Helicobacter pylori DprA alleviates restriction barrier for incoming DNA.

5 MB·English

by  Dwivedi, Gajendradhar R.

3274–3288 Nucleic Acids Research, 2013, Vol. 41, No. 5 Published online 25 January 2013
doi:10.1093/nar/gkt024
Helicobacter pylori DprA alleviates restriction barrier
for incoming DNA
Gajendradhar R. Dwivedi, Eshita Sharma and Desirazu N. Rao*
Department of Biochemistry, Indian Institute of Science, Bangalore 560012, India
Received September 18, 2012; Revised December 21, 2012; Accepted January 1, 2013
ABSTRACT microbiota of the human stomach (3). Helicobacter
pylori has a remarkably high level of genetic variation
Helicobacter pylori is a Gram-negative bacterium
that reflects its ability to adapt gastric habitats (4,5).
that colonizes human stomach and causes gastric
This high genetic diversity is believed to contribute
inflammation. The species is naturally competent towards the success of H. pylori in colonizing the human
and displays remarkable diversity. The presence of gastric mucosa where many different microenvironment
a large number of restriction–modification (R–M) changing conditions are likely to be encountered (6,7).
systems in this bacterium creates a barrier against The transformation system of H. pylori is fundamen-
natural transformation by foreign DNA. Yet, mech- tally different from other competent Gram-negative
anisms that protect incoming double-stranded bacteria. The structural core of H. pylori translocation
system is related to the bacterial Type IV secretion
DNA (dsDNA) from restriction enzymes are not
systems, rather than like a pili (8,9). Natural transform-
well understood. A DNA-binding protein, DNA
ation in H. pyloriinvolvesa two-step DNAuptakemech-
Processing Protein A (DprA) has been shown to
anism (10). The first step involves uptake of
facilitate natural transformation of several
double-stranded DNA (dsDNA) from the outer environ-
Gram-positive and Gram-negative bacteria by pro-
ment to the periplasm. The second step involves conver-
tecting incoming single-stranded DNA (ssDNA) and sion of dsDNA to single-stranded DNA (ssDNA) and
promoting RecA loading on it. However, in this then transport from periplasm to cytoplasm through the
study, we report that H. pylori DprA (HpDprA) innermembrane.Thesetwostepsaretemporallyandspa-
binds not only ssDNA but also dsDNA thereby tially segregated in H. pylori (10).
conferring protection to both from various exo- Lateraltransferofgeneticinformationbetweenbacteria
nucleases and Type II restriction enzymes. Here, of different species, and even between different strains of
the same species, is often limited by one or more restric-
we observed a stimulatory role of HpDprA in DNA
tion modification (R–M) systems (11,12). Although
methylation through physical interaction with
inter-strain transformation is limited by R–M systems,
methyltransferases. Thus, HpDprA displayed dual
similar methylation patterns enable intra-strain trans-
functional interaction with H. pylori R–M systems
formation. Incorporation of DNA fragments of small
by not only inhibiting the restriction enzymes but
size (on average 1300bp) through recombination in
also stimulating methyltransferases. These results H. pylori again indicates the role of R–M barrier during
indicate that HpDprA could be one of the factors horizontal gene transfer (13). A Type III-like restriction
that modulate the R–M barrier during inter-strain endonuclease has been shown to be a major barrier to
natural transformation in H. pylori. horizontal genetic transfer in clinical Staphylococcus
aureus strains (11). Similarly, a Type I R–M system in
S. aureus has been described as a barrier for all the three
INTRODUCTION
majormechanismsoflateralgenetictransfer,i.e.conjuga-
HelicobacterpyloriisaGram-negativebacteriumthatcol- tion, transformation (via electroporation) and transduc-
onizes the human gut and infects more than half of the tion (14). In H. pylori, Type II R–M systems act as the
world’s human population (1). It is a bacterial pathogen mainbarrieragainstnaturaltransformation(15,16).A30-
responsible for gastrointestinal diseases such as atrophic fold higher transformation frequency was observed for
gastritis, gastric adenocarcinoma, peptic ulcers and DNA from other strains when four Type II restriction
mucosa-associated lymphomas (2). Helicobacter pylori is enzymes were deleted in H. pylori strain 26695 (17).
the most abundant phylotype present in the bacterial The inter-strain transformation frequency is reduced but
*To whom correspondence should be addressed. Tel:[phone]; Fax:[phone]; Email: [email protected]
Present address:
Eshita Sharma, Department of Molecular biology, Max Planck Institute for Developmental Biology, Tuebingen, Germany.
(cid:2)TheAuthor(s)2013.PublishedbyOxfordUniversityPress.
ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommonsAttributionNon-CommercialLicense(http://creativecommons.org/licenses/
by-nc/3.0/),whichpermitsunrestrictednon-commercialuse,distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited.
NucleicAcidsResearch,2013,Vol.41,No.5 3275
not completely blocked by R–M systems indicating its strain DH5a [F0-end A1 hsd R17 (r (cid:2) m (cid:2)) glnV44 thi1
k k
regulation during horizontal gene transfer (16). recA1gyrA(NalR)relA1(cid:2)(lacIZYA–argF)U169deoR
A number of studies have shown the role of a DNA- {(cid:3)80dlac (cid:2) (lacZ)M15}] was used as a host
binding protein ‘DNA processing protein A (DprA)’ in for preparation of plasmid DNA. Escherichia coli strain
high-frequency uptake and translocation of exogenous ER2566[F-fhuA2ompTlacZ::T7gene1gal1sulA11(mcrC-
DNA (18,19). DprA is a conserved bacterial protein mrr)114::IS10 (R9mcr-73::mini-Tn10-Tets)2 R(zgb-
which was first identified in Haemophilus influenzae (20). 210::Tn10) (Tet) endA(cid:2)] (obtained as a kind gift from
s
Knockout of dprA in H. pylori results in reduced trans- New England Biolabs) was used for expression and
formation efficiency for both chromosomal and plasmid purification of HpDprA.
