Weppelmannetal.MalariaJournal2013,12:30 http://www.malariajournal.com/content/12/1/30 RESEARCH Open Access High frequency of the erythroid silent Duffy Plasmodium vivax antigen genotype and lack of infections in Haiti Thomas A Weppelmann1,2, Tamar E Carter3,4,5, Zhongsheng Chen3, Michael E von Fricken1, Yves S Victor6, Alexander Existe7 and Bernard A Okech1,2* Abstract Background: Malaria is a significant publichealth concern inHaiti where approximately 30,000 cases are reported annually with CDC estimatesas highas 200,000. Malaria infections inHaiti are caused almost exclusively by Plasmodium falciparum,while a small numberof Plasmodium malariae and an even smaller numberof putative Plasmodium vivax infections have been reported.The lackof confirmed P. vivaxinfections in Haiti could be due to thegenetic background of native Haitians. Having descended from West African populations, many Haitians could be Duffy negative due to a single nucleotide polymorphismfrom thymine to cytosine intheGATA box of the promoter region of the Duffy antigen receptor for chemokines (DARC) gene. This mutation, encoded by theFYES allele, eliminates the expression ofthe Duffy antigen onerythrocytes,which reduces invasion by P. vivax.This study investigated thefrequency oftheFYES allele and P. vivax infections in malaria patients with the goal of uncovering factors for the lack of P. vivax infections reported in Haiti. Methods: DNA was extracted from dried blood spots collectedfrom malaria patientsat four clinic locations in Haiti. The samples were analysed by polymerase chain reaction (PCR) for the presence of theP. vivaxsmall subunit ribosomal RNA gene. PCR, sequencing, and restriction enzyme digestion were used to detect the presence of the FYESallele. Matched samples were examined for both presence of P. vivax and the FYES allele. Results: No cases of P. vivax were detected inany of thesamples (0/136). Of allsamples testedfor the FYES allele, 99.4% had the FYESallele (163/164). Ofthe matched samples, 99% had theFYES allele (98/99). Conclusions: In this preliminary study, nocases ofP. vivaxwere confirmed by PCRand 99% ofthemalaria patients testedcarried theFYES allele. The highfrequency oftheFYES allele thatsilences erythroid expression of theDuffy antigen offers a biologically plausible explanation for thelack of P. vivax infections observed. These results provide insights on the host susceptibility for P. vivax infections thathas never before been investigatedinHaiti. Keywords: Plasmodium vivax,Malaria, Hispaniola,Haiti, Duffy antigen receptor for chemokines(DARC), Duffy negative, Genetic susceptibility *Correspondence:[email protected] 1DepartmentofEnvironmentalandGlobalHealth,UniversityofFlorida,PO Box100188,Gainesville,FL32610,USA 2EmergingPathogensInstitute,UniversityofFlorida,2055MowryRd,P.O. Box100009,Gainesville,FL32610,USA Fulllistofauthorinformationisavailableattheendofthearticle ©2013Weppelmannetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsofthe CreativeCommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse, distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited. Weppelmannetal.MalariaJournal2013,12:30 Page2of5 http://www.malariajournal.com/content/12/1/30 Background (n=7), and Jacmel (n=6) (Figure 1). Samples from Malaria transmission in Haiti is a serious public health patients at the Blanchard clinic included symptomatic concern where approximately 30,000 cases are reported individualsaswellasthoseconfirmedbyrapidtestand/or eachyearwithCentersforDiseaseControlandPrevention