grk5 deficiency leads to reduced hippocampal ach level via impaired presynaptic m2/m4

20 Pages·2009·4.14 MB·English

by  Zhiming Suo

JBC Papers in Press. Published on May 28, 2009 as Manuscript M109.005959
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M109.005959
GRK5 DEFICIENCY LEADS TO REDUCED HIPPOCAMPAL ACH LEVEL VIA
IMPAIRED PRESYNAPTIC M2/M4 AUTORECEPTOR DESENSITIZATION
Jun Liu1,4, Imtiaz Rasul1, Yuning Sun1, Guisheng Wu1, Longxuan Li1,5, Richard T. Premont6,
William Z. Suo1,2,3,*
1Lab for Alzheimer's Disease & Aging Research, Kansas City Veterans Affairs Medical Center, Kansas
City, MO 64128, USA
Departments of 2Neurology and 3Physiology, University of Kansas Medical College, Kansas City, KS
66170, USA
4Department of Neurology, the Second Affiliated Hospital, Sun Yat-sen University, Guangzhou,
Guangdong, 510120, P. R. China
5Department of Neurology, Guangdong Medical College Affiliated Hospital, Zhanjian, Guangdong,
524001, P. R. China
6Department of Medicine, Duke Univ. Med. Center, Durham, NC 27710, USA
Running head: GRK5 Deficiency and Cholinergic hypofunction
*Address correspondence to: William Z. Suo, Laboratory for Alzheimer's Disease & Aging Research,
Veterans Affairs Medical Center, 4801 Linwood Blvd., Kansas City, Missouri 64128, USA, Phone: +1-
816-861-4700 ext. 57084, Fax: + 1-816-861-1110, E-mail: [email protected] D
o
w
n
lo
G protein-coupled receptor kinase-5 mice. Altogether, these results suggest that a
d
e
(GRK5) deficiency has been linked recently to GRK5 deficiency leads to a reduced d fro
early Alzheimer's disease (AD), but the hippocampal ACh release and cholinergic m
h
mechanism by which GRK5 deficiency may hypofunction by selective impairment of ttp
contribute to AD pathogenesis remains elusive. desensitization of presynaptic M2/M4 ://w
w
Here we report that overexpression of autoreceptors. Since this non-structural w
dominant negative mutant of GRK5 (dnGRK5) cholinergic hypofunction precedes the .jbc
.o
in a cholinergic neuronal cell line led to hippocampal cholinergic hypofunction rg
decreased acetylcholine (ACh) release. This associated with structural cholinergic by/
g
reduction was fully corrected by pertussis degeneration and cognitive decline in aged u
e
s
toxin, atropine (a non-selective muscarinic GRK5 knockout mice, this non-structural t o
n
antagonist), or methoctramine (a selective alteration may be an early event contributing A
p
M2/M4 muscarinic receptor antagonist). to cholinergic degeneration in AD. ril 5
Consistent with results in cultured cells, high , 2
0
1
potassium-evoked ACh release in hippocampal G protein-coupled receptor kinase-5 (GRK5) 9
slices from young GRK5 knockout mice was is one of the seven GRK family members, whose
significantly reduced compared to wild type primary function is to desensitize G-protein
littermates, and this reduced ACh release was coupled receptors (GPCRs) (1,2). We recently
also fully corrected by methoctramine. In reported that increased soluble β-amyloid (Aβ)
addition, following treatment with the non- decreases membrane (functional) levels of GRK5
selective muscarinic agonist oxotremorine-M, in vitro, and this membrane GRK5 deficiency
M2 and M4 receptors underwent significantly occurs in vivo as well in an Alzheimer’s disease
reduced internalization in GRK5KO slices (AD) transgenic model (3), and in postmortem
compared to WT slices, as assessed by plasma human AD brain samples (4). Moreover, the aged
membrane retention of receptor GRK5 knockout (GRK5KO) mouse, which
immunoreactivity, while M1 receptor models this GRK5 deficiency in the absence of
internalization was not affected by loss of exogenous mutant human β-amyloid precursor
GRK5 expression. Moreover, Western blotting protein (β-APP) or any other known AD-related
revealed no synaptic or cholinergic
genes (i.e., presenilins or tau), develops axonal
degenerative changes in young GRK5 knockout
defects and mild cholinergic degeneration with
1
Copyright 2009 by The American Society for Biochemistry and Molecular Biology, Inc.
associated amnestic mild cognitive impairment salivation, as well as antinociceptive changes (9).