DNA (19). However, dprA knockout in H. influenzae
resulted in a reduction of transformation efficiency with
Reagents
chromosomalDNA,butnotwithplasmidDNA(20).This
indicates a different mechanistic role for DprA in the Restriction endonucleases and T4 polynucleotide kinase
natural transformation pathways of different organisms. were obtained from New England Biolabs. T4 DNA
DprA expression was shown to be dependent on ComK ligase and 1kb DNA ladder were obtained from
protein as it could not be detected in comK knockouts in Fermentas Life Sciences. Phusion DNA polymerase was
Bacillus subtilis (21). DprA is localized at cell poles as a obtained from Finnzymes. Coomassie Brilliant blue
partoftheeclipsecomplex, suggestingthatitgainsaccess R-250, proteinase K, Tris(hydroxymethyl) aminomethane
to the incoming DNA before other cellular factors (21). (Tris), heparin Sepharose, protease inhibitor cocktail and
DprA from Gram-positive bacteria has been reported to isopropyl b-D-1-thiogalactopyranoside (IPTG) were
bind and protect ssDNA but not dsDNA (22). These ob- procured from Sigma Aldrich Ltd (USA). Ni+-NTA
servations collectively suggest that DprA is crucial in the agarose and glutathione Sepharose were obtained from
protection of incoming foreign DNA. GE Healthcare (Sweden). [g-32P]ATP (3500Ci/mmol)
In this study, we have analysed the biochemical and was obtained from BRIT (India). All other reagents
molecular properties of HpDprA to understand its func- used were of analytical or ultrapure grade.
tional role in bacterial natural transformation. We dem-
onstrate that HpDprA binds and protects both ssDNA Oligonucleotides and radiolabeling
and dsDNA. This observation led us to investigate
All oligonucleotides used in this study were synthesized
further role of HpDprA in protecting dsDNA from re-
bySigmaGenosys.Theconcentrationsofoligonucleotides
striction enzymes. We noticed that dsDNA was not only
weredeterminedbyUVabsorbanceat260nm.Extinction
protected from restriction enzymes but could also be
coefficient of oligonucleotides was calculated using the
methylated with greater efficiency in the presence of
sum of the extinction coefficients of the individual bases.
HpDprA. Our findings shed light on a novel role of
The oligonucleotides (Table 1) were labelled at the 50-end
H. pylori DprA in alleviating the restriction barrier in
with [g-32P] ATP using T4 polynucleotide kinase and
the host bacterium.
purified by Qiagene nucleotide removal kit. For
experiments with ssDNA, oligo 1 (50 mer) and oligo 3
MATERIALS AND METHODS (110 mer) were labelled (Table 1) as described above.
Duplex dsDNA was formed by first labelling oligo 1,
Bacterial strains and plasmids
oligo 3 and oligo 5 individually and subsequently
Helicobacter pylori J99 strain (cagA+ iceA1 vacAs1am1) annealing the labelled oligos with excess of oligo 2, oligo
genomic DNA was obtained as a gift from New 4 and oligo 6, respectively (Table 1). Annealing reactions
England Biolabs (Beverley, MA, USA). Escherichia coli were carried out in 1(cid:3) saline sodium citrate buffer (23).
Table 1. Sequences of the oligonucleotides used
Oligo 1 50 mer CGAACCGTAATCGTACCTAGCAGTGACCGGTACCGTTCGGTAATATTCCG
Oligo 2 50 mer CGGAATATTACCGAACGGTACCGGTCACTGCTAGGTACGATTTGGGTTCG
Oligo 3 110 mer TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGA
CGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCG
Oligo 4 110 mer CGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGT
CTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA
Oligo 5 60 mer GCAAAACATTGGATCCGCGAATATTCAAATTTTCAAAGCAAAACATTCTTCAAAA
CAAGG
Oligo 6 60 mer CGTTTTGTAACCTAGGCGCTTATAAGTTTAAAAGTTTCGTTTTGTAAGAAGTTTT
GTTCC
Oligo 7 32 mer TCGATAGTCGGATCCTCTAGACAGCTCCTTTT
Oligo 8 40 mer TCGATAGTCGGATCCTCTAGACAGCTCCTTTTTTTTTTTT
Oligo 9 48 mer TCGATAGTCGGATCCTCTAGACAGCTCCTTTTTTTTTTTTTTTTTTTT
Oligo 10 63 mer ATCGATAGTCGGATCCTCTAGACAGCTCCATGTAGCAAGGCACTGGT
AGAATTCGGCAGCGTC
Oligo 11 73 mer ACGCGATCGCCCAGGTGGCAGGCCCTAGGGTGGAGGGGAGGCCGCC
GGCATGGGGACGCGATGGGCGGAGGCG
Oligo 12 90 mer Poly-dT (dT )
90
3276 NucleicAcidsResearch,2013,Vol.41,No.5
Sequencesofoligonucleotidesofincreasinglength(32–110 Mass spectroscopy and peptide mass fingerprinting
mer) are shown in Table 1.