microscopy to have P. falciparum or mixed infections (CDC)estimatesashighas200,000[1].Over99%ofmal- (P.falciparumandP.malariaeorP.vivax).Samplesfrom aria infections in Haiti are caused by Plasmodium falcip- patientsattheotherthreelocationswereconfirmedbymi- arum, withless than 1%ofcasesreported as Plasmodium croscopyalone.TheDBSweretransportedtotheEmerging malariae infections [2-4]. Thereareeven fewer reports of Pathogens Institute at the University of Florida and Plasmodium vivax in Haiti, all of which were only archived in dry storage before further genetic analyses detected by microscopy and none confirmed by polymer- asdescribedbelow. ase chain reaction (PCR) based methodologies [2,5,6]. SinceP.vivaxisresponsiblefor74%ofallcasesofmalaria DNAextraction in Central and South America and up to 94% of cases in A methanol extraction procedure was used to extract Mexico and Central America, the lack of P. vivax infec- the DNA from the DBS [22]. Three millimetre discs were tions in Haiti merits further investigation [1,5,7]. Besides punched from the DBS, placed inside a PCR tube, and geographical isolation, host genetic factors could be an- 100 μl of absolute methanol was added. The samples other reason for the lack of P. vivax infections in Haiti. A were incubated at 25 degrees Celsius (°C) for 15 minutes, majority of Haitians are descendants of West African the methanol was removed, and the samples were populations,whohaveahighfrequencyofindividualsthat allowed to dry overnight. Once dry, 65 μl of nuclease donot expresstheDuffyantigen receptorfor chemokines free water was added and heated to 95°C for 30 minutes. (DARC) on their erythrocytes [8,9]. The absence of the The samples were centrifuged and then stored at 4°C for Duffy antigen on erythrocytes has been shown to reduce immediateuseorstoredat–20°Cforfutureuse. orcompletelypreventP.vivaxinfections[10-14]. The Duffy antigen is a trans-membrane glycoprotein DetectionofP.vivaxbypolymerasechainreaction locatedonredbloodcellsthatcontainsaN-terminaldomain A species-specific PCR protocol was used to detect the usedbyP.vivaxmerozoitestoinvadeandinfecterythrocytes presence of P. vivax in the samples. PCR primers were [15,16].Therearetwoco-dominantallelesFYAandFYBthat targeted to detect the P. vivax small subunit ribosomal differbyasinglenucleotideataminoacidcodon42,wherea RNA gene and were able to detect low levels of parasites changefromglycinetoasparticacidresultsintheexpression [23]. The forward primer and reverse primer sequences oftheFya or Fybantigen,respectively[17]. Inmany African used were 50 GCAACGCTTCTAGCTTAATC 30 and 0 0 and African-descendent populations the expression of the 5ACAAGGACTTCCAAGCCGAAGC 3, respectively. Duffy antigen is silenced as a result of a single nucleotide The PCR temperature protocol was as follows: 94°C for polymorphism (SNP) in the GATA box sequence in the 5 minutes; 94°C for 30 seconds, 58°C for 30 seconds, DARC gene promoter region in which a cytosine (C) and 72°C for 60 seconds for 40 cycles; and 72°C for replacesthymine(T)46nucleotidesbeforetheerythroidcap 10 minutes. The expected size of the amplicon was 131 site[18-20].Thiserythroid silent(ES)genotype,encodedby base pairs (bps). All PCR runs included a P. vivax posi- the FYES allele, is responsible for the Duffy negative pheno- tive control obtained from the malaria reagents and typeexpressed by homozygotes that can reach a population resourcescenter (MR4). frequencyof100%innativeWestAfricans[9,21]. Neither the reason why P. vivax has been