(5). When Swedish mutant βAPP is over- These behavioral changes are typical M2 and/or
expressed in the GRK5KO mice by cross-breeding M4 receptor-mediated functions, according to the
with Swedish APP transgenic mice, the aged findings from muscarinic receptor subtype
double mutant mice display significantly knockout mice (11,15). Therefore, GRK5
exaggerated brain inflammation (6). These deficiency in vivo may selectively impair
accumulating data strongly suggest that GRK5 M2/M4R desensitization. If so, the resulting
deficiency significantly contributes to AD presynaptic M2/M4R hyperactivity would overly
pathogenesis, although the precise molecular inhibit ACh release from cholinergic neurons, and
mechanisms remain to be delineated. eventually compromise the learning and memory
Mounting evidence indicates that the substrate function.
spectrum of broadly-expressed GRKs (i.e., This study was undertaken to investigate the
GRK2/3/5/6) can significantly overlap for some impact of GRK5 deficiency on ACh release and
receptors, suggesting that a lack of one of these desensitization of mAChR subtypes using GRK5
members may have only a limited impact on deficient models both in vitro and in hippocampal
GPCR regulation (2). On the other hand, slices from the GRK5KO mice.
compensation for loss of a particular GRK
member by others in vivo can be incomplete or EXPERIMENTAL PROCEDURES D
selective for other receptor types. For example, Materials: [Methyl-3H]Choline chloride was ow
n
GRK2KO and GRK6KO mice have been shown from Amersham Biosciences (Piscataway, NJ). loa
d
to display selective impairments of adrenergic and Fetal bovine serum (FBS) was from Atlanta ed
dopaminergic receptor desensitization, Biologicals (Norcross, GA). Pertussis toxin fro
m
respectively (7,8). Findings from different GRK (PTX), methoctramine tetrahydrochloride (MT), h
ttp
isoform-targeted animals strongly support the atropine, Eserine, and oxotremorine-M (oxo-M) ://w
conclusion that although redundancy exists were purchased from Sigma (St. Louis, MO). w
w
between GRK isoforms, each isoform has its own Other routine biochemical and cell culture .jb
c
selective substrates; should one GRK be deficient reagents and supplies were purchased from Sigma, .org
or inactivated, desensitization of its selective Invitrogen, or Fisher. b/
y
substrates will be impaired (1). For GRK5 in Plasmid constructs: The coding sequence of gu
e
particular, previous studies have demonstrated that K215R dominant negative (dn) mutant bovine st o
n
GRK5KO mice display selectively impaired GRK5 cDNA in the previously constructed pRK5- A
p
desensitization of muscarinic acetylcholine (ACh) GRK5K215R plasmid (16) was initially used as a ril 5
receptors (mAChRs) (9,10). template for polymerase chain reaction (PCR) , 2
0
To date, five mAChR subtypes have been with T7 primer and a modified GRK5 reverse 19
identified, with M1, M3, and M5 receptors being p r i m e r ( 5 ' -
G -coupled, and M2 and M4 receptors being AAATTTGTCGACGCTGCTTCCGGTGGAGTT
q/11
G -coupled (11). In hippocampal memory -3') that eliminated the stop codon of the GRK5
i/o
circuits, M2 receptor (M2R) is primarily a and added SalI site. The resultant PCR product
presynaptic autoreceptor that inhibits ACh release containing the dnGRK5 and phrGFP-C
(12,13), while M1R is postsynaptic and is believed mammalian expression vector (Stratagene, La
to be critical in memory processes involving an Jolla, CA) were digested with BamHI/SalI, and
interaction between the cerebral cortex and then ligated to generate dnGRK5GFP fusion
hippocampus (11). In AD, there is a selective loss construct, with the humanized Renilla green
of cholinergic neurons, which leads to a fluorescent protein (hrGFP) tagged at C-terminal
cholinergic hypofunction, primarily a hypoactivity of the dnGRK5. The point mutation of the
of postsynaptic nicotinic and M1 muscarinic dnGRK5GFP was then corrected by mutagenesis
receptors (14). GRK5KO mice, when challenged to generate the wild type (wt)GRK5GFP fusion
with non-selective muscarinic agonists, display construction. The full length of both the
augmented hypothermia, hypoactivity, tremor, and dnGRK5GFP and wtGRK5GFP fusions was
2
sequenced to exclude any unexpected mutations. HT22/dnGRK5GFP/M2, HT22/wtGRK5GFP/M2,
and HT22/GFP/M2 that express equivalent
Due to very low levels of intrinsic M2R
numbers of the transgene copies were used for this
expression in the HT22 cells, this study used
study. For all functional assays, the HT22 cells
pVITRO1 multigenic expression vector
were differentiated, as previously described (19),
(InvivoGen, San Diego, CA) to co-express the
before any treatments were applied.