Peptide mass fingerprint analysis of trypsin-treated
HpDprA was performed as described (28). Briefly,
Polymerase chain reaction amplification and cloning of
MALDI-MS data were acquired on an Ultraflex TOF/
H. pylori dprA
TOF spectrometer (Bruker Daltonics, Billerica, MA,
The 801-bp hpdprA gene was amplified by polymerase USA and Bremen, Germany), equipped with a 50-Hz
chain reaction (PCR) from H. pylori J99 genomic DNA pulsed nitrogen laser (l¼337nm), operated in positive
template using primers (forward primer, 50-GTCGGATC ion reflectron mode using a 90-ns time delay and a
CATGAAAAGCAATTTCCAATAC-30 and reverse 25-kV accelerating voltage. The samples were prepared
primer, 50-CTTCTCGAGTCATGCTAACACCACGAG by mixing an equal amount of peptide (0.5ml)
ATG-30) carrying the sites for BamHI and XhoI. The with matrices dihydroxybenzoic acid/a-cyano-4-hydro-
primers were designed with the help of gene sequence xycinnamic acid saturated in 0.1% trifluoroacetic acid
obtained from the annotated complete genome sequence and acetonitrile (1:1, v/v). Masses <500m/z were not
of H. pylori J99 deposited at The Institute for Genomic considered as a result of interference from the matrix.
Research. The amplified PCR fragment was gel purified
and digested with restriction enzymes. The DNA was Electrophoretic mobility shift assays
extracted with phenol–chloroform, precipitated by
TheDNA-bindingactivityofHpDprAwasmeasuredina
ethanol and ligated into BamHI–XhoI sites of pET28a
20-ml reaction mixture containing 0.5nM DNA substrate
vector with a hexa-histidine (His) tag at the N-terminus
6 (32P-ssDNA or 32P-dsDNA) in 1(cid:3) TAM reaction buffer
of the expressed protein. The DNA construct containing
[50mMTrispH7.4,50mMNaOAc,10mMMgOAcand
the dprA gene was confirmed by restriction digestion and
1mMdithiothreitol (DTT)] withindicated concentrations
sequencing.
of HpDprA. For the competition experiments, excess of
Overexpression and purification of HpDprA unlabelled competitor was also included in the reaction
mixture. After 30min incubation at 4(cid:4)C, free DNA was
HpDprA protein was overexpressed in E. coli strain
resolved from the DNA–protein complex by
ER2566 harbouring the DNA construct pET28a-hpdprA.
electrophoresis through 8% non-denaturing PAGE in 1(cid:3)
The recombinant bacteria were grown in LB with
TAMEbuffer[6mMTris–HCl (pH7.8),10mMNaOAc,
kanamycin selection (50mg/ml) at 37(cid:4)C to A of 0.6.
600 4mM MgOAc and 1mM ethylenediaminetetraacetic acid
HpDprA was induced by the addition of 0.5mM IPTG,
(EDTA)]. For ionic strength analysis of the HpDprA
andthecultureswereincubatedfor4hat37(cid:4)C.Cellswere
interaction with DNA, DNA substrates were incubated
collected by centrifugation, resuspended in Buffer A
with 1mM protein in reaction buffer 50mM Tris pH 7.4,
[50 mM Tris–HCl (pH 7.4), 300mM NaCl, 2mM
10mM MgCl , 1mM DTT and increasing concentrations
2
b-mercaptoethanol, 10% (v/v) glycerol and 10mM
ofNaCl(10–1000mM).Thesampleswereelectrophoresed
imidazole] and lysed by sonication. 1(cid:3) Protease inhibitor
on an 8% polyacrylamide gel in 45mM Tris/borate (pH
cocktail and 0.05% TritonX-100 were added to the cell
8.3) containing 0.4mM EDTA (0.5(cid:3)TBE). A constant
suspension before sonication. The cell lysate was voltage of 7V/cm was applied for 6h at 4(cid:4)C. The gel was
centrifuged at 16000rpm for 1h at 4(cid:4)C. The supernatant
transferredontoWhatmann3MMpaperanddriedunder
containing HpDprA protein was loaded onto a Ni-NTA vacuum at 75(cid:4)C for 30min. The gels were visualized by
column that had been previously equilibrated with Buffer
phosphorimaging and quantified using Image Gauge
A. The column was washed with 30 column volumes of
(Version 3.0). For DNA-binding assays with closed
Buffer A containing 30mM imidazole. The protein was
circular pUC19 DNA, 20ml reaction mixtures containing
eluted with 10ml of Buffer A containing 300mM
the indicated concentrations of purified HpDprA and
imidazole. The eluate of Ni-NTA column was dialyzed
1(cid:3)TAM reaction buffer were incubated with DNA for
against 50mM Tris buffer pH 7.4 containing 2mM b 30 min at 4(cid:4)C. Free DNA was resolved from the DNA–
mercaptoethanol, 10% glycerol and 75mM NaCl. The
proteincomplexbyelectrophoresisthrough1.5%agarose
dialyzed eluate was loaded on a heparin Sepharose
gelin0.5(cid:3)TBE.
column. The column was washed with the same buffer
and protein was eluted using a salt gradient of 0.1–1M.