so rarely PCRandsequencingoftheDARCGene observed in Haitians, nor the prevalence of the erythroid A PCR protocol was used to amplify a segment of the silent Duffy antigen genotype has been investigated in DARC gene that was 329 bps and included the –46 T/C detail. Therefore, this studyinvestigated the frequency of SNP [14]. The forward primer and reverse primer se- the FYES allele and P. vivax infections in malaria quences used were 50CAGGAAGACCCAAGGCCAG 30 0 0 patients. The information obtained from this study will and5CCATGGCACCGTTTGGTTCAGG3 respectively. helpclarifythe statusofP.vivaxinfectionsinHaiti. The PCR temperature protocol was as follows: 94°C for 5min;94°Cfor20seconds,62°Cfor15seconds,and72°C Methods for20secondsfor35cycles;and72°Cfor10minutes. Datacollection Tenofthesamplesfromthemalariapatientsalongwith Dried blood samples (DBS) were collected by finger prick a blood sample from one of the authors of European an- and blotted on filter paper (FTA cards, Whatman©) in cestry were sequenced for the GATA box mutation with Haiti from May 2010 to August 2012. The samples origi- the forward and reverse primers described above to iden- nated from several clinics including the Blanchard clinic tify –46 T and –46C controls for use in the restriction in Port-au-Prince (n=164), Hinche (n=7), Cap-Haitien enzyme digestion of patient samples. DNA was sequenced Weppelmannetal.MalariaJournal2013,12:30 Page3of5 http://www.malariajournal.com/content/12/1/30 Figure1MapofHaitiwithclinicaloriginofdriedbloodspots. bytheInterdisciplinaryCenterforBiotechnologyResearch (Table 1). No cases of P. vivax were detected by PCR in at the University of Florida using Sanger sequencing. Se- 136 patient samples tested from the Blanchard clinic. Of quence analysis was accomplished by the examination of thesamplestestedfortheFYESallelefromthesameclinic, the chromatograms with 4Peaks (Mekentosj, Amsterdam, 99.4%(163/164)hadtheFYESallele.Ofthematchedsam- NL)softwarefollowedbyalignmentsusingClustalX2[24]. ples (n =99) tested for both the presence of P. vivax and theFYESallele,noP.vivaxinfectionswerefoundand99% RestrictionfragmentlengthpolymorphismofDARC (98/99) had the FYES allele. The remaining samples from Restriction fragment length polymorphism (RFLP) ana- theother siteswerenottested(NT) forP.vivax,however lysis was used to confirm the presence or absence of the 100%(20/20)werepositivefortheFYESallele. −46 T/C SNP [14]. The PCR products were digested over- night with therestrictionendonuclease StyI(New England Discussion Biolabs,Ipswich,MA)accordingtothemanufacturer’sspe- This preliminary study is the first in Haiti to focus on cifications.Afterheatinactivationoftheenzymefor10min- the prevalence of the FYES allele and P. vivax infections utes at 65°C, the fragments were stained with ethidium in malaria patients. No P. vivax infections were found bromide and resolved by gel electrophoresis on a 4% agar- and 99% of the malaria patients had the FYES allele. The osegelfor2.5hoursat140volts. frequency of the FYES allele observed in this study could explain the different rates of P. vivax Haiti as compared Results to Central and South America, where the majority of TheresultsfromtheGATAboxmutationanalysisandthe infectionsareP.vivaxandthepopulationfrequencyofthe detection of P. vivax from the DBS are shown below FYES allele is rare [17,25]. The results from this study are Weppelmannetal.MalariaJournal2013,12:30 Page4of5 http://www.malariajournal.com/content/12/1/30 Table1PrevalenceofGATAboxmutationsandP.vivaxInfections