Table Of Content

PROTOCOL Virulence3:6,539–542;October1,2012;G2012LandesBioscience Multiple locus VNTR fingerprinting (MLVF) of Streptococcus pyogenes Katarzyna Obszańska, Anna L. Borek, Waleria Hryniewicz and Izabela Sitkiewicz* DepartmentofEpidemiologyandClinicalMicrobiology;NationalMedicinesInstitute;Warszawa,Poland Streptococcus pyogenes (GAS) is a within S. pyogenes genome (PP, phage human pathogen that causes mil- profiling).1-3 Nevertheless, both methods lions of infections worldwide. aremorefocusedonmobileportionofthe Comparison between GAS strains iso- genome. To improve and balance the lated in different laboratories all over the typing scheme developed for GAS and to world is often difficult. Three usually reflect variability of a core (non-MGE used methods have either low resolution related) genome, we recently proposed a (emm typing), are expensive (MLST) or new typing method.4 time- and labor-consuming (PFGE). Our Multilocus variable tandem repeat ana- laboratory recently developed new, inex- lyses (MLVA and MLVF) are methods pensive methods of GAS typing—VF based on the detection of repeated (virulencefactorprofiling)andPP(phage sequences within bacterial genomes. profiling).Toimprovethetypingscheme MLVF (multiple locus variable number developedforGAS,werecentlyproposed tandem repeat fingerprinting) is based on a new typing method. Here we present the amplification of several loci of variable detailed protocol for MLVF analysis. size and comparison of generated band patternswithareference.MLVA(multiple locus variable number tandem repeat analysis)isbasedonthesameprinciples as Introduction MLVF, but instead of pattern analysis, number of repeated sequences within each Streptococcus pyogenes (GAS) is a human locus is used to generate unique code that pathogenthatcausesmillionsofinfections can be stored in the database. Both worldwide. Comparison between GAS methodsarecheap,fastanddonotrequire strains isolated in different laboratories all specialized equipment, except a thermo- overthe world isoften difficult.Currently cyclerandelectrophoresistank.Informative threemajormethodsareusedtodetermine results, comparable with PFGE analysis, relationships between GAS strains: canbeavailableinlessthan10h. (1) emm typing, which allows for clas- The method we developed is based on sification of strains into ~150 serotypes, the size variation within seven loci. The (2) multilocus sequence typing (MLST) number of the size variants varies from and (3) restriction analysis combined with severaltotensfortestedgenes.Asaresult, pulse field gel electrophoresis (PFGE). All about 40,000 MLVF patterns can be Keywords: MLVF, typing, Streptococcus three methods have either low resolution generated4.Themethodisusedforroutine pyogenes, multiplex PCR, PCR detection (emm typing), are expensive (MLST) or work and S. pyogenes typing in our Submitted: 06/15/12 time- and labor-consuming (PFGE). Our laboratory. We analyzed over 700 strains laboratory recently developed new, inex- using the procedure described below and Revised: 10/03/12 pensive methods of GAS typing. The first observed that homogenous populations, Accepted: 10/04/12 method (VF), allows detection of 20 which belong to the same M type and http://dx.doi.org/10.4161/viru.22459 virulence factors, the second method is exhibitthesamePFGEpatternandMLST based on PCR detection of the mobile profile, can be further differentiated using *Correspondenceto:IzabelaSitkiewicz; Email:[email protected] genetic elements (MGE) integration sites MLVA typing.4 www.landesbioscience.com Virulence 539 Table1.StartersusedforMLVAtyping lysozyme, 5 ml of RNase and 2.5 ml of Primer Primerdesignation Primersequence mutanolysin for about 30–45 min at number 37°C. Purified DNA used as a template 1 Spy1_MLVA_F AGTTGCGGTGTCAGCATCAG should be diluted 10(cid:1) to a ~10 ng/ml concentration. We usually run multiple 2 Spy1_MLVA_R AGCGCAGCAGCTGTAAAGAA analyses in 96-well plate format, so we 3 Spy4_MLVA_F CCTGATCACTATTAGTAACAGACTTAAC dispensedilutedDNAtostandard96-well 4 Spy4_MLVA_R ACTGCATGATGACTGGGTACAC plate and use it in further reaction setup. 