Nuclease cleavage assays
Thepurifiedproteinwasdialyzedat4(cid:4)CagainstBufferA
containing 200mM NaCl. The purity of the protein Nuclease cleavage assays were performed in a 20ml
preparation was judged on sodium dodecyl sulphate– reaction mixture containing 0.5nM DNA substrates
polyacrylamide gel electrophoresis (SDS–PAGE) with (32P-ssDNA or 32P-dsDNA) in reaction buffer
Coomassie Brilliant blue staining (24) and silver staining (recommended NEB buffer for each respective nuclease)
(25). Protein concentration was estimated by Bradford and the indicated concentrations of HpDprA. The
assay using bovine serum albumin (BSA) as a standard cleavage reaction was started with the addition of
(26). Polyclonal antiserum against HpDprA was respective exonucleases (1 U/reaction). Digestion was
generated and used for western blot analysis. HpDprA performed for 30min at 37(cid:4)C. The reaction was stopped
antibody was purified from rabbit serum using a Protein with the addition of 10mM EDTA and the samples
A Sepharose affinity column. M.HpyAVIA was as deproteinized by the action of Proteinase K (10mg/
described (27). reaction) in the presence of 0.05% SDS for 15min at
NucleicAcidsResearch,2013,Vol.41,No.5 3277
65(cid:4)C. Degraded DNA was separated from protected Triton X-100 (1(cid:3)PBST) for 2h at 4(cid:4)C. The reaction
DNA on a denaturing (7 M urea) 8% polyacrylamide membrane was incubated with HpDprA (1mM) in
gel (0.5(cid:3)TBE). A constant voltage of 14V/cm was 1(cid:3)TAM buffer (4(cid:4)C, O/N), while the control
applied for 3h at room temperature. The gel was membrane was incubated with 1(cid:3)TAM buffer alone.
visualized by phosphorimaging analysis of the dried gel Bound HpDprA was detected with the anti-HpDprA
(Fujifilm FLA-9000). antibody and goat anti-rabbit immunoglobulin G (IgG)
horseradish-peroxidase conjugate. The blot was further
Restriction endonuclease cleavage assays processed using ECL plus western blot analysis kit from
GE Healthcare (UK).
The 110-bp duplex DNA (0.5nM) containing one site
each for HpyCH4V and Hpy188I and 50-bp dsDNA
Glutathione Sepharose pull down assay for analysis of
(0.5nM) containing two sites for HpyCH4III were
M.HpyAVIA–HpDprA interaction
incubated with increasing concentrations of HpDprA in
NEB reaction buffer 4 for 10min at 37(cid:4)C. Further GlutathioneSepharosebeads(100ml)wereincubatedwith
incubation with respective restriction enzymes glutathione transferase (GST)-tagged M.HpyAVIA
(1U/reaction) was carried for 1h. The reaction was (25mg) at 4(cid:4)C for 3h. Beads were pulled down by
stopped and samples deproteinized as explained for the centrifuging at 3000rpm. M.HpyAVIA–GST-bound
nuclease cleavage assay. Cleaved DNA product was beads were washed with PBST. Each time the wash was
separated from protected DNA on non-denaturing 8% collectedbycentrifugingat3000rpm.MTase-boundbeads
polyacrylamide gel in 0.5(cid:3)TBE. werefurtherincubatedwithHpDprA(25mg)inPBS.This
wasfollowedwiththreewasheswithPBST.BoundMTase
In vitro methylation assay waselutedusing25and50mMglutathione.Theeluatewas
probed with anti-His antibody (1:10000) for the presence
Methylation assays were carried out to monitor the
ofHpDprA.
incorporation of tritiated methyl groups into DNA by
using a modified ion exchange filter-binding assay (29).
Enzyme-linked immunosorbent assay for analysis of
Methylation assays were performed in a reaction
protein–protein interactions
mixture (20ml) containing supercoiled pUC19 plasmid
DNA, [3H]AdoMet (specific activity 66 Ci/mmol) and The interaction between HpDprA and M.HpyAVIA was
purified protein (M.HpyAVIA and/or HpDprA) in the tested by modified enzyme-linked immunosorbent assay
1(cid:3)TAM reaction buffer. DNA was first pre-incubated (ELISA) as described (31). Briefly, purified M.HpyAVIA
with HpDprA for 10min at 37(cid:4)C in an appropriate was adsorbed to the wells of an ELISA plate (2.0mg/well)
reaction buffer. The methylation reaction was started by overnight incubation at 4(cid:4)C, and the wells were
with the addition of MTase. After incubation at 37(cid:4)C blocked with 5% skimmed milk in PBS. The indicated
for 1h, reactions were stopped by snap freezing in liquid concentrations of HpDprA were incubated in 1(cid:3)TAM
nitrogen. Background counts were measured at zero-time buffer with the previously coated wells for 2h at 37(cid:4)C.
incubation.Thereactionmixtureincubatedintheabsence Detection of bound HpDprA was scored using anti-
of enzyme was taken as control and the data were HpDprA antibody as primary antibody and goat anti-
analysed. All methylation experiments were carried out rabbit IgG horseradish–peroxidase conjugate as
in triplicate and the average values reported. Standard secondary antibody. Wells were washed between
deviations of the average methylation rates were <10%. incubations with three washes of 1(cid:3)PBST. BSA was
used as a control. All experiments were performed in
Sensitivity to restriction endonuclease MnlI triplicate and standard deviations were calculated.