Siteofsample (FYES)allelepresence P.vivaxpresence Collection No.tested No.positive %Positive No.tested No.positive BlanchardClinic 164 163 99.4 136 0 Hinche 7 7 100 0 NT* Cap-Haitien 7 7 100 0 NT* Jacmel 6 6 100 0 NT* Total 184 99.5% 99.5% 136 0 *NTrepresentssamplesnottestedforthepresenceofP.vivax. similar to other studies conducted in West African popu- representative of the ancestry of native Haitians. However, lations,whohavebetween95-100%prevalenceoftheFYES historical reports have indicated P. vivax transmission in allele and almost complete absence of P. vivax infections. communes inhabited byhigher proportions of peoplewho InarelatedstudyinGambia(n=1,176)wherethepopula- are of African/European descent that have lower popula- tion had complete penetrance of the Duffy negative tion frequencies of the Duffy negative phenotype [26]. phenotype, of the samples positive for the presence of Since P. vivax infections have received little attention, it is malaria parasites, 94.8% contained P. falciparum, 3.7% unknown if such transmission is still occurring in those contained P. malariae,1.5%containedPlasmodiumovale, areasofHaiti.ItislikelythatlowratesoftravelerstoHaiti and 0% contained P. vivax [21]. In another study from fromthesurroundingP.vivaxendemiccountriesinSouth nine countries in West and Central Africa (n=2,588) AmericamayhaveslowedanypotentialintroductionsofP. where the Duffy negative genotype is estimated to be vivax infections into Haiti. Even if introductions were to above 95%, PCR analysis of blood samples indicated that occur, it would not be likely that P. vivax transmission ofsamplespositiveformalariaparasites,onlyasinglecase couldbesustainedbecauseofthehighratesoftheFYESal- of P. vivax was found while 98.5% contained P. falcip- leleinthepopulation.Amoreextensivestudywithalarger arum, 8.5% contained P. malariae, and 3.9% contained P. samplesizefrommultiplesitesinHaitiisdesirabletocon- ovale[9]. firmtheseresults. The high frequency of the FYES allele found in this study In conclusion, no P. vivax infections were confirmed couldbeattributedtotheWestAfricanancestryofHaitians. by PCR and the FYES allele that results in silenced ex- Historical records dating back to the 1780s indicate that a pression of the Duffy antigen on erythrocytes was found large proportion of West Africans brought to the New in 99% of the patients. The high frequency of FYES allele Worldduringthetrans-AtlanticslavetradearrivedinHaiti could explain the sparse historical evidence of P. vivax [8]. It is estimated that over 75% of the total number of infections in native Haitians and is attributable to their enslavedAfricansinHaiticamefromWestandWestCen- West African ancestry. Though P. vivax malaria is not tral Africa, which have almost exclusively the FYES/FYES prevalent and does not represent a significant public genotype [8,9]. This studyfound only a singlepatientwith- health risk in native Haitians, the risk of infection for outtheFYESallelethatmaybeduetothesmallproportion travellers and foreign aid workers who are Duffy positive ofHaitianshavingFrenchand/orSpanishancestryorafor- remains uncertain. eignaidworker,whohavemuchlowerpopulationfrequen- cies of the FYES allele [18]. Though the French and the Competinginterests Spanish originally colonized Haiti, in 1804 the French Theauthorsdeclarethattheyhavenocompetinginterests. departedandtheremainingSpanishsequesteredthemselves eastward to the Dominican Republic. This massive gene Authors’contributions flow from West Africa followed by the