GRK5GFP along with M2 together. The
Semi-quantitative RT-PCR: The mRNA
pVITRO1 carries two elongation factor 1α
levels of cells were analyzed by reverse
promoters from rat and mouse origins (rEF1α and
transcriptase-polymerase chain reaction (RT-
mEF1α). Similarly to their human counterpart,
PCR). Total RNA was isolated from the hrGFP,
both promoters display strong activities that yield
wtGRK5 and dnGRK5 transfected HT22 cells
similar levels of expression. The hph gene confers
using Trizol Reagent (Invitrogen), then quantified
resistance to hygromycin B in both E. coli and
by UV spectrophotometry (Bio-Rad, Hercules,
mammalian cells. Therefore, pVITRO1 plasmids
CA). Total RNA (2µg) was used to create cDNA
allow ubiquitous and constitutive co-expression of
using SuperScript™II First-Strand Synthesis
two genes of interest at high levels in mammalian
System Kit (Invitrogen). Subsequent PCR
cells. For the constructs, human M2R cDNA
amplification of murine GRK5, bovine GRK5GFP
(University of Missouri-Rolla cDNA Resource
fushion or GAPDH (an internal control), was
D
Center) was first digested with AgeI/BglII and o
carried out for 30 cycles of 94°C for 40 sec, 58°C w
inserted into the multiple cloning site (MCS) 2 of for 30 sec, and 72°C for 40 sec, followed by a 5 nlo
a
pVITRO1. Then, the wtGRK5GFP and min final extension at 72 °C. The PCR products ded
dnGRK5GFP fusions from the phrGFP-C vector were run on 1.8% agarose gels and the intensities fro
m
were digested with BsiWI/AvrII and inserted into were measured using an image analyzer Quantity h
the MCS 1 of pVITRO1 (Fig. 1A). For the hrGFP ttp
control, the phrGFP-C was digested with one (Bio-Rad, Hercules, CA). The primer ://w
sequences were shown in Table 1. w
BamHI/AvrII and inserted into the MCS 1 of High K+-evoked [3H]ACh release: This w.jb
pVITRO1. The full length of all the inserts was experiment was performed in both cultured cells c.o
sequence-confirmed before transfection. and perfused hippocampal slices. HT22 cells brg/
y
Cell culture and transfection: HT22 cells are seeded at a density of 5x105 cells/well in six-well g
u
a generous gift from Dr. David Schubert (The Salk plates were allowed for differentiation, as est o
Institute, La Jolla, CA) (17,18). The cells were previously described (19). Cells were then n A
scuupltpulrieedd iwn itDh u1lb0e%cc FoB's Sm, o1d0i0fi eµdg /Emalg lsetrse'sp tmomedyiucimn i3nHc]uCbhaotleidn e wcihtlho rimdee daitu ma ficnoanlt acionnincegn t[rMatieotnh yolf- pril 5, 2
and 100 units/ml penicillin, as previously 0.05 µM (5 µCi/ml) for 2 h. This low 01
9
described (19). Transfection was performed using concentration of [3H]choline favors the selective
0.125-0.25 µg plasmid DNA (pVITRO1- uptake of choline through high-affinity choline
dnGRK5GFP/M2, pVITRO1-wtGRK5GFP/M2, transporter (HACT) (20). After the incubation, the
and pVITRO1-GFP/M2) mixed with TransFastTM cells were rinsed three times, followed by high
reagents (Promega), according the manufacture's potassium (50 mM) stimulation in the presence of
instruction. Forty-eight hours after transfection, 1 µM Eserine (to prevent hydrolysis of the
hygromycin B (750 µg/ml) was added to the released ACh (21)) for 2 h, with normal potassium
medium for initial selection of stably transfected medium containing 1 µM Eserine as control for
cells. Two weeks after initial selection, the determination of basal release. The conditioned
transfected cells were diluted and further purified medium (200 µl/sample) was then taken for liquid
with assistance of cloning cylinders (Bellco Glass, scintillation counting. As previously
Inc., Vineland, NJ). The cloned stable lines were demonstrated, the total released radioactivity in
maintained in the culture medium containing 100 similar conditions contains more than 90%
µg/ml hygromycin B to keep the selection authentic [3H]ACh (13,22). Therefore, the total