MethylationofpUC19DNA(1200nMsiteconcentration)
wascarried outwithpurified proteins(M.HpyAVIA and/
RESULTS
or HpDprA) as described above in the presence of 8mM
AdoMetin1(cid:3)TAMreactionbufferfor1hat37(cid:4)C.This HpDprA binds ssDNA and dsDNA
was followed by inactivation of both the proteins by
HpDprA was expressed as a soluble recombinant protein
heating at 75(cid:4)C for 30min. DNA was further incubated
withaN-terminal(His) taginE.coliandpurifiedtonear-
with MnlI (1 U/reaction) at 37(cid:4)C for 1h. Reactions were 6
homogeneity (Supplementary Figure S1A). A minor
stopped and deproteinized as described earlier. Products
protein band of (cid:5)30kDa was detected just below the
wereanalysedbyelectrophoresisona1.2%agarosegelin
purified 33kDa protein in silver stained SDS–PAGE
0.5(cid:3)TBE.
(Supplementary Figure S1A, lane 2). This protein band
wasseeninallthepurifiedfractionsandinallsubsequent
Far Western
protein preparations. The mass spectra of purified
Far Western studies were performed by a similar method HpDprA revealed a sharp peak corresponding to the
as described earlier (30). Briefly, the indicated calculated molecular weight of 33kDa for the
concentrations of M.HpyAVIA in 5ml volume were recombinant protein (Supplementary Figure S1B). A
spotted on a nitrocellulose membrane followed by short peak corresponding to 30kDa was also observed
blocking with 5% (w/v) skimmed milk in phosphate- (Supplementary Figure S1B). Peptide mass fingerprinting
buffered saline (PBS) buffer containing 0.05% (v/v) was performed to confirm the identity of the purified
3278 NucleicAcidsResearch,2013,Vol.41,No.5
protein and the co-purified minor protein. An analysis of thatincreasingthesizeofthetransformingDNAsubstrate
the obtained fingerprints revealed several matches for the from 50bp to longer chromosomal DNA resulted in an
expected fingerprint of HpDprA confirming the increase in transformation frequency of H. pylori (15).
authenticity of the purified protein (Supplementary This has also been observed in the case of SpDprA
Figure S1C). Two bands corresponding to peptide ions where the binding affinity of the protein increased with
from the C-terminal region of HpDprA (encircled peaks the increase in size of ssDNA and becomes optimal with
inSupplementaryFigureS1C)werefoundtobemissingin 50 mer (33). In order to determine whether the DNA
the peptide fingerprint map of the 30kDa band length affects its interaction with HpDprA, an analysis
(Supplementary Figure S1D). These bands correspond to of HpDprA interaction with varying lengths of ssDNA
alossofnearly30aminoacidsfromtheC-terminuswhich (32–110 mer) was carried out. The affinity of HpDprA
correlates with a mass difference of 3kDa. It was for ssDNA did not vary significantly with increasing
confirmed that the cleavage was not at the N-terminus length of ssDNA from 40 to 110 mer. However, a
as both bands were picked up in the western blot using reduced affinity for 32 mer ssDNA was observed
an anti-His antibody (data not shown).
(Supplementary Figure S2C). This shows that binding of
DprA from Streptococcus pneumoniae (SpDprA) and
HpDprA becomes optimal with 40 mer size of ssDNA.
Bacillus subtillis (BsDprA) has been reported to bind
These results together demonstrate that the binding of
and protect ssDNA but not dsDNA (22). HpDprA
HpDprA to DNAissequence independent. The ability of
binds not only ssDNA (Figure 1A) but interestingly to
the protein to bind dsDNA indicates the possibility of a
dsDNA too (Figure 1B), resulting in a retardation of
wider role for DprA in H. pylori.
both complexes on native PAGE. However, HpDprA
showed a higher affinity towards ssDNA as evidenced
by the fact that for ssDNA a near complete shift of free
DNA was observed at 100nM concentration of protein. HpDprA has a higher affinity for ssDNA than dsDNA
This protein concentration was 2-fold lower than the DNA-binding studies with EMSA and ionic strength
concentration required for a similar shift with free analysis of the HpDprA–DNA complex indicated a
dsDNA (Figure 1C).
higher affinity of the protein for ssDNA over dsDNA.
Binding of SpDprA to ssDNA was shown to be
ThehigheraffinityofHpDprAforssDNAwasascertained
sequence non-specific (22). To determine whether
incompetitionassays.TheHpDprA–ssDNAcomplexwas
binding of HpDprA protein is sequence independent or
chased with excess of cold ssDNA. A release of labelled
not,gelshiftassayswerecarriedoutwithhomopolymeric
DNA from the complex was observed at a (cid:5)200-fold
ssDNA poly-dT (dT ) and dsDNA poly (dT:dA) .
110 110bp higher concentration of cold competitor DNA (Figure
HpDprAshowedasimilarbindingpatternwithboththese
2A),indicatingthatHpDprAformsastrongbutreversible
homopolymers (Figure 1D and E) as it showed for
complex with ssDNA. Next, the HpDprA–ssDNA
random sequences (Figure 1A and B). A quantitative
complex was chased with excess of cold dsDNA. The
analysis of binding of HpDprA with ssDNA [poly dT
release of free ssDNA was less with dsDNA than with
(dT )] and with dsDNA [poly (dT:dA) ] shown in
110 110 bp ssDNA (Figure 2A and B). Quantification of the
Figure 1F clearly suggests that HpDprA binds both
HpDprA–ssDNA complex chased with ssDNA and
ssDNA and dsDNA in a sequence-independent manner.