establishment of TAWcarriedoutthegenetictestingfortheFYESalleleanddraftingthe Haiti as an independent country could have contributed to manuscript.TChelpedconductthegenetictestingfortheP.vivaxand highpopulationfrequencyofDuffynegativeindividuals[8]. revisionofthemanuscript.ZChelpedconductthegenetictestingforP. vivax.MEVwasinvolvedindraftingofthemanuscript.VSF,AEaidedinthe Althoughthesamplesizewasrelativelysmall,noP.vivax samplecollection.BAOconceived,designedandcoordinatedthestudy,and DNA was found in any of the patient samples, which is helpeddraftthemanuscript.Allauthorsreadandapprovedthefinal consistent with previous reports of the lack of P. vivax in manuscript. Haiti [2-4]. It is likely that the highprevalence of the FYES allelethatcauses the Duffynegativephenotypemay bere- Acknowledgements sponsibleforthelackofP.vivaxtransmissioninHaiti.The ThisstudywasfundedbytheDepartmentofDefense-GlobalEmerging InfectionsSurveillancegrantnumber#C0607_12_UNtoBAO.Theauthors samples in this study were obtained from areas that are wouldliketothankMeganC.Warnerforhercontributionsthatensuredthe predominantly of West African ancestry, which are more successofthiswork. Weppelmannetal.MalariaJournal2013,12:30 Page5of5 http://www.malariajournal.com/content/12/1/30 Authordetails 16. MichonP,StevensJR,KanekoO,AdamsJH:Evolutionaryrelationshipsof 1DepartmentofEnvironmentalandGlobalHealth,UniversityofFlorida,PO conservedcysteine-richmotifsinadhesivemoleculesofmalaria Box100188,Gainesville,FL32610,USA.2EmergingPathogensInstitute, parasites.MolBiolEvol2002,19:1128–1142. UniversityofFlorida,2055MowryRd,P.O.Box100009,Gainesville,FL32610, 17. KingCL,AdamsJH,XianliJ,GrimbergBT,McHenryAM,GreenbergLJ, USA.3GeneticsInstitute,UniversityofFlorida,2033MowryRd,POBox SiddiquiA,HowesRE,daSilva-NunesM,FerreiraMU,ZimmermanPA: 103610,Gainesville,FL32610,USA.4DepartmentofAnthropology,University Fya/FybantigenpolymorphisminhumanerythrocyteDuffyantigen ofFlorida,1112TurlingtonHall,POBox117305,Gainesville,FL32611,USA. affectssusceptibilitytoPlasmodiumvivaxmalaria.ProcNatlAcadSciUSA 5DepartmentofEpidemiology,CollegeofPublicHealthandHealth 2011,108:20113–20118. Professions,UniversityofFlorida,POBox100231,Gainesville,FL32611,USA. 18. TournamilleC,ColinY,CartronJP,LeVanKimC:DisruptionofaGATA 6BlanchardClinic,FamilyHealthMinistriesHaiti,TerreNoire,PortauPrince, motifintheDuffygenepromoterabolisheserythroidgeneexpression Haiti.7NationalPublicHealthLaboratory,MinistryofPublicHealthand inDuffy-negatieindividuals.NatGenet1995,10:224–228. Population(MSPP),Delmas33,PortauPrince,Haiti. 19. CavasiniCE,deMattosLC,D’AlmediaCoutoAAR,D’AlmediaCoutoVSC, GollinoY,MorettiLJ,Bonini-DomingosCR,RossitARB,CastilhoL,Machado Received:14November2012Accepted:9January2013 RLD:Duffybloodgroupgenepolymorphismsamongmalariavivax Published:24January2013 patientsinfourareasoftheBrazilianAmazonregion.MalarJ2007,6:167. 20. CastilhoL,RiosM,PellegrinoJ,SaadSTO,CostaFF,ReidME:AnovelFY alleleinBrazilians.VoxSang2004,87:190–195. References 21. WelchSG,McGregorIA,WilliamsK:Theduffybloodgroupandmalaria 1. RobertsL:EliminationmeetsrealityinHispaniola.Science2010, prevalenceingambianwestAfricans.TransRSocTropMedHyg1977, 328:850–851. 71:295–296. 2. LindoJF,BryceJH,DucasseMB,HowittC,BarretDM,MoralesJL,OrdR, 22. BereczkyS,MartenssonA,GilJP,FarnertA:Shortreport:rapidDNA BurkeM,ChiodiniPL,SutherlandCJ:PlasmodiummalariaeinHaitian extractionfromarchivebloodspotsonfilterpaperforgenotypingof refugees.Jamaica.EmergInfectDis2007,13:931–933. Plasmodiumfalciparum.AmJTropMedHyg2005,72:249–251. 