5 Spy2_MLVA_F CAGCTGCTGAAGATGGCTTATCAG Diluted template DNA should be kept at 6 Spy2_MLVA_R GCGTTGGGGTAACGAGTATAGC 4°C to avoid freezing/thawing cycles. 7 Spy3_MLVA_F AGGTGCAAGTGCGGTTAAGG Starters. Because the amplification efficiency of designed starters varies, we 8 Spy3_MLVA_R GTCGTGAGCTGCCGGTGTTTTTG combine various amounts of individual 9 Spy6_MLVA_F CTCACGTAAGCCGCTGATGA 100 mM primers stocks to prepare 10 Spy6_MLVA_R CTCCCAAAGACCAGTCGTCTC primer mastermix that used in the PCR 11 Spy7_MLVA_F TAAATTCTCAAACATCTTATCAGTTTCATTTTGAG reaction will yield products of compar- 12 Spy7_MLVA_R CTCAAACAACTGATGATGCTGACAGAGACTATG able intensity. We mix 1 volume of 13 Spy5_MLVA_F GCCAACTAAGGGTTCAGGTCAG primers 1–6, 0.5 volume of primers 7– 10, 2 volumes of primers 11 and 12 and 4 volumes of primers 13 and 14. For Reagents Equipment example:30mlofprimers1to6,15mlof primers 7 to 10, 60 ml of primers 11 and (1) RNase 10 mg/ml (Sigma-Aldrich, (1) Veriti PCR cycler (Life Technologies). 12 and 120 ml of primers 13 and 14. R5503) (2) Gel electrophoresis tank (BioRad, Primer mix should be aliquoted into 25– (2)Lysozyme20mg/ml(Sigma-Aldrich, 170-4511) with 26 well combs (BioRad, 250mlportionsandstoredat−20°Cuntil L6876) 170-4525) use. Each primer mix portion should (3)Mutanolysin10U/ml(Sigma-Aldrich, never be thawed/frozen more than 2 M9901) Setup times. (Problem 1) (4)1mMstockoffourdNTPprepared Reaction setup. (1) Prepare diluted from100mMstocksolutionsofindividual Template.AsatemplateforPCRreaction template DNA (as described above), dNTPs(Sigma-Aldrich,DNTP100) we use chromosomal DNA isolated using preferably in 96-well format, or 8-well (5) Taq polymerase (Fermentas, commerciallyavailablekits.Wehavegood strips. Template DNA dispensed into EP0402) results with columns Genomic Mini wells/strips can be easily transferred to (6) 10(cid:1) Taq buffer with (NH ) SO produced by A&A Biotechnology (116- reaction wells with a multichannel 4 2 4 (Fermentas, B33) 250), but kits available from other man- pipette. (7) 25 mM MgCl stock solution ufacturers may be used as well. S. pyogenes (2) Mix together all reagents for PCR 2 (Fermentas, R0971) cells for DNA isolation are grown on half mastermix according to Table 2. (8) Starters (Table 1; Genomed, www. oftheagarplate(Columbiawith5%sheep (3)Dispense9mlofpreparedmastermix genomed.pl) blood, multiple manufacturers). Prior toeachofthereactionwellsorPCRtubes. (9) 2.5% wt/vol NuSieve agarose purification bacteria are scraped from the (4) Transfer 1 ml of DNA template (Lonza, 50094) (in 1(cid:1) TBE) plate and re-suspended 200 ml of TE from template DNA plate to the reaction (10) 1(cid:1) TBE electrophoresis buffer buffer. Bacteria are treated with 10 ml of plate with multichannel pipette. Table2.CompositionofPCRmastermix PCRmastermix 1(cid:1)persinglereaction(ml) 55(cid:1)perhalfof96wellplate(ml) 110(cid:1)per96wellplate(ml) Primermix 2.5 137.5 275 Buffer10(cid:1) 1 55 110 25mMMgCl 1.6 88 176 2 1mMdNTP 1.6 88 176 Taqpolymerase 0.1 5.5 11 H O 2.2 121 242 2 540 Virulence Volume3Issue6 reference strain (size or present/absent) (Problem 2). Timing (1) DNA isolation ~90 min (2) Reaction setup ~15 min (3) PCR ~4 h (4) Electrophoresis ~3.5 h Problem Handling Problem 1. We sometimes observe low yield of PCR products. This is a result of non-efficient PCR amplification that is caused either by low quality of primers or template.Primersandthetemplateusedin the reaction are often degraded after multiple freezing/thawing cycles. To max- Figure1.ResultsofroutineMLVFanalysisof17GASstrains.Eachstrainismarkedwithemmtype, imize PCR efficiency primer mastermixes VFprofile1,2andPPprofile,1,3eachnumericaldesignationdenotesuniquepatternwithinthe analyzedgroupofstrains,strainswiththesamedesignationhaveidenticalprofiles.Identical arekeptat−20°Cinsmallportionsandare patterns6and7representtwostrainsofthesameserotype(M89),thesameVFprofile(3)andthe