pressure. Selected lines of secreted [3H] beyond (subtracting) the basal
3
release was used to represent the [3H]ACh release Membrane fraction preparation: F o r
in response to a treatment. For determining the cultured HT22 cells, the membrane and cytosol
impact of PTX, the differentiated cells were fractions were prepared as previously described
incubated with the media in the absence or (23). Briefly, the cells were dissociated
presence of 100 ng/ml PTX overnight before high mechanically in TNT buffer (50 mM Tris-HCl,
potassium stimulation. All other treatments, such 150 mM NaCl, 0.1% Triton X-100, pH 7.6)
as muscarinic antagonists, were given containing 1 mM phenylmethylsulfonyl fluoride
simultaneously with the high potassium (PMSF) and 1 x protease inhibitor cocktail
stimulation. (Sigma). Following centrifugation at 13,000 rpm
For the perfused brain slices, hippocampi for 90 min, the supernatant was collected as the
from 3 month-old GRK5+/+ and GRK5-/- mice cytosol fraction. The pellet was resuspended in
were dissected and chopped into 300 µm slices TNT-SDS buffer (50 mM Tris-HCl, 150 mM
with a McIIwain Tissue Chopper. After brief NaCl, 1% Triton X-100, 4 mM EDTA, 4% SDS,
rinsing with cold saline, the hippocampal slices pH 7.4) containing 1 mM PMSF, and 1 x protease
were transferred to normal potassium Hepes inhibitor cocktail. After centrifugation at 13,000
buffer (10.7 mM Glucose, 121 mM NaCl, 25 mM rpm for 90 min, the supernatant was collected as
NaHCO , 10 mM Hepes, 1.87 mM KCl, 1.22 mM the membrane fraction.
3
CaCl , 1.17 mM KH PO , 1.17 mM MgSO , pH The preparation of brain membrane fractions
2 2 4 4 D
o
7.4) at 37°C, continuously gassed with 95% was performed according to a protocol previously w
n
O :5%CO , and incubated for 45 min with buffer described (24), with minor modifications. In brief, lo
2 2 a
changing every 15 min. The [3H]choline the brain slices were homogenized in 9x volume ded
incorporation was then performed by incubation of pre-chilled homogenization buffer (50 mM fro
m
of the slices at 37°C for 20 min in the Hepes Tris-acetate, pH 7.4, 10% sucrose, 5 mM EDTA h
buffer containing 0.1 µM [Methyl-3H]Choline containing a freshly added protease inhibitor ttp://w
chloride (10 µCi/ml). Following washing with the cocktails of 1 mM PMSF, 20 µg/ml benzamidine, w
w
oxygenated Hepes buffer without [3H]choline, the and 20 µg/ml iodoacetamide), followed by .jb
c
slices were transferred to superfusion chambers, centrifugation at 600 x g, 4°C for 5 min to collect .o
rg
and perfused (0.5 ml/min) with the oxygenated the P1 pellet (nuclear fraction). The supernatant b/
y
Hepes buffer without [3H]choline at 37°C for 1 was centrifuged at 16,000 x g, 4°C for 30 min to g
u
e
hour. For the purpose of pre-desensitizing the collect the P2 pellet (mitochondria/microsome st o
muscarinic receptors, one set of the slices was fraction). The P2 pellet was resuspended with 9x n A
p
pmeirnf,u sfeodll owwitehd ab sya tau r2a0te md icna rwbaacshhionlg ( 1o fmf Mpe)r ffuosr io2n0 vceonlutrmifeusg oaft iiocne -caot ld9 230200 mx Mg, s4u°cCro sfeo,r f o1l5lo wmeind btoy ril 5, 2
0
with the oxygenated Hepes buffer. For high collect the P3 pellet (crude 1
9
potassium stimulation, the isosmotic Hepes buffer membrane/synaptosomes fraction). The pellets
containing 24 mM potassium was used. In were then lysed with boiling denaturing lysate
addition, 1 µM Eserine was used along with all buffer (1% SDS, 1 mM sodium orthovanadate, 10
treatments, including normal control, high mM Tris-Cl, pH 7.4), supplemented with
potassium, and M2 antagonist treatments, to phosphatase (BioMol, Plymouth Meeting, PA)
prevent hydrolysis of the released ACh (21). and protease inhibitor mixtures (Roche
Perfusion samples were collected every 2 min, Diagnostics) for routine preparation of Western
with 3 fractions before treatment for baseline and blot.
