Biogeosciences,11,1727–1741,2014 O p www.biogeosciences.net/11/1727/2014/ e n doi:10.5194/bg-11-1727-2014 Biogeosciences A c c ©Author(s)2014.CCAttribution3.0License. e s s Microbial and metabolic profiling reveal strong influence of water table and land-use patterns on classification of degraded tropical peatlands S.Mishra1,2,3,W.A.Lee3,A.Hooijer4,S.Reuben3,I.M.Sudiana5,A.Idris6,andS.Swarup1,2,3,7 1MetabolitesBiologyLaboratory,DepartmentofBiologicalSciences,NationalUniversityofSingapore(NUS),117543, Singapore 2NUSEnvironmentalResearchInstitute,NUS,T-LabBuilding,5AEngineeringDrive1,117411,Singapore 3Singapore-DelftWaterAllianceBlockE1,No1EngineeringDrive2,NUS,117576,Singapore 4Deltares,P.O.Box177,2600MHDelft,theNetherlands 5CibinongScienceCenter,LIPI,Jl.RayaBogorKm46,CibinongBogor,16911,Indonesia 6FacultyofAgriculture,UniversityofJambi,Jambi,36122,Indonesia 7SingaporeCentreonEnvironmentalLifeSciencesEngineering(SCELSE),60NanyangDrive,NTU,637551,Singapore Correspondenceto:S.Swarup([email protected]) Received:21July2013–PublishedinBiogeosciencesDiscuss.:26August2013 Revised:18January2014–Accepted:9February2014–Published:3April2014 Abstract.TropicalpeatlandsfromsoutheastAsiaareunder- could distinguish communities not only based on land-use going extensive drainage, deforestation and degradation for types but also their geographic locations, thus providing a agricultureandhumansettlementpurposes.Thisisresulting finer resolution than bacterial profiles. Agricultural inputs, in biomass loss and subsidence of peat from its oxidation. such as nitrates, were highly associated with bacterial com- Molecularprofilingapproacheswereusedtounderstandthe munitystructureofoilpalmplantations,whereasphosphates relative influences of different land-use patterns, hydrologi- and dissolved organic carbon influenced those from mixed calandphysicochemicalparametersonthestateofdegraded crop plantations and settlements. Our results provide a ba- tropicalpeatlands.Asmicrobialcommunitiesplayacritical sisforadoptingmolecularmarker-basedapproachestoclas- role in biogeochemical cascades in the functioning of peat- sify peatlands and determine relative importance of factors lands,weusedmicrobialandmetabolicprofilesassurrogates that influence peat functioning. Our findings will be useful of community structure and functions, respectively. Profiles inpeatlandmanagementbyprovidingabasistofocusearly weregeneratedfrom230bacterial16SrDNAfragmentsand effortsonhydrologicalinterventionsandimprovingsustain- 145metabolicmarkersof46samplesfrom10sites,includ- ability of oil palm plantations by adopting mixed cropping ingthosefromaboveandbelowwatertableinacontiguous practicestoincreasemicrobialdiversityinthelongterm. areaof48km2 coveringfiveland-usetypes.Thesewerede- gradedforest,degradedland,oilpalmplantation,mixedcrop plantation and settlements. Bacterial profiles were most in- fluenced by variations in water table and land-use patterns, 1 Introduction followed by age of drainage and peat thickness in that or- der.Bacterialprofilingrevealeddifferencesinsites,basedon Peatlands are formed by the accumulation of partially de- the duration and frequency of water table fluctuations and cayed vegetation matter over over millennial timescales in onoxygenavailability.Mixedcropplantationshadthemost low-lyingareasthatarefrequentlywaterloggedduetoheavy diverse bacterial and metabolic profiles. Metabolic profil- rainfall or periodic inundation (Anderson, 1964). Peatlands ing,beingcloselyassociatedwithbiogeochemicalfunctions, areahighlyvulnerablenaturalresourcethatcover50–70% of global wetlands (Finlayson et al., 1999) and sequester PublishedbyCopernicusPublicationsonbehalfoftheEuropeanGeosciencesUnion. 1728 S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands one-thirdoftheworld’ssoilcarbon(Freemanetal.,2012).In In most ecosystems, changes in land-use patterns impact southeastAsia,peatlandscoveranareaofnearly25million both microbial diversity and their activity (Wardle et al., haandstoreapproximately69Gtofcarbon,whichis77%of 1998;Ollivieretal.,2011;Putten2012).Watertabledepth, allthetropicalpeatlandcarbonpool(88.6Gt),ofwhich65% which directly affects the oxygen levels in the peat layer (57.4Gt of carbon) is in Indonesia itself, distributed within (Lahde, 1969), is an important factor in shaping bacterial 23.4millionha of peatland (Page et al., 2011). Carbon den- community structure. Water table depth also affects water sity is relatively high in tropical compared to temperate or stress, which has been shown to have direct and indirect borealpeatlands;thisislargelyaconsequenceofdeeperpeat influences on soil bacterial community composition (Fierer layersintheformer,withpeatthicknessupto20m(Pageet etal.,2003).Whilegeochemicalconditionsaffectmicrobial al.,2002). communities, they, in turn, affect their environment. There- Southeast Asian peatlands are under threat from anthro- fore,itisimportanttostudymicrobialcommunitycomposi- pogenicactivities,predominantlyduetodrainageanddefor- tion.Molecularprofilingapproacheshavebeenwidelyused estationforagricultureandhumansettlementpurposes.For- to describe microbial diversity in soil, rhizosphere, extreme est fires and biomass burning linked to land-use change ex- environments, freshwater and mangrove ecosystems (Bai et acerbatethesethreats.ThesefireeventsinIndonesiacrossed al., 2012; Chan et al., 2013; He et al., 2012; Nold et