neverfrozen/thawedmorethantwotimes. samePPprofile(2).Patterns14–17representfourM117strains.MLVFpatternsofstrains15–17,as AlsodilutedchromosomalDNAiskeptin wellasVFandPPprofiles,areidentical,strain14hasdistinct,butrelated,MLVFandVFprofiles. thefridgetoavoidmultiplefreezingcycles. Lane1:GeneRuler50bpstandard(Fermentas). Problem 2. In some patterns, very strong bands can be observed among (5) Close tubes or seal the plate. electrophoresis cell for 3.5 h. Gels are weaker ones. It is a result of multiple (6)Mixwellandspinfor15sec(tubes) visualizedunderUVlightandphotographed. bands of similar size. Double, more or 1 min at 500 rpm (plates). (3)Gelanalysis.Patternanalysiscanbe intense bands are often observed for M1 (7)Placethepreparedplate/tubesinthe performed on multiple levels. (1) When (about 750 bp in size) and M28 (about thermocycler and run the program. MLVF is simply used to check if two or 630 bp) serotype strains. Depending on Equipment setup. No special setup more strains are identical, visual band the electrophoresis equipment, for better is required. We usually store saved matching of two or multiple patterns can separation of PCR products, time of PCR amplification program listed be performed. (2) In case of multiple electrophoresis could be extended. below. samplesthatgeneratevariablepatterns,we recommend more detailed analysis. Anticipated Results Procedure Usually, based on the photograph, we estimate size of the amplified products The gel presented in Figure1 shows (1) PCR amplification. Initial with the imaging software that allows typical results of MLVA analysis of denaturation, 95°C, 5 min automatic determination of the product multiple strains. MLVA patterns in lanes 40cyclesof:denaturation,95°C,15sec; size (in our case Molecular Imaging 6–7 are identical and represent two annealing,64°C,30sec;elongation,72°C, Software by Kodak, supplied with the strains of serotype M89 with identical 4 min 30 sec GelLogic 2000 imaging system). It is virulence factor profiles (VF) and phage Final elongation, 72°C, 7 min mucheasiertocompareproductsizesthan profiles (PP), patterns 8 and 9 are related (2)Gelelectrophoresis.Theproductsof patterns on the gel photograph. (3) To and represent two M95 strains with multiplex PCR reactions are analyzed by compare MLVF patterns of samples run identical virulence factor profile (VF). electrophoresis in 2.5% (wt/vol) NuSieve on multiple gels we use BioNumerics Patterns 7 and 8 are not related. All agarose gel with ethidium bromide, in software.Thesoftwareallowstonormalize bands in these patterns differ in size or standard TBE buffer. We usually use 50 patterns between multiple gels/runs, com- are not present. bpand100bpladder(Fermentas,SM0371, pare them to each other, and cluster SM0321), which allows precise fragment similar patterns. Acknowledgments sizedetermination. We consider two strains as closely The work was financed by the grant from Electrophoresis is performed with con- related if they differ by no more than National Center for Science (NCN) stantcurrent100mAinSub-CellModel192 single band within the profile from the number NN401 536140. www.landesbioscience.com Virulence 541 References 3. BorekAL,ObszańskaK,HryniewiczW,SitkiewiczI. TypingofStreptococcuspyogenesstrainsusingthephage 1. Borek AL, Wilemska J, Izdebski R, Hryniewicz W, profiling method. Virulence 2012; 3:534-38; PMID: SitkiewiczI.Anewrapidandcost-effectivemethodfor 23076280;http://dx.doi.org/10.4161/viru.21887 detectionofphages,ICEsandvirulencefactorsencoded 4. ObszańskaK,BorekAL,Izdebski R, Hryniewicz W, byStreptococcuspyogenes.PolJMicrobiol2011;60:187- SitkiewiczI.Multilocusvariablenumbertandemrepeat 201;PMID:22184925 analysis(MLVA)ofStreptococcuspyogenes.JMicrobiol 2. BorekAL,ObszańskaK,HryniewiczW,SitkiewiczI. Methods2011;87:143-9;PMID:21920391;http://dx. DetectionofStreptococcuspyogenesvirulencefactorsby doi.org/10.1016/j.mimet.2011.08.017 multiplex PCR. Virulence 2012; 3:529-33; PMID: 23076284;http://dx.doi.org/10.4161/viru.21540 542 Virulence Volume3Issue6