dsDNA revealedthat 50% complex was competed outby
The sensitivity of protein–DNA complex to salt has
a(cid:5)6-foldhigherconcentrationofcoldcompetitordsDNA
been shown as a relative measure of its binding affinity
than with cold competitor ssDNA (Figure 2C). Similarly,
(32). To further characterize the interaction of HpDprA
the HpDprA–dsDNA complex was chased with an excess
with ssDNA and dsDNA, binding assays were performed
of cold dsDNA and with cold ssDNA. The complex was
in the presence of increasing concentration of NaCl. The
more efficiently dissociated by cold competitor ssDNA
binding of HpDprA with both ssDNA and dsDNA was
than by cold dsDNA (Figure 2D and E). A quantitative
stable upto 200 mM salt concentration (Supplementary
comparativeanalysisofcompetitorassayoftheHpDprA–
Figure S2A). However, at salt concentrations >200mM,
dsDNAcomplexshowsthatreleaseof50%bounddsDNA
the dissociation of dsDNA from its bound complex was
more than that of the ssDNA–protein complex. At was observed with a (cid:5)10-fold lower concentration of
300mM NaCl, (cid:5)60% HpDprA–dsDNA complex and competitor ssDNA than with dsDNA (Figure 2F). These
(cid:5)75% HpDprA–ssDNA complex were retained. This results indicate a higher preference for ssDNA by
indicates that the HpDprA–ssDNA complex is more HpDprA.
stable than the HpDprA–dsDNA complex. Next, the HpDprA–ssDNA (50 mer) complex was
SpDprA hasbeenshown tobindto supercoiled (cid:3)X174 chased with cold ssDNA (50 mer of same sequence) and
DNA, indicating that it does not need a free end to bind poly-dT (dT110) separately. ssDNA was competed out
ssDNA (22). To determine whether HpDprA binds from complex with similar efficiency by both types of
dsDNA lacking a free end, electrophoretic mobility shift DNA substrates (Supplementary Figure S3). A similar
assay was performed with pUC19 plasmid DNA as a result was observed for the HpDprA–dsDNA complex
substrate. When increasing concentrations of the protein (data not shown). These results additionally confirm
were added to covalently closed circular form of pUC19, that HpDprA–DNA binding is not substantially
its mobility in native agarose gel decreased progressively affected by changes in length or sequence of substrate
(Supplementary Figure S2B). It has been demonstrated DNA above 40 mer length.
NucleicAcidsResearch,2013,Vol.41,No.5 3279
Figure 1. Binding ofHpDprAtossDNAanddsDNA. Electrophoretic mobilityshiftassayswere performedbyincubatingdifferent concentrations
ofHpDprA(0,10,25,50,100,200,400,800,1000and1500nM)with0.5nM32P-labelledDNAsubstrates.Sampleswereelectrophoresedonnative
PAGE and visualized by autoradiography, as described in ‘Materials and Methods’ section. [(A) 50 mer ssDNA (B) 50 mer dsDNA (D) poly-dT
(dT )(E)poly(dT:dA) bp(0.5nM)].QuantitationofHpDprAbindingtossDNAanddsDNAof50bplength(C)or110bplength(F).Thedata
110 110
points in Figure 1C and F were obtained from densitometric analysis of EMSA results.
HpDprA–DNA complex is protected from exonucleases indicate that HpDprA coats DNA molecules (both
and sequence-independent endonucleases ssDNA and dsDNA) completely and thus prevents
access of various nucleases to DNA. Earlier, electron
To analyse the nature of interaction of HpDprA with
micrographs for interaction of S. pneumoniae DprA with
DNA, nuclease protection assays were carried out. The
(cid:3)X174 ssDNA showed tightly packed discrete complexes
HpDprA–ssDNA complex was subjected to cleavage
that include numerous protein molecules (22). Such a
with ssDNA-specific 30-exonuclease, ExoT. HpDprA
complex would prevent the access of nucleases to the
conferred protection to ssDNA from ExoT (Figure 3A)
DNA molecule. Thus, these results for HpDprA are in
and the protected DNA was of the same size as that of
accordance with the earlier observation.
full-length DNA (110 mer). Similarly, protection of
dsDNA from the 30-exonuclease, ExoIII was observed in
HpDprA protects dsDNA from Type II restriction
the presence of HpDprA (Figure 3B), indicating that
endonucleases
HpDprA binds and protects both ssDNA and dsDNA.
The HpDprA–ssDNA complex was further probed with Restriction enzymes cleave incoming DNA during inter-
RecJ, a 50-exonuclease. As can be seen from Figure 3C, strainnaturaltransformationduetotheirdifferentpattern
protection of ssDNA from RecJ was observed similar to ofmethylationandthusactasatransformationbarrierin
that with ExoT. The HpDprA–dsDNA complex was H.pylori(16,34).Asinter-straintransformationfrequency
found to be resistant to T7Exo (dsDNA-specific 50- inH.pyloriisreducedbutnotcompletelyinhibitedbyR–
exonuclease) (Figure 3D). Furthermore, the HpDprA– Msystems,thecleavageofincomingDNAshouldbeonly
DNA complex was found to be protected from non- partial and limited to only a fraction of restriction sites
specific endonucleases (mung bean endonuclease for (16). DNA-binding proteins have been hypothesized to
ssDNA and DNase1 for dsDNA) as well (data not have a role in limiting the accessibility of restriction
shown). Protection of the HpDprA–DNA complex from endonucleases to the DNA molecule and thus preventing
exonuleasesaswellassequencenon-specificendonucleases cleavage (35). As shown earlier, DprA from H. pyori can
3280 NucleicAcidsResearch,2013,Vol.41,No.5
Figure 2. HpDprA has higher affinity for ssDNA than dsDNA. Chase of preformed 32P-labelled 50 mer ssDNA–HpDprA complex (0.5nM DNA
and400nMofHpDprA)withunlabelled(A)ssDNAor(B)dsDNA.Similarly,thechaseof50-bpdsDNA–HpDprAcomplexwithadditionofcold
(D)dsDNA or(E)ssDNA. Lane 1:DNA alone, lanes2–9: 0,10,25,50, 100, 250,500 and750 (nM)unlabelled competitor DNA.Acomparative
quantitativeanalysisofchasewithcoldcompetitorDNA(ssDNAanddsDNA)ofssDNA–HpDprAcomplex(C)anddsDNA–HpDprAcomplex(F)
are shown.