al., allpastrecords,hitting371inthePollutantStandardsIndex 2000; Xiong et al., 2010). Microbial profiling approaches (PSI)inSingapore,basedondailyaverage,duringthesmog thatarenowwidelyusedmainlyrelyonDNAfingerprinting eventthatengulfedneighboringcountries,suchasSingapore (Zhou,2003;Nockeretal.,2007;Nazariesetal.,2013)oron and Malaysia (Schmaltz, 2013). Such land-use changes and pyrosequencing of ribosomal DNA region (Chistoserdova, hydrologicalinterventionshaveresultedinadrasticdecrease 2010;Heetal.,2010).Morerecently,metabolicprofilinghas in peatland water tables, exposing the biomass sequestered alsoemergedasausefulapproachtoreportstatusofmicro- in the peat to aerobic microbial oxidation. Of the total area bial functions in soil (Bundy et al., 2009) and rhizosphere of peatlands in Indonesia, at least 2.2millionha have been (Leeetal.,2013).Tworecentstudiesofintact,forestedpeat- converted to commercial oil palm plantations, which is ex- landsfromThailand(Kanokratanaetal.,2011)andMalaysia pected to increase to 6.2millionha by 2020 (Miettinen et (Jackson et al., 2009) used pyrosequencing and fingerprint- al.,2012a).Interspersedwithintheplantationsaresmallar- ingapproachestodescribetheirmicrobialdiversityandfunc- easoftemporaryhumansettlements.InpeninsularMalaysia tional properties, respectively. They demonstrated the capa- and the islands of Sumatra and Borneo, some 60% of peat bility of such techniques to show broad phylogenetic diver- swamps had been partly or completely deforested by 2007, sityandgeneticpotentialtodegradebiomass,respectively. usually accompanied by some form of drainage, and only Indegradedtemperatepeatlands,i.e.,thosepeatlandsthat 10% remained in pristine condition (Miettinen and Liew, haveundergonemassiveland-usechangeduetodrainageand 2010).Inrecentyears,rapidlyincreasingpeatcarbonlosses deforestation, much is known about the relationship of mi- fromdrainedpeatlandsinsoutheastAsiahavebeenfoundto crobialdiversitytopeatlandfunctioningandgreenhousegas contribute significantly to global greenhouse gas emissions emissions(Opeltetal.,2007;Ausecetal.,2009;Kimetal., (Melling et al., 2005; Furukawa et al., 2005; Couwenberg 2012; Tveit et al., 2013). In contrast, for tropical peatlands, et al., 2010). Estimates of net carbon losses and resultant wehavearelativelypoorunderstandingoftherelationshipof CO emissions from peatland drained for agriculture range microbialdiversityandfactorsinfluencingcommunitystruc- 2 from 30–40tCO ha−1yr−1 (Murdiyarso et al., 2010; Her- ture for intact as well as tropical peatlands under land-use 2 goualc’handVerchot,2011)toashighas70tCO ha−1yr−1 change.Givenboththeecologicalandeconomicimportance 2 (Couwenberg et al., 2010; Jauhiainen et al., 2012), exclud- ofthesepeatlands,itwillbeusefultounderstandthediffer- ing forest biomass losses, fire losses and peat organic mat- ences among various land-use patterns in degraded tropical ter losses in the initial years after drainage. Carbon losses peatlandwithrespecttomicrobialecology.Towardsthisdi- from such emissions and through fluvial processes have led rection,itiscriticaltodevelopscientificmethodstomanage totropicalpeatlandsbeingtransformedfromcarbonsinksto therapidchangeinlandusefrompristineconditionsofpeat- carbonsources(Mooreetal.,2013).Theoxidationofdrained lands and monitor the progress as well as effectiveness of peatiscausingrapidsubsidencebydisappearanceofthesur- ecosystemrestorationinterventions.Inconjunctionwithex- face layers in the peat (Kool et al., 2006; Couwenberg and isting methods, such as field surveys of flora and fauna of Hooijer, 2013). In a recent study from the same region of tropicalpeatlandsthatareundergoingland-usechange(Posa Sumatra,peatwasreportedtosubsideatarateof5cmyr−1, etal.,2011),thesecombinedapproachesneedtobeadopted ofwhich92%lossisduetooxidationandnotcompactionor toclassifypeatinordertoconserveremainingpristinepeat- plantrespiration(Hooijeretal.,2012).Oxidationoforganic lands.Ourapproachisbasedontheabilityofmolecularpro- matterhasbeenshownusingmesocosmsofborealpeattobe filingtocaptureshiftsincommunitystructureandmetabolic due to stimulation of microbial growth, thereby causing the profilingtoreflectthefunctionaloutcomeofmetabolicactiv- breakdown of organic matter and release of carbon dioxide itiesofmicrobes,plantrootsandtheirexudates,respectively. inabiogeochemicalcascade(FennerandFreeman,2011). Using these two microbial profiling approaches, we report Biogeosciences,11,1727–1741,2014 www.biogeosciences.net/11/1727/2014/ S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands 1729 theeffectsofwatertabledepthandoxygenavailability,land- tation”, depending on land cover in that area; and (5) small usepatterns,ageofdrainageandpeatthicknessonbacterial holdermosaicandbuilt-upareas(188km2,or6%)wasclas- diversity in degraded peatlands of Indonesia. We focus on sified as “settlements”. For this study, the contiguous land- five land-use patterns from a contiguous study site: (a) de- usetypeswerechosenthatwerepresentinSiteAandSiteB. gradedforest,whichincludesdrainedandheavilydeforested Intact PSF was not included in this study because of being peatswampforest;(b)degradedland,whichincludesdefor- non-contiguous. ested and drained peatlands that have yet to undergo con- The coordinates of sampling locations distributed across version for agricultural use; (c) oil palm plantation, which two broad areas, referred to