig. 1F, K). length (0.8 mm); approximate length ratio
Female unknown. of 3rd–5th segments of maxillary palps 1.0 :
Measurements (mm). Head length 3.4; 1.0 : 1.1. Pronotum as in Figs 2B, 4C. Tegmi-
head width 3.5; pronotum length 5.1; pro- na distinctly shortened (Figs 2B, 4C); wings
notum width 6.4; tegmen length 15.5; teg- vestigial, completely covered with tegmina.
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 21
Fig. 2. Cyrtonotula tertia sp. nov., (A–K, M–O – holotype; L – paratype). A – facial part of head;
B – anterior part of body from above; C – abdominal apex from above; D – paraprocts from below;
E – hypandrium from below; F, G – right phallomere of the male genitalia from below (F) and above
(G); H – sclerites R1T, R2 and R3 from side; I – sclerite L2D from above; J – caudal part of sclerite
L2D from above; K – “chaetae-bearing membranous area” from above; L – left hook (hla) in everted
station and sclerite L4U; M–O – apical part of hook hla. Dotted area shows dark colour (A) or
membranous parts (D–G, I, J, L–O). Abbreviations: b.L3; c.p.R1T; cr.p.R1T; f.s.; L4U; R2; R3; R4;
R5 – see text. Scale bars 1 mm (a for A; b for B; c for C; d for D; e for E; f for F–H, J, K; g for I; h for
L; i for M–O).
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
22 V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA
Venation of tegmina simplified, but main talia: sclerite R4 of the right phallomere in
veins (Sc, R and CuP) distinct, Sc thickened one paratype whole (without membranous
(clearly visible on ventral side of tegmen). strip).
Anterior margin of fore femur armed ac- Female unknown.
cording to type B (sensu Bey-Bienko, 1950; Measurements (mm). Head length 2.9–
Roth, 2003): with 5–6 spines, including two 3.1 (3.0); head width 2.9–3.0 (2.9); prono-
apical ones. Fore tibiae distally not thick- tum length 4.1–4.5 (4.5); pronotum width
ened. Structure of hind tarsi similar to that 5.2–5.7 (5.2); tegmen length 5.4–5.5 (5.5);
of C. secunda sp. nov. Abdomen without tegmen width (in place where CuP running
visible specializations. Anal plate (tergite into anal margin of tegmen) 3.8–4.0 (4.0).
X) triangular in shape, with weak caudal Holotype measurements in parentheses.
incision (Fig. 2C). Cerci slightly flattened Comparison. C. tertia sp. nov. is most
dorsoventrally, with segments distinctly closely related to C. secunda sp. nov. The
separated (Fig. 2C). Paraprocts of blaberid new species readily differs from the latter
type (Fig. 2D); pv–sclerites distinct. Hy- species and C. lata in strongly abbreviated
pandrium weakly asymmetrical (as in Fig. tegmina.
2E); styli slender, approximately equal in
size, cylindrical (Fig. 2E). Genus Pseudophoraspis Kirby, 1903
Male genitalia (Fig. 2F–O). Right phal-
lomere (R+N) with caudal part of sclerite Type species Epilampra nebulosa Bur-
R1T subrectangular in shape (Fig. 2F, G: meister, 1838, by original designation.
c.p.R1T), covered with few bristles, cranial Note. The genus includes 18 species from
part of R1T nearly straight (Fig. 2F–H: South China and Southeast Asia (Beccalo-
cr.p.R1T); R2 short and curved (Fig. 2G, ni, 2015), and several new species await de-
H); R3 long (Fig. 2F–H); R4 large, di- scription (Anisyutkin, unpublished data).
vided into two parts by medial membra- This genus needs revision, that is why we
nous strip; R5 weakly sclerotized, covered prefer to postpone a precise determination
with sclerite R4 (Fig. 2G) and fused with of the specimen listed below.
sclerite R3 (Fig. 2F). Small folded “chae-
tae-bearing membranous area” located be- Pseudophoraspis sp.
tween right phallomere and sclerite L2D
Material. 1 male (prep.: Pseudo ex 2408/3);
(Fig. 2K). Sclerite L2D (L1) divided into
Indonesia, Sumatra I., Sumatera Selatan Prov.,
basal and apical parts (Fig. 2I); basal part
environs of Banding Agung Vill. on Ranau Dan-
rod-like; apical part in shape of sclerotized au Lake, 04°48.695´S, 103°55.289´E, 600–700 m,
plate (Fig. 2I, J), with weak bristles (vis-
19–22 April 2009, A. Gorochov, M. Berezin,
ible at high magnification) on membranous E. Tkatsheva.
lobe located in posterior part of sclerotized Note. Data on this specimen are here in-
plate. Sclerite L3 (L2d) with distinct basal dicated, as it was used in the present mo-
subsclerite (Fig. 2L: b.L3); “folded struc- lecular analysis.
ture” distinct, with short bristles (Fig.
2L–O: f.s.); hge absent. Sclerite L4U (L3d) Genus Rhabdoblatta Kirby, 1903
large (Fig. 2L).