bind and protect dsDNA (Figures 1 and 3). Both R–M HpDprA showed complete binding with DNA
systems and DprA have been shown to play an early role (Figure 4A). Heat inactivated HpDprA failed to protect
in natural transformation (16,36). Taken together a DNA from restriction cleavage confirming the specificity
functional interaction between DprA and R–M system of the interaction (Figure 4A). A similar protection was
can be deduced as they participate in the same spatial observedwhentheHpDprA–dsDNAcomplexwasprobed
and temporal events during the process of natural with R.HpyCH4III (Figure 4B) and R.Hpy188I
transformation. (Figure 4C).
To investigate the ability of HpDprA to confer Theeffectonrestrictionenzymesisgeneral.Totestthis,
protection from Type II restriction endonucleases, the HpDprA–dsDNA complex was subjected to
in vitro protection assays were performed. Three different restriction activity by MboII. Protection of dsDNA
Type II restriction enzymes R.HpyCH4V, R.HpyCH4III from R.MboII shows that the HpDprA–dsDNA
and R.Hpy188I from H. pylori were used in this analysis. complex is resistant to restriction enzymes from other
The dsDNA substrate (110bp) with one site for bacterial species (Supplementary Figure S4). These
R.HpyCH4V was incubated with increasing con- results indicate a protection of dsDNA from REases in
centrations of HpDprA and the reaction was initiated by the presence of HpDprA.
additionoftherestrictionenzyme.Astherestrictionsiteis
69bpawayfromthelabelled end,asuccessfulcleavageof
HpDprA stimulates the activity of H. pylori MTase
110bp dsDNA will result in 69bp labelled dsDNA and
41bp unlabelled dsDNA. Cleaved DNA was separated InhibitionofDNAcleavagebyTypeIIrestrictionenzymes
from protected DNA (110bp) on 8% native in the presence of HpDprA could be attributed to the
PAGE. HpDprA was found to protect dsDNA from ability of DprA to coat dsDNA thus occluding the
R.HpyCH4V in the concentration range at which restriction sites from restriction enzymes. This hypothesis
NucleicAcidsResearch,2013,Vol.41,No.5 3281
Figure 3. Nuclease protection assay. 32P-labelled ssDNA or dsDNA (0.5nM) either alone (lane 2) or pre-bound with increasing concentrations of
HpDprA[1,5,10,50,100,500,1000and1500(nM),lanes3–10]wasincubatedfor30minwith1unitof(A)ExoT(B)ExoIII(C)RecJ(D)T7Exo.
Lane 1: DNA alone.
is in agreement with the earlier observation of nuclease restriction enzyme. Therefore, stimulation of a MTase
protection of DNA by HpDprA (Figures 3 and 4) as well in the presence of HpDprA should be accompanied
as by SpDprA (22). Having demonstrated HpDprA with an increased protection from the cognate
involvement in protection of DNA from the REases- restriction enzyme. While M.HpyAVIA methylates
mediated cleavage, it was reasonable to assess interaction both GAGG and GGAG sites, MnlI restriction
ofitwiththeMTasesinH.pylori.Anassaywascarriedout enzyme recognizes and cleaves at GGAG(N) site
6
toprobetheabilityofM.HpyAVIA(asolitaryN6adenine (27). As shown in Figure 6A, pUC19 was methylated
MTase)tomethylatepUC19inthepresenceandabsenceof with M.HpyAVIA in the presence and absence of
HpDprA. Surprisingly, with increasing concentrations of HpDprA following which the MTase and/or HpDprA
HpDprA, an increase in activity of the MTase was were heat inactivated at 70(cid:4)C for 30 min. Next, DNA
observed (Figure 5A). Nearly a 4-fold stimulation of cleavage was initiated by addition of MnlI. Complete
MTase activity was observed at 3mM concentration of protection of pUC19 DNA was observed at a 10-fold
HpDprA(Figure5A).Nostimulationwasobservedwhen lower concentration of the MTase in the presence of
heat inactivated HpDprA was added to the reaction HpDprA when compared with that in the absence of
(Figure 5B). When sinefungin (a universal competitive DprA (Figure 6B and C). It must be noted that in this
inhibitor of MTases) was added to the reaction in the assay, methylation of DNA was followed by heat
presence of HpDprA, the activity of MTase was reduced denaturation ensuring inactivation of all DprA and
significantly(Figure5B).Proteins(E.coliRecA,H.pylori MTase molecules. Figure 6B, lane 3, represents a
SSBandH.influenzaeDprA)thatbindtossDNAsuchas reaction in which only HpDprA (3mM) was added
HpDprAhadnoeffectonMTaseactivity(datanotshown), and no MTase was added. The reaction mixture was
suggestingthatstimulationofH.pyloriMTasesisaunique heat inactivated (in a similar manner as for other
andspecificpropertyofHpDprA. reactions containing MTase and DprA) and cleavage
reaction started with addition of MnlI. A similar
cleavage pattern as that of MnlI alone (Figure 6B,
HpDprA confers increased protection from restriction
lanes 2 and 3) shows that the heat inactivation step
enzymes due to stimulation of MTase activity
inactivated all the HpDprA molecules and the
In the case of Type II R–M systems, DNA methylation increased protection observed was solely due to
results in a proportionate protection from the cognate increased methylation in the presence of HpDprA.