as Site A and Site B, includes peatland area under palm plantations; (d) settle- were 103◦53052.5800E, 1◦43012.4700S and 103◦49032.2300E, ments,whichincludespeatlandareaunderpalmplantations 1◦40058.2400S,respectively(Fig.1).Thetotalareascovered interspersed with human settlements; and (e) mixed crop by the sites were 42 and 6km2, respectively. Out of five plantation, which includes peatland area under palm plan- land-use patterns, degraded land with similar peat physical, tations,pineappleandtapioca.Inordertodetermineimpor- geological and hydrological conditions was present in both tanceofvariousmanagementpracticesofthesepeatlandson SiteAandSiteB(Fig.1).Allstudysites(Fig.1)havebeen the structure and functioning of the bacterial communities, affected by fire in the past. The only exception is the de- westudiedtheinfluencesof11physicochemicalparameters. graded forest (DHFN: Deep peat depth, High water table, Basedonourfindingsreportedhere,wemakerecommenda- Degraded Forest and New drainage <10years; please re- tions that will help in the classification, improved manage- fer to legends of Fig. 1 for acronyms of site description). mentandsustainabilityoftropicalpeatlands. The fire events have occurred in the past in degraded land (DHAN) in Site A and B in 2004 and 2005, respectively. Burningoccurredinoilpalmandmixedcropplantationsites 2 Materialsandmethods inSiteB(MHPN,DHPN,MHXNandSHXN)in2004,sites withoilpalmplantationsinSiteAinlowwatertabledepth 2.1 Sitedescriptionandsampling (MLPO) in 2001, and sites in oil palm plantations (DHPO) andinsettlements(DHTO)in2000.Aspartofroutineman- The study area is located in peatlands of the eastern part of agement practices, fertilizers are applied to the sites that Jambiprovince,Sumatra,Indonesia(Fig.1).Forestedtropi- fall within oil palm and mixed crop plantations. The main calpeatlandsareextensiveinthisareaandavarietyofland- categories of fertilizer are nitrogen–phosphorus–potassium use patterns are present due to land intensification activi- (NPK 16:16:16) and urea, which are applied three times ties. Land-cover classification was performed using visual ayear,andpotassiumchloride(KCl),whichisappliedonce image interpretation and manual on-screen delineation of ayear. land-cover polygons. The classification scheme was mainly Inordertomonitorthehydrologicalparameters,bothrain- basedonvariationinphysicalvegetationcharacteristics(e.g., fall and water table depths were measured periodically us- height,sparseness,etc.)andincludedthemainphasesofthe ing rain gauges at strategic locations and dipwells in each tropicalpeatlandconversionanddegradationprocesses(Mi- transect.ThedipwellsconsistedofperforatedPVCpipesan- ettinen et al., 2012b). The Landsat image and base maps chored into peat, reaching the mineral subsoil. These dip- of field sites were obtained from the University of Jambi, wellswereusedtomonitorwatertabledepthchangesevery Jambi, Indonesia. The coordinates of monitoring sites were two weeks, since 2009. Rainfall measurements were moni- recorded using handheld global positioning system (GPS) tored on a daily basis. Average water table depths and total devices.Thecoordinatesofthesesiteswereinsertedontothe rainfall were calculated for every month. Data from August base maps using ArcView and ArcMap programs (ArcGIS- 2009 to August 2010 are being reported in this study. Sam- Esri,CA,USA). pling was performed in March 2010, preceding which the The overall mapped area in the eastern part of Jambi highestmonthlyrainfall(370±25mm)intheperiodstudied comprised a total of 3390km2 (Fig. 1), out of which wa- wasrecordedinFebruary2010. ter/seasonal water comprised 11km2, or 0.3% of total At each sampling location, a 1m3 pit was dug. Three mapped area. The land-cover classes used in Miettinen et equidistant pits were used for sampling in each transect. al. (2012b) were regrouped and reclassified for this study. These transects ranged between 120 and 550m at differ- The land cover comprising (1) slightly and moderately de- entsamplinglocations.Wetooksamplesatapredetermined graded peat swamp forest (PSF) (1656km2, or 49% of to- distance from the water table along the wall of the pit. At tal mapped area) was classified as “intact PSF”; (2) heav- thisdistance,wereachedhorizontally10cmintothepeatto ily degraded PSF and secondary forest (543km2, or 16%) collect least disturbed samples. This process was repeated was classified as “degraded forest”; (3) shrubs, fern/grass for each of the four walls of the pit at the same distance andclearancearea(712km2,or21%)wasclassifiedas“de- from the water table. A composite was then prepared us- graded land”; (4) commercial plantations (279km2, or 8%) ing these four samples. The number of specified distances wasclassifiedas“oilpalmplantation”or“mixedcropplan- in sampling varied according to the water table depths in www.biogeosciences.net/11/1727/2014/ Biogeosciences,11,1727–1741,2014 1730 S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands Fig.1 Fig. 1. Map showing Sumatra Island in Indonesia (top left) and land cover present in the eastern part of Jambi province (right). Study ◦ 0 00 ◦ 0 00 ◦ 0 00 sitesinthisregionofJambi,SiteAandSiteB,arelocatedatgeographicallocations103 5352.58 E,1 4312.47 Sand103 4932.23 E, 1◦40058.2400S,respectively.Abbreviationsareasfollows:D,deeppeatthickness(>7m);M,mediumpeatthickness(3–7m);S,shallowpeat