6 fractions after treatment. At the end of the Western blotting analyses: For the cells,
sample collection, the hippocampal slices were differentiated, or otherwise stated separately, cells
lysed, with an aliquot for protein quantification at ~70% confluence were lysed with the boiling
and the rest for remaining radioactivity denaturing lysate buffer. For the mice, at
determination. The radioactivity for all samples euthanasia, cold PBS-perfused brains were
was determined by scintillation counting. dissected to obtain hippocampus. Except for the
cellular fraction preparation, which is described
4
above, all other protein extract preparation, total MCS2 of pVITRO1 vector and then inserted
protein content determination, Western blotting, bovine dnGRK5 cDNA tagged on its C-terminal
and semi-quantitative analyses were performed as with GFP into MSC1 of the multigenic expression
previously described (5,19,25). The only vector (Fig. 1A). In parallel, the wtGRK5GFP or
exception was the dilution rates for the different GFP alone were inserted to the MSC1 of
primary antibodies (Abs), which include pVITRO1, and were used as controls. After
synaptophysin (Sigma, St. Louis, MO; 1:400), transfection, selected stable lines expressing
synapsin-IIa (BD Biosciences, San Jose, CA; GFP/M2, dnGRK5GFP/M2 and wtGRK5GFP/M2
1:5,000), synaptotagmin (BD Biosciences, (for easier description, these cell lines will be
1:1,000), SNAP-25 (BD Biosciences, 1:1,000), abbreviated as GFP, dnGRK5, and wtGRK5,
neuronal growth associated protein-43 (GAP-43, respectively) were examined using semi-
Sigma, 1:500), M1 and M4 (Santa Cruz quantitative RT-PCR, Western blots and
Biotechnology, Santa Cruz, CA; 1:200), M2 immunocytochemistry (ICC). The RT-PCR result
(Santa Cruz Biotechnology; 1:100), acetylcholine revealed that the mRNA levels of exogenous
esterase (AChE, Santa Cruz Biotechnology; bovine dnGRK5 and wtGRK5 were similar while
1:500), choline acetyltransferase (ChAT, the intrinsic murine GRK5 mRNA level in the
Chemicon, Temecula, CA; 1:800), high affinity dnGRK5 transfected cells was 24% higher than
choline transporter (HACT, Chemicon, 1:4,000), that in the wtGRK5 transfected cells. As a result,
D
o
vesicular acetylcholine transporter (VAChT, Santa the expression levels of dnGRK5 and wtGRK5 w
n
Cruz Biotechnology; 1:200), hrGFP (Stratagene, were approximately 3.3- and 4.1-fold higher, lo
a
d
La Jolla, CA; 1:5,000), and β-actin (Sigma, respectively, than intrinsic murine GRK5 level in ed
1:2,500). their corresponding cell lines (Fig. 1B). Western fro
m
Immunocytochemistry (ICC): Cells seeded blot data confirmed that the exogenous h
ttp
onto poly-L-lysine-coated round cover-slips at a dnGRK5GFP and wtGRK5GFP, as well as M2R, ://w
density of 1 x 104/well were fixed with pre-chilled were expressed in similar levels in their w
w
(4°C) 5% acetic acid in methanol for 45 min at corresponding cell lines. Meanwhile, expression .jb
c
4°C, followed by washing blocking and staining of other intrinsic cholinergic markers of interest, .o
rg
with specific Abs, as previously described (25,26). such as ChAT, HACT, M1R and M4R, were also b/
y
Statistics: Quantitative data are expressed as found to be similar among the three cell lines (Fig. g
u
e
mean ± S.E. and analyzed by ANOVA using 1C). Microscopic observation further confirmed st o
SPSS 11.0. Post-hoc comparisons of means were the primary cell membrane localization of both n A
ampapdreo purisaitneg. Scheffe’s or Tukey’s method where dwnhGerReK G5RGKF5P parnidm awritlGy RloKc5aGlizFePs f(u1)s,i own hpicrho teisi nisn, pril 5, 2
0
contrast to the cytosolic localization of the GFP 1
9
RESULTS (Fig. 2A, D, G). In addition, ICC with an antibody
HT22 cells are immortalized murine against M2R revealed a distribution of particle-
hippocampal neuronal precursor cells. We have like M2R immunoreactivity from the peri-nuclear
recently found that the differentiated HT22 region all the way to the axon terminals (Fig. 2B,
neurons possess functional cholinergic neuronal E, H), which is consistent with the known
properties (22). In order to investigate impact of cytosolic synthesis and nerve terminal distribution
GRK5 deficiency on desensitization of muscarinic of M2R due to axonal transport (27,28). In
receptors, we established an in vitro model in particular, at axonal terminals, the M2R
HT22 cells by stable transfection of K215R immunoreactivity was found to be colocalized
mutant dnGRK5. Over-expression of the dnGRK5 with dnGRK5GFP or wtGRK5GFP (Fig. 2C, F, I).