Variations. Distance between anten- Type species Epilampra praecipua Walk-
nal sockets approximately 1.6–1.8 times as er, 1868, by monotypy.
great as length of scape (0.8 mm); approxi- Note. The genus Rhabdoblatta is one of
mate length ratio of 3rd–5th segments of the largest in the subfamily Epilamprinae
maxillary palps 1.0–1.3 : 1.0 : 1.1–1.3. An- and includes over 100 species (Beccaloni,
terior margin of fore femur with 5–7 spines 2015). It is distributed from Japan and
including 1–2 apical ones. The male geni- South China to South Asia and Australia
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30
V.A. MAVROPULO ET AL. NEW DATA ON BLABERIDAE FROM SOUTHEAST ASIA 23
(Beccaloni, 2015). Greater Sunda Islands lar spots and adjacent areas, areas near eyes,
are characterized by a diverse and insuffi- and clypeus whitish; labrum yellowish; an-
ciently studied fauna of Rhabdoblatta, and tennae dark brown with apical segments
it is evident that many species remain to be (starting from 44th–46th segments) whit-
discovered. Taking that into consideration, ish; pronotum black, laterally bordered with
we postpone a precise determination of sin- yellow; tegmina blackish, slightly lighter
gle species. toward apex; each tegmen with small indis-
Also, it is reasonable to mention that the tinct yellow spot at base of CuP; legs with
authors treated Rh. praecipua as a valid spe- coxae, trochanters and partly femora yel-
cies, but not as a synonym of Polyzosteria lowish brown, with distal parts of femora,
terranea Walker, 1868 (Anisyutkin, 2014). tibiae and tarsi dark brown, and with tibiae
darker than tarsi (nearly black); abdomi-
Rhabdoblatta sp. nal tergites and sternites dark brown, with
lateral yellow spots; anal plate finely bor-
Material. 1 male (prep.: Rh. ex 2408/05); In- dered with pale colour; cerci black, with
donesia, Sumatra I., Bengkulu Prov., environs pale apices. Surfaces smooth and lustrous;
of Curup Town (not far from Bengkulu city), antennae with lustrous proximal 10–11
03°28–29´S, 102°31–38´E, 1000–1500 m, 24
segments and rest part mat; facial part of
April – 2 May 2009, A. Gorochov, M. Berezin,
head, pronotum and costal area of tegmina
E. Tkatsheva.
moderately punctured. Head in front with
Note. Data on this specimen are here in-
rounded vertex, slightly longer than wide
dicated, as it was used in the present mo-
(Figs 3A, 4E); ocellar spots small; facial
lecular analysis.
part with very weak impression between
antennal sockets (visible at high magnifi-
Subfamily Paranauphoetinae
cation); distance between eyes about equal
J.W.H. Rehn, 1951
to length of eye; distance between antennal
Genus Paranauphoeta sockets approximately 1.4 times as great
Brunner von Wattenwyl, 1865 as length of scape (1.3 mm); approximate
length ratio of 3rd–5th segments of max-
Type species Blatta circumdata (de illary palps 1.1 : 1.0 : 1.3. Pronotum as in
Haan, 1842), by subsequent designation. Figs 3B and 4F, caudally truncated, with
The genus includes 16 species from In- lateral carinae (sensu Shelford, 1908; An-
dian subcontinent, Southeast Asia, South isyutkin, 2003a) very weak. Tegmina and
China and New Guinea (Beccaloni, 2015). wings fully developed, projected behind
abdominal apex, rounded apically. Vena-
Paranauphoeta pullata sp. nov. tion of tegmina partly obliterated (oblit-
(Fig. 3A–Q, 4E, F) eration more expressed in proximal half of
tegmina), with Sc, R and CuP distinct; Sc
Holotype. Male (prep.: ex. 2108/03, prep.
thickened (easily visible on ventral side
18); Indonesia, Sumatra I., Sumatera Selatan
of tegmen); anterior branches of R incras-
Prov., environs of Banding Agung Vill. on Ranau
sate and constituting corrugated structure.
Danau Lake, 04°48.695´S, 103°55.289´E, 600–
Anterior margin of fore femur unarmed.
700 m, 19–22 April 2009, A. Gorochov, M. Bere-
Fore tibiae not thickened distally; all tibiae
zin, E. Tkatsheva.
Paratypes. One male (prep.: ex. 2108/01, with spines weak and not numerous. Fore
prep. 8), 1 female (prep.: ex. 2108/02); same data left tarsus abnormal: 2nd and 3rd segments
as for holotype. fused. Structure of hind tarsus (Fig. 3C):
Description. Male (holotype). General metatarsus shorter than other segments
colour blackish brown, partly yellowish combined, with several spines along lower
(Figs 3A, 4E, F); head and eyes black; ocel- margin arranged in single incomplete row;
© 2015 Zoological Institute, Russian Academy of Scienсes, Zoosystematica Rossica 24(1): 14–30