thickness(<3m);H,highwatertable(0–45cm);L,lowwatertable(>45cm);F,degradedforest;A,degradedland;P,oilpalmplantations; T,settlements;X,mixedcropplantations;N,drainage(<10years);O,drainage(>10years).Land-usepatternsdescribedinthisstudyare indicatedwithinbracketsinitalicsinthelegendboxabove. different sites. Samples using the above mentioned strategy plantationwasflooded;hence,onlyonesamplewascollected were collected at a distance of 20–30cm above water table BWTandnonefromtheAWTposition.Peatwatersamples (AWT)andfrom20–30cmbelowwatertable(BWT)inster- formetabolicprofilingwerecollectedfromdipwellsadjacent ile50mLtubesfromallsites,withexceptionsat4sites.At toeachpit.Allsampleswereshippedonicetothelaboratory threeoilpalmplantationsitesintheMLPOtransect(Fig.1), and processed immediately. In order to analyze the oxygen the water table was extremely low (80cm below peat sur- availabilityateachsamplingpoint,anOX-NClark-typeoxy- facelevel);hencesampleswerecollectedfrom20–30cmand gensensor(Unisense,Aarhus,Denmark)wasusedanddata 50cmAWT,respectively.Onelocationwithinamixedcrop wererecordedmanually Biogeosciences,11,1727–1741,2014 www.biogeosciences.net/11/1727/2014/ S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands 1731 2.2 Bacterialcommunitystructure(terminal calcium using an ion chromatography analyzer (ICS-5000, restrictionfragmentlengthpolymorphism Dionex). (T-RFLP)analysis) PeatwatersampleswererunthroughaSolidPhaseExtrac- tion cartridge using an Oasis® HLB cartridge (1cc/30mg; Bulk peat gDNA was extracted using a ZR Soil Mi- 30µm, Waters, USA) in order to extract, concentrate and crobe DNA MidiPrep™ extraction kit (Zymo Research clean up the metabolites (Parab et al., 2009). The samples Corporation, Irvine, USA) based on the manufacturer’s were analyzed using ultra-performance liquid chromatogra- protocol, with minor modifications. The extracts were phy (UPLC) in a Waters ACQUITY UPLC™ system (Wa- quantified spectrophotometrically (Nanodrop ND-1000, ters Corp., MA, USA), equipped with a binary solvent Nanodrop Technologies, Wilmington, DE, USA). Bacterial delivery system and an autosampler. The chromatography 16S rRNA genes were amplified using universal primer, was performed on a Waters ACQUITY C 1.7µm column 18 BSF517-GCCAGCAGCCGCGGTAA and BSR1541/20- (100×2.1mm).Massspectrometrywasperformedbasedon AAGGAGGTGATCCAGCCGCA (Wilmotte et al., 1993). MSconditionsusingamassspectrometerequippedwithan For T-RFLP analysis, forward primer was labeled with electrospray ionization source (UPLC-TOF-Bruker Dalton- 6-carboxyfluorescein (FAM) at the 50 end and reverse ics).DatawereextractedusingBrukerDaltonicsprofileanal- primer was labeled with photo-induced electron transfer ysissoftware. (PET)atthe30 end.PCRwasperformedintriplicate(50µL reaction) using 50ng of template DNA and the following parameters:initialdenaturationat95◦Cfor10min,followed 2.4 Dataanalysis bydenaturation95◦Cfor1min,annealingat58◦Cfor30s, extensionat72◦Cfor1minandfinalextensionat72◦Cfor Toanalyzethevariationinbacterialcommunitystructureas 7 min. Agarose gel electrophoresis, followed by staining well as difference in metabolic functions, due to influence of products with SYBR Green (Invitrogen, USA) was per- fromanalyzedparameters(namely,watertable,land-usepat- formed to check amplified product size and concentration. terns, age of drainage and peat thickness), multivariate sta- Amplicons from three replicates of PCR were pooled and tisticaltechniques(PRIMER6,PRIMER-E,Ltd.,Plymouth, cleaned up using NucleoSpin® Extract II according to United Kingdom) were used to calculate distance matrices the manufacturer’s instructions. Five hundredng of each usingBray–Curtissimilarityindicesandone-wayANOSIM amplicon were digested with restriction enzymes Alu I and (Analysis of Similarity) coefficients (Legendre and Legen- Bsu RI (Fermantas) at 37◦C for 16h. Digests were then dre, 1998). Unconstrained ordination plots with 100 iter- purifiedusingtheNucleoSpin® ExtractIIkit,andanaliquot ations using nonmetric multidimensional scaling (nMDS) of 1µL was mixed with 8.5µL HiDi formamide (Applied based on Bray–Curtis similarity were used to represent the Biosystems, Foster City, CA, USA) and 0.5µL of internal outcome (Kruskal 1964, Shepard 1962). To analyze the rel- size standard (Applied Biosystems) for T-RFLP reactions. ative influence of different parameters over bacterial com- The labeled terminal-restriction fragments (TRFs) were munities, two-way ANOSIM (Clarke, 1993) was used. The detected on an ABI 3730XL automatic DNA sequencing global R statistic value (generated using one-way or two- machine (Applied Biosystems) in the GeneScan mode. way ANOSIM) indicates the degree of separation between For data collection from the DNA sequencing machine, the two communities, with values close to unity indicating GeneMapper software (Applied Biosystems) was used to moreseparationandazerovalueindicatingnodifferencebe- comparerelativelengthsofTRFswiththeinternalsizestan- tweenthegroups. dard.Forprofilecomparison,minimalandmaximalcut-offs To analyze influences of geochemical traits on the bacte- of 50 and 600bp, respectively, were set and fragments with rial community structure, CCA (Canonical Correspondence peakheightbelow75wereremovedasfilternoise. Analysis) was performed using Canoco (version 4.5 for Windows, PRI Wageningen, the Netherlands) (Lepš and 2.3 Chemicalanalysis Šmilauer, 2003). Presence/absence of TRFs