has been previously used to inhibit endogenous These results suggest that while the GFP,
GRK5 so as to resemble GRK5 deficiency in vitro dnGRK5 and wtGRK5 cell lines have different
(16). As detailed in the Experimental Procedures, (normal, decreased, and increased, respectively)
due to very low intrinsic M2R expression in HT22 GRK5 functional status, their cholinergic
cells, we inserted human M2R cDNA into the properties are comparable, and therefore are
5
appropriate in vitro models for studying impact of M2 and M4 in the dnGRK5 cells and the lower
GRK5 hypofunction on muscarinic membrane M2 and M4 in the wtGRK5 cells.
neurotransmission. Taken together, these results suggest that over-
After thei n vitro models were established, expression of dnGRK5 impaired the agonist-
we examined high K+-evoked ACh release from induced internalization of M2 and M4, but not M1
these cell lines. We found that dnGRK5 and receptors, while over-expression of wtGRK5 had
wtGRK5 had opposite effects on [3H]ACh release the opposite effects.
(Fig. 3A), with the former significantly decreased Comparison of in vitro and in vivo assays
(p<0.05) and the latter significantly increased demonstrate clearly that selectivity of GRK-
(p<0.05) compared to the GFP control cells. When regulation of GPCR substrates is a function of
these cells were pretreated with a G-protein specific cellular contexts (29). Therefore, to
i
activation inhibitor, PTX (100 ng/ml), all three validate the physiological relevance of our in vitro
cell lines showed several fold increase in ACh findings, we also performed experiments in an ex
release (Fig. 3B, p<0.001 for all three as vivo setting, using acute hippocampal slice
compared to their corresponding vehicles), but the cultures from young adult GRK5KO mice. First,
absolute differences among the three cell lines hippocampal tissues from female GRK5KO and
disappeared. In addition to PTX, treatment with a WT littermates were used for Western blotting
non-selective muscarinic antagonist, atropine (1 analyses to determine whether levels of
D
o
µM), and a selective M2/M4R antagonist, cholinergic and synaptic markers in these animals w
n
methoctramine (MT, 100 nM), each resulted in are compatible. The examined molecules included lo
a
d
significantly increased ACh release, and also ChAT, AChE, HACT, VAChT, M1R, M2R, ed
eliminated the differences among the three cell M4R, synaptophysin, synapsin II, synaptotagmin, fro
m
lines (Fig. 3C & D). These results suggest that the SNAP-25, and GAP-43. Unlike the decreased h
ttp
functional difference of GRK5 in these three cell levels of some of these markers that we have ://w
lines leads to altered ACh release, which is reported in aged GRK5KO mice (5), young w
w
mediated by an altered function of PTX-sensitive GRK5KO mice displayed comparable levels of .jb
c
G protein-coupled muscarinic M2 and/or M4 both cholinergic and synaptic markers as .o
rg
receptors. compared to WT littermates (Fig. 5). This data b/
y
To determine the impact of GRK5 function on suggests that the hippocampal cholinergic system g
u
e
internalization of mAChRs, we exposed the cells in 3-month old GRK5KO mice is normal at the st o
to a saturating concentration of oxotremorine structural level, and cross-strain comparisons can n A
p
(moMxo)- Mf,o ra 2no0n -mseilneucttievse, manudsc atrhineinc aegxoanmisitn, e5d bche olminaedreg icd irefucntlcyt ioton minedaespueren ddeinftf eroefn cegsr osins ril 5, 2
0
membrane retention of M