3. AgarwalA,McMorrowM,ArguinPM:Theincreaseofimportedmalaria 23. HangVT:Screeningdonorbloodformalariabypolymerasechain acquiredinHaitiamongUStravelersin2010.AmJTropMedHyg2012, reaction.TransRSocTropMedHyg1995,59:124–128. 86:9–10. 24. ThompsonJD,GibsonTJ,PlewniakF,JeanmouginF,HigginsDG:The CLUSTALXwindowsinterface:flexiblestrategiesformultiplesequence 4. PAHO:Rollbackmalariainmesoamerica:reportonthemeetingheldinthe alignmentaidedbyqualityanalysistools.NucleicAcidsRes1997, dominicanrepublicwiththeparticipationofthecentralamericancountries, 25:4876–4882. Haiti,andthedominicanrepublic.Mexico:PanAmericanHealth 25. GuerraCA,SnowRW,HaySI:Mappingtheglobalextentofmalariain Organization;2000. 5. PAHO:RegionalstrategicplanformalariaintheAmericas2006–2010.USA: 2005.TrendsParasitol2006,22:353–358. PanAmericanHealthOrganization;2010:1–85. 26. MasonJ:DevelopmentoftheHaitimalariaeradicationprogramme,World HealthOrganizationtechnicaldocument.WHO/Mal/68.665;1968. 6. PAHO:XVIIIPanamericansanitaryconferenceXXIIregionalcommittee meeting.Washington,DC:WorldHealthOrganization;1970. 7. MuellerI,GalinskiMR,BairdJK,CarltonJM,KocharDK,AlonsoPL,delPortillo doi:10.1186/1475-2875-12-30 HA:KeygapsintheknowledgeofPlasmodiumvivax,aneglectedhuman Citethisarticleas:Weppelmannetal.:Highfrequencyoftheerythroid malariaparasite.LancetInfectDis2009,9:555–566. silentDuffyantigengenotypeandlackofPlasmodiumvivaxinfections inHaiti.MalariaJournal201312:30. 8. FalolaT,RobertsK,ChildsM:Theyorubadiasporaintheatlanticworld. Bloomington,IN:IndianaUniversityPress;2004. 9. CulletonRL,MitaT,NdoungaM,UngerH,CravoPV,PaganottiGM, TakahashiN,KanekoA,EtoH,TintoH,KaremaC,D’AlessandroU,doRosario V,KobayakawaT,NtoumiF,CarterR,TanabeK:Failuretodetect plasmodiumvivaxinwestandcentralafricabyPCRspeciestyping.Malar J2008,7:174. 10. ZimmermanPA,WoolleyI,MasindeGL,MillerSM,McNamaraDT,HazlettF, MgoneCS,AlpersMP,GentonB,BoatinBA,KazuraJW:Emergenceof FY*AnullinaPlasmodiumvivax-endemicregionofPapuaNewGuinea. ProcNatlAcadSciUSA1999,96:13973–13977. 11. ChaudhuriA,PolyakovaJ,ZbrzeznaV,PogoAO:Thecodingsequenceof Duffybloodgroupgeneinhumansandsimians:restrictionfragment lengthpolymorphism,antibodyandmalariaparasitespecificities,and expressioninnonerythroidtissuesinDuffy-negativeindividuals.Blood 1995,85:615–621. 12. ChaudhuriA,PolyakovaJ,ZbrzeznaV,WilliamsK,GulatiS,PogoAO: CloningofglycoproteinDcDNA,whichencodesthemajorsubunitof theDuffybloodgroupsystemandthereceptorforthePlasmodium vivaxmalariaparasite.ProcNatlAcadSciUSA1993,90:10793–10797. 13. GrimbergBT,UdomsangpetchR,XainliJ,McHenryA,PanichakulT, Submit your next manuscript to BioMed Central SattabongkotJ,CuiL,BockarieM,ChitnisC,AdamsJ,ZimmermanPA,King and take full advantage of: CL:Plasmodiumvivaxinvasionofhumanerythrocytesinhibitedby antibodiesdirectedagainsttheDuffybindingprotein.PLoSMed2007, • Convenient online submission 4:e337. 14. KasehagenLJ,MuellerI,KiniboroB,BockarieMJ,ReederJC,KazuraJW, • Thorough peer review KastensW,McNamaraDT,KingCH,WhalenCC,ZimmermanPA:Reduced • No space constraints or color figure charges PlasmodiumvivaxerythrocyteinfectioninPNGDuffy-negative • Immediate publication on acceptance heterozygotes.PLoSOne2007,2:e336. 15. VanBuskirkKM,SevovaE,AdamsJH:Conservedresiduesinthe • Inclusion in PubMed, CAS, Scopus and Google Scholar PlasmodiumvivaxDuffy-bindingproteinliganddomainarecriticalfor • Research which is freely available for redistribution erythrocytereceptorrecognition.ProcNatlAcadSciUSA2004, 101:15754–15759. Submit your manuscript at www.biomedcentral.com/submit