was used as “species”data.Geochemicaldata(anions,cations,DOCand Five grams of peat were mixed with 40mL of analytical inorganic carbon) were included in the analysis as “envi- gradewater.Themixturewasshakenat200rpmovernightto ronmental” variables. Ordination biplots approximating the obtain a bioavailable extract for microorganisms from peat weighteddifferencesbetweentheindividualcommunities(T- (Reynolds and Clarke, 2008). These extracts were used for RFLPpatterns)withrespecttoeachofthegeochemicalfac- analysis of total dissolved organic carbon (DOC) and inor- tors(representedasarrows)weredrawn.Therelativeimpor- ganic carbon using a total organic carbon analyzer (TOC-V tance of geochemical factors in explaining variation in the CPH E200V 220V, Shimadzu). Aliquots from the same re- bacterialT-RFLPprofileswasexplainedbythelengthofthe mainingextractswerealsoanalyzedforanionssuchasfluo- corresponding arrows, and the angle between arrows indi- ride, chloride, nitrite, nitrate, phosphate, sulfate and cations cated the degree to which they were correlated. The impact such as sodium, ammonium, potassium, magnesium, and ofgeochemicalvariablesoverbacterialcommunitystructure www.biogeosciences.net/11/1727/2014/ Biogeosciences,11,1727–1741,2014 1732 S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands was calculated using a Monte Carlo permutation test based 3 Results on1000randompermutations(Rascheetal.,2011). To predict the phylogeny of the bacterial species at the 3.1 Influencesofpeatcharacteristicsonbacterial taxa level from the TRFs of 16S rDNA, Fragment Sorter communitystructure Suite(FRAGSORT)(ver.5.0;AgriculturalResearchandDe- velopment Center, Ohio State University) and Phylogenetic 3.1.1 Oxygenavailabilityandwatertable AssignmentTool(PAT)(Kentetal.2003)wereused,adopt- ingthemethodologydescribedinLefebvreetal.(2010).Mi- Oxygen availability was lower in the BWT samples com- crobialCommunityAnalysis(MiCA)–avirtualdigestpro- paredtoAWTsamplesbyafactorofthreeormore(Fig.2a). gram(Shyuetal.,2007)–wasusedtoconstructareference The BWT oxygen levels were similar across all land-use databaseforeachsetofprimers. types.Basedonthis,henceforth,weusetheterms“oxic”and “anoxic” conditions to refer to oxygen availability in AWT 2.5 Clonelibrarysequencingof16SrDNAgene and BWT zones, respectively. Effects of oxygen levels on bacterialDNAprofileswereanalyzed(Fig.2b).Intheordi- In order to validate the presence of predicted species eval- nation plot, samples from the low-water-table sites (across uated from FRAGSORT analysis, a clone library using all oil palm plantations) tended to cluster together, regard- 16S rDNA from two randomly chosen sites that differed in less of oxicand anoxic zones. The remaining samples clus- water table, land-use pattern and oxic conditions was pre- tered roughly into oxic and anoxic zones, although samples pared.Thesiteschosenbelongtosettlementswithhighwater from degraded land from anoxic zones were mixed within tableandoilpalmplantationswithlowwatertable.Thesam- oxic zones. BWT points found within AWT group are of ples were taken from both oxic and anoxic zones of settle- two types. One of these BWT groups is in a cluster that is mentsandonlyfromoxiczonesofoilpalmplantationsites. highly influenced by low water table (as shown in Fig. 2b). ThecleanedPCRproduct(usingsamenon-labeledprimer This explains why this subgroup has both AWT and BWT sequences as described earlier) of 16S rDNA from set- pointsallcomingfromlow-water-tablesites.Oftheremain- tlements and oil palm plantation sites was cloned into ing8BWTpointswithintheAWTgroup,3belongingtooil 3956bppCR® 4-TOPO® vector using TOPO TA Cloning palmplantationsitesarerightattheperipheryoftheBWT- kit for sequencing (Invitrogen, USA) according to the man- specificgroup.Anotheronesample(markedbyarrow)isan ufacturer’s protocol. One Shot® TOP 10 Competent Cells outlierwhichwasduetoflooding.Thisleaves4BWTpoints (Invitrogen, USA) was used in order to transform the re- belongingtodegradedland,whichwebelievehavehighwa- combinant plasmid. DNA Sequencing was performed on a ter table fluctuations as the water table is not controlled by DNA sequencer (ABI 3130 Genetic Analyzer) using for- hydrologicalinterventions.Whileforestedareasarealsonot ward or reverse M13 primers, on plasmid DNA extracted managed,theyareunlikelytohavelargefluctuationsdueto usingWizard® PlusSVMiniPrepDNAPurificationSystem closedcanopy.Thus,thedegradedforestBWTpointfallsin (Promega,USA)fromindividualclones.DNAsequencedata theBWTspecificgroup.Anoxiczonessupportedmorecom- wereanalyzedasdescribedpreviously(Reubenetal.,2012). plex bacterial communities than oxic zones, although this Briefly, sequences were trimmed and edited using MEGA5 was not the case for samples from degraded land (Table 1). (Tamura et al., 2011). MAFTT (Katoh et al., 2009) was ThepHvaluesmeasuredfromallsitesdidnotshowanysig- used for aligning the sequences and identifying reverse ori- nificantcorrelationwithShannondiversityindicesfromdif- entation. Sequences were then reverse-complemented using ferentland-usetypesatbothoxicandanoxiczones. MEGA5. Vector contamination was checked using the vec- Continuous monitoring of the water table and rainfall re- tor screening tool in Sequin (http://www.ncbi.nlm.nih.gov/ vealed that variation in water table over the period (August Sequin/sequin.hlp.html),andachimeracheckwasperformed 