3282 NucleicAcidsResearch,2013,Vol.41,No.5
Figure 4. HpDprA protects dsDNA from Type II restriction enzymes. 50-end-labelled dsDNA (0.5nM) either alone (lane 2) or pre-bound with
increasingconcentrationsofHpDprA[5,10,15,25,50,75,150,300,500and1000(nM),lanes3–12]wasincubatedwith1Uof(A)R.HpyCH4V
(B) R.HpyCH4III (C) R.Hpy188I for 60min at 37(cid:4)C. Lane 1: DNA alone. Figure 4A, lane 13: (cid:2) indicates heat inactivated HpDprA (1000nM).
Figure 5. Effect of HpDprA on MTase activity. (A) Increasing concentrations of HpDprA were incubated with 1mM AdoMet and pUC19 DNA
(1000nM site concentration) and 100nM of M.HpyAVIA. Incorporation of tritiated methyl groups on DNA was monitored. (B) Stimulation of
MTase activity of M.HpyAVIA in presence of HpDprA. (cid:2) indicates heat inactivated protein.
These observations clearly demonstrate that HpDprA analysis was carried out. Increasing concentrations
stimulates methylation activity of MTase on dsDNA. of M.HpyAVIA (1–4mg) were immobilized on a
nitrocellulose membrane. After blocking with 5%
HpDprA shows physical interaction with MTase
skimmed milk, the membrane was further incubated with
ToascertainwhetherstimulationofMTasesbyHpDprAis 1mMHpDprA.InteractionbetweenMTaseandHpDprA
due to physical or functional interaction, Far Western was probed with HpDprA antiserum as described in
NucleicAcidsResearch,2013,Vol.41,No.5 3283
Figure 6. Comparison of restriction digestion patterns of DNA in the presence and absence of HpDprA. (A) Schematic illustration of the
experimental design. (cid:2) indicates heat inactivation step. (B) pUC19 either unmethylated (lane 2) or methylated with increasing concentrations of
M.HpyAVIA[250,500,1000,2000,4000and5000(nM),lanes4–9]inpresenceof1mMofHpDprAwastreatedwithMnl1(1U)for60minat37(cid:4)C.
Lane3:pUC19incubatedwith1mMofHpDprAfollowedbytreatmentwithMnlI.M:1kbDNAladder(C)pUC19eitherunmethylated(lane2)or
methylated with increasing concentrations of M.HpyAVIA [250, 500, 1000, 2000, 4000 and 5000 (nM), lanes 3–8] was treated with MnlI. Lane 1:
pUC19 DNA alone.
‘MaterialsandMethods’section.Agreaterinteractionwas probed with pre-immune serum in place of HpDprA
observed with the increasing concentration of the antiserum confirming the specificity of the interaction
immobilized MTase (Figure 7A). However, no signal was (Figure 7C). Similarly, no interaction was observed for
obtained when immobilized M.HpyAVIA was directly HpDprA with R.HpyAII (Type IIS restriction enzyme
incubated with HpDprA antiserum (data not shown), containing N-terminal (His) tag) (Figure 7C). To
6
indicating that the signal obtained was due to the understand the nature of interaction between HpDprA
interaction between HpDprA and MTase. Similarly, and M.HpyAVIA, ELISA was performed in presence of
whentheMTasewastestedforinteractionwithMutS2of varying concentrations of NaCl. Interaction of HpDprA
H. pylori (HpMutS2—an antirecombinase protein), no with M.HpyAVIA was stable upto 250 mM NaCl
signal was observed (Figure 7B) confirming the specificity concentration (Figure 7D). This suggests that interaction
ofHpDprA–MTaseinteraction. of HpDprA with M.HpyAVIA is stable even under high
Interaction between M.HpyAVIA and HpDprA was salt concentrations.
also confirmed by ELISA, where a fixed concentration M.HpyAVIA interaction with HpDprA was further
of M.HpyAVIA (2mg) was immobilized on ELISA analysed using glutathione Sepharose pull down
plates and probed for interaction with increasing experiments. GST-tagged M.HpyAVIA was allowed to
concentrations of HpDprA. A non-linear saturation bind to glutathione Sepharose beads. HpDprA was
curve was obtained for interaction of HpDprA with added to glutathione Sepharose beads bound to
M.HpyAVIA (Supplementary Figure S5). No signal was M.HpyAVIA–GST and glutathione Sepharose beads
obtained when BSA was immobilized instead of the alone in 1(cid:3)PBS buffer. The beads were washed with
MTase or M.HpyAVIA–HpDprA interaction was 1(cid:3)PBSthrice.M.HpyAVIAwaselutedfromglutathione