2009–August2010)wasinfluencedbyrainfallinthatperiod, usingBellerophon(Katohetal.,2009)followedbyMallard withmaximalrainfallinFebruary2010of370±25mm,av- 1.2. (Ashelford et al., 2006). Sequences of 302 clones were eragedoverallsites(Fig.3a).Samplingwasperformeddur- submittedtoGenBank,andthenucleotidesequencedatare- ing the time when water table was highest in the entire pe- portedinthispaperarepublishedintheGenBanknucleotide riod under study. Variation in the water table pattern was databaseunderaccessionnumbersJF739556–JF739857. similarforallsites(DHFN,DHPO,DHAN,DHTO,SHXN, MHXN, DHPN and MHPN) except for five oil palm plan- tation sites (MLPO) that had low water table (>50cm). The water table in sites with high water table depths fluc- tuatedfrom−0.1to−0.7mintheperiodunderstudy.How- ever,thesefluctuationsrangedfrom−0.75to−1.6minthe sites with low water table depths in the same period, hence exposing the low-water-table sites to different durations of oxicandanoxicregimescomparedtohigh-water-tablesites. Biogeosciences,11,1727–1741,2014 www.biogeosciences.net/11/1727/2014/ S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands 1733 Fig. 2 a) n=20 b) Above water table (AWT)- dominated group (oxic zones) n=20 Above water table (oxic zones) *** Below water table (BWT) group Low water table 200 *** Below water table (anoxic zones) (anoxic zones) subgroup 160 Hg) n=20 n=20 m n=20 * m *** ( 120 ** O2 p 80 Similarity 20 40 2D Stress: 0.19 40 High oxygen availability (oxic zones) Low oxygen availability (anoxic zones) AWT- Degraded forest BWT- Degraded forest AWT- Degraded land BWT- Degraded land 0 AWT- Oil palm plantation BWT- Oil palm plantation Degraded Degraded Oil palm Settlements Mixed crop AWT- Settlement BWT- Settlement forest land plantations plantations AWT- Mixed crop plantation BWT- Mixed crop plantation Fig.2.Oxygenlevels(pO2),mmHg(a)andnonmetricmultidimensionalscaling(nMDS)ordinationplotbasedonBray–Curtissimilarities calculated from presence/absence data of 16S rDNA TRFs abundances (b) at above (oxic zones) and below (anoxic zones) water table positionsindifferentland-usetypes.Levelofsignificancein(a)is∗ p<0.05,∗∗ p<0.01,and∗∗∗ p<0.001,andn=totalnumberof independentmeasurements. Table 1. Shannon diversity indices for different land-use patterns table differences for both oxic and anoxic zones were sig- basedon16SrDNAandmetabolicdiversity. nificant across land use, peat thickness and age of drainage (Table2:two-wayANOSIMvalues). Above Below water water 3.1.2 Land-usepattern,ageofdrainageandpeat Land-use table table Metabolic thickness patterns (oxic (anoxic diversity zones) zones) Unlike the oxic zone, where water table was the predomi- nantfactorinfluencingbacterialcommunitystructure,inthe Degradedforest 3.14 3.53 4.07 anoxic zone, land-use pattern had equally as strong an in- Degradedland 3.44 3.27 4.28 Settlements 3.19 3.38 4.24 fluenceaswatertableonbacterialcommunitystructure(Ta- Oilpalmplantations 2.62 2.68 4.33 ble2).Insuchanoxiczones,thebacterialdiversitydecreased Mixedcropplantations 3.48 3.62 4.47 in different land-use types in the following order: mixed cropplantations>degradedforest>settlements>degraded Averagediversityindicesfordifferentland-usepatternsbasedon16SrDNA werewithin±0.17and±0.08intheoxicandanoxiczones,respectively. land>oil palm plantations (Table 1). In both oxic and anoxiczones,highestdiversityofbacterialcommunitieswas foundinmixedcropplantations,whereasleastdiversitywas Between-sitecomparisonsofbacterialcommunitycomposi- presentinoilpalmplantations. tionshowedstatisticallysignificantclusteringbasedonwater Ageofdrainageandpeatthicknesshadaweakeryetsta- tablelevelinoxiczones(Fig.3b;Table2:one-wayANOSIM tistically significant effect as compared to water table and values) land-usepatternsinshapingthebacterialcommunityprofiles Water table depth greatly influenced bacterial diversity inbothoxicandanoxiczones(Table2:One-wayANOSIM in both oxic and anoxic zones, with the influence being values). In the ordination plot of the bacterial communities greater in the oxic zone. In order to determine the rela- basedonageofdrainage,twosub-groupsdominatedbylow- tiveinfluencesofdifferentpeatcharacteristics,weanalyzed water-tablesitesandmixedcropplantations,respectively,re- pair-wisecombinationsofpeatcharacteristicsusingtwo-way vealed that these two parameters had additional influences ANOSIManalysis.Itrevealedmajorinfluenceofwatertable (Supplement Fig. S1). Similar to age of drainage, in the or- and land-use pattern over other characteristics, namely, age dinationplotbasedonpeatthickness,therewasasub-group ofdrainageandpeatthickness(Table2:two-wayANOSIM oflow-water-tablesitesinoxiczones(Fig.3b). values).Thevariationsinbacterialcommunitiesduetowater www.biogeosciences.net/11/1727/2014/ Biogeosciences,11,1727–1741,2014 1734 S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands Table2.One-way(boldlettersindiagonalcells)andTwo-way(non-boldlettersinoff-diagonalcells)ANOSIMshowingvariationinbacterial communitystructureduetoanindividualparameteracrossotherparameterstestedinoxicandanoxiczones.Thetopvalueineachwhite cellreferstoinfluencebytheindividualparameteracrossothers(lefttoright),whereasthebottomvalueinthesamewhitecellshowsthe converse(righttoleft).Valuesinwhitecellscanbedirectlycomparedwithinsamewhitecellsorbetweenwhitecellsofoxicandanoxic zones.Asanexampleofwithin-whitecellcomparison:inoxiczones,theinfluenceofwatertablewasmuchhigheracrossdifferentland-use patterns(globalR:0.702),peatdepth(0.946)andageofdrainage(0.609)thanviceversa(0.189,0.344,NS:−0.009),respectively.However, inanoxiczones,land-usepatternhadhighinfluenceacrosswatertable(0.468),peatdepth(0.636)andageofdrainage(0.532),respectively. GlobalRstatistics Above-water-table(oxic)zones Below-water-table(anoxic)zones Water Land Peat Ageof Water Land Peat Ageof table use depth drainage table use depth drainage 0.702b 0.946b 0.609c 0.541a 0.878a 0.66b Watertable 0.527c Watertable 0.359b 0.189a 0.344a −0.009 0.468b 0.266a 0.247a 0.485b 0.361b 0.636c 0.532c Landuse 0.267a Landuse 0.413b 0.358 0.76b 0.268 0.101 0.433c 0.563b Peatdepth 0.214b Peatdepth 0.165a 0.574b 0.643b Ageofdrainage 0.389c Ageofdrainage 0.192a Levelofsignificanceisap<0.05,bp<0.01,cp≤0.001. Fig.3 a) b) Above water table (oxic) zones 0 450 Sampling time -0.2 400 -0.4 350 m) -0.6 300m Water table (m)-0-.18 220500onthly rainfall ( m -1.2 150otal 2D Stress: 0.15 T -1.4 100 Medium peat (3-7m) - Low water table Deep peat (>7m) - High water table -1.6 50 Medium peat (3-7m) - High water table Low water table High water table Total monthly rainfall (mm) Shallow peat (<3m) - High water table -1.8 0 Fig.3.(a)RainfallandwatertabledatafromAugust2009toAugust2010atallsamplinglocationsfromSiteAandSiteB.Thelocations areshowninFig.1.Watertablelevelswereaveragedacrosslocationswithinhighwatertable(0–45cm)andlowwatertable(>45cm), respectively.Theaveragedvaluesarerepresentedas“highwatertable”and“lowwatertable”,respectively.(b)Nonmetricmultidimensional scaling(nMDS)ordinationplot,basedonBray–Curtissimilaritiescalculatedfrompresence/absencedataof16SrDNATRFsabundances, showingvariationbetweenbacterialcommunityacrossdifferentwatertabledepthandpeatthickness,fromabove(oxiczones)watertable positions.Low-water-table(LWT),high-water-table(HWT)anddifferentpeatthicknesssamplesarerepresentedbyopensymbols,closed symbolsanddifferentshapes,respectively. 3.2 Distributionofbacterialtaxa datethetaxagroupidentified,aclonelibrarywascreatedthat revealeddifferencesinabundanceoftaxabasedonwaterta- ble,land-usepatternandoxygenavailability(Table3),which In order to identify the dominant members of the bacterial was consistent with our previous findings (Figs. 2 and 3b). communities,wepredictedthetaxausingtheTRFs.Tovali- Biogeosciences,11,1727–1741,2014 www.biogeosciences.net/11/1727/2014/ S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands 1735 Table3.Correspondenceofclonedataincomparisontopredictedspecies.“AWT”:above-water-tablesamples;“BWT”:below-water-table samples. MLPO-AWT(fromoxiczones) DHTO-AWT(fromoxiczones) DHTO-BWT(fromanoxiczones) (Mediumpeat-lowwatertable-oil (Deeppeat-highwatertable- (Deeppeat-highwatertable- palmplantations-drainage>10years) settlements-drainage>10years) settlements-drainage>10years) Species No.of No.of % No.of No.of % No.of No.of % distribution clones predicted coverage clones predicted coverage clones predicted coverage (taxonomiclevel) (102) taxaby (104) taxaby (96) taxaby FRAGSORT FRAGSORT FRAGSORT Environmental 71 313 22.7 60 278 21.6 74 281 26.3 unclassified Gammaproteobacteria 19 34 56.7 25 28 89.3 15 23 65.2 Alphaproteobacteria 5 45 11.2 10 41 24.4 3 41 7.3 Acidobacteria 5 5 100.0 73 3 100.0 2 2 100.0 Actinobacteria 0 53 0.0 1 49 2.0 0 22 0.0 Betaproteobacteria 2 44 4.5 2 37 5.4 2 41 4.9 Planctomycetes 0 12 0.0 1 9 11.1 0 14 0.0 Proteobacteria 0 4 0.0 2 3 66.7 0 1 0.0 Acidobacteria had 100% similarity with the predicted taxa mainly associated with DOC, ammonium and phosphates. asmentionedaboveforallthesitessampledforclonelibrary. Salinity had some influence on bacterial communities from The coverage between the predicted taxa and clones identi- sites with mixed crop plantations and settlements; the latter fied for Gammaproteobacteria ranged from 56.7 to 89.3% corroborated the identified salinity-associated species from between the sites sampled. The highest coverage between settlements. thepredictedtaxaandclonesidentifiedwasfoundinthesite Metabolic profiling of peat water from different land-use withsettlementsinoxiczones.Basedonsequencedatabase patterns was performed (Fig. 5) and was compared with searcheswiththeclonesequences,twospecieswereidenti- bacterial profiling (Fig. 2b) to directly evaluate the effects fiedbasedonidentitiestoknownentries.Outofwhich,Bre- of bioavailable organics that influence the bacterial com- vundimonassp.,reportedinitiallyfromsalinesoils(Wanget munities. Bacterial communities from anoxic zones were al.,2012),wasfoundabundantinsettlements. marginally separated based on land-use patterns (Fig. 2b). Oxygen availability had a strong influence on the abun- The communities were separated based on habitat, as re- dance of bacterial taxa in high and low water table depths vealed by significant separation of the flooded site (indi- (Supplement Fig. S2). In the oxic zones, the water table cated by arrow) from the non-flooded sites of mixed crop didnotaffecttaxaabundance,whereas,intheanoxiczones, plantations (Fig. 2b). When comparing the functional data all major taxa were more abundant in the low-water-table frommetabolicprofiling(Fig.5),distinctclustersofdifferent sites. Among the five most abundant taxa (α-, β- and γ- land-usetypeswereformed.Metabolicprofilingnotonlydif- Proteobacteria, Actinobacteria and Firmicutes Bacillales), ferentiatestheland-usepatternsbutalsoclearlydistinguishes Actinobacteria had the largest difference in abundance be- samplesbasedongeographicalsamplingposition.Forexam- tweenhighandlowwatertablesitesinbothoxicandanoxic ple,twositesfromdegradedlandinSiteBformedadistinct zones. clusterfromtheothertwositesfromdegradedlandinSiteA (DHAN in Fig. 1). Similarly, two oil palm plantation sam- 3.3 Relationshipofenvironmentalandgeochemical ples (extreme left of Fig. 5), though belonging to different parameterswithbacterialcommunitystructure peatthickness(MHPNandDHPNinFig.1),wereclustered verycloseastheywerefromthesametransect. Canonical correspondence analysis was used to identify the association of environmental and geochemical traits with bacterial communities from different land-use patterns 4 Discussion (Fig. 4a, b and Supplement Table S1). Bacterial communi- ties from the oil palm plantations were associated with ni- Bacterial and metabolic markers that represent the complex tratelevelsinbothoxic(Fig.4a)andanoxic(Fig.4b)zones. nature of bacterial communities and metabolic processes of Nitrate levels were lower in the anoxic zones compared to diverse biota, respectively, provided the resolving power to oxiczonesbyafactorof20–30,whichislikelytodrivedif- distinguish different habitats. This resolution ranged from ferences in their community structures. Bacterial communi- centimeter scale in depth measurements to kilometer scale, ties in the mixed crop plantations, on the other hand, were where sites were distributed within the 48km2 of the study www.biogeosciences.net/11/1727/2014/ Biogeosciences,11,1727–1741,2014 1736 S.Mishraetal.:Hydrologyandland-usechangeaffectsmicrobialecologyofpeatlands Fig. 4 0 0 .1A) .1 B) Nitrate Dissolved organic carbon (DOC) Phosphate Magnesium Calcium Dissolved inorganic carbon Potassium Sulfate Chloride Ammonium Chloride Sodium Magnesium Sodium Ammonium Sulfate Calcium Dissolved inorganic carbon Dissolved organic carbon (DOC) Nitrate Oxic zones Phosphate Anoxic zones Settlements Settlements Degraded land Degraded land Degraded forest Degraded forest 0 Oil palm plantations 0 Oil palm plantations .1 Mixed crop plantations .1 Mixed crop plantations --1.0 1.0 --1.0 1.0 Fig.4.Canonicalcorrespondenceanalysisof16SrDNAgenebasedT-RFLPdatasetsandenvironmentaldataindifferentland-usepatterns from oxic (a) and anoxic (b) zones. Geochemical data, represented with arrows, are nitrates, dissolved organic carbon (DOC), dissolved inorganiccarbon,chloride,magnesium,ammonium,sodium,calcium,sulfateandphosphate.Testofsignificance(pvalue)ofallcanonical axesis0.05and0.009inoxic(a)andanoxic(b)zones,respectively. Fig.5 forunderstandingvariationatlargescalesofspatialdistribu- 2D Stress: 0.05 tion. Both sets of molecular markers distinguished different land-usetypes,butwithdifferentlevelsofresolution.Com- paredwithmicrobialprofiles,thoseofmetabolitesweread- ditionallyabletodifferentiateland-usetypesfromlocations thatareseparatedbynearly8kmdistance.Ourfindingsabout bacterialprofilinghaveledustoidentifygeochemicalfactors that influence the state of degraded peatlands. In addition, Oil palm plantation sites with low water table depth metabolic profiling, which relies on markers derived from functions of diverse biotic communities and not just bacte- ria,provideafinerclassificationofpeatlandsites.Metabolic Settlement Degraded land Degraded forest Oil palm plantation Mixed crop plantation profiling can, therefore, be used in developing better prac- tices for mapping peatlands, which can be a tool for both Fig. 5. Nonmetric multidimensional scaling (nMDS) ordination managementandpolicydevelopment. plot, based on Euclidean distance calculated from intensity of While there have been reports of effects of land-use metabolitesextractedfrompeatwaterofdifferentland-usepatterns. Thearrowrepresentsthefloodedsitewithmixedcropplantations. change and hydrology on CO2, N2O and CH4 emissions (Jauhiainen et al., 2008, 2012a, b) and hydrology on sub- sidence (Hooijer et. al., 2010, 2012), our approach allows area.Thus,thesamesetofmolecularmarkersprovidedady- multiple parameters to be evaluated simultaneously using a namic range of resolution at four orders of magnitude. Mi- singlemolecularprofilingapproach.Ourfindingsshowthat crobial markers have been extensively used to study alter- microbialprofilesfrompeatlandsitesaremostinfluencedby ation in community structures due to changes in land-use variationsinwatertableandland-usepatterns.Thesetwoare patternsatlargescalesofspatialdistribution,suchasinPa- followedbyageofdrainageandpeatthicknessininfluencing cificNorthwestmarinesedimentcommunities(Brakeretal., thebacterialcommunitystructure.Acrossdegradedpeatland 2000), in high levels of nuclear-waste-contaminated vadose thatareunderhydrologicalmanagement,watertablefluctu- sediments at the Hanford Site in the US (Fredrickson et al., ates due to drainage, rainfall and other physical parameters 2004), in western Amazon soils (Jesus et al., 2009) and in (Jauhiainen et al., 2008; Hooijer et al., 2010). The ability Antarctic dry valley (Chan et al., 2013), among other bio- ofmicrobialmarkerstodistinguishthelow-andhigh-water- geographiclocations.Incomparison,therearerelativelyfew table sites shows their robustness to capture differences in studiesthathaveusedmetabolitesasfunction-basedmarkers communitystructuresdespitethedifferencesintherangeof Biogeosciences,11,1727–1741,2014 www.biogeosciences.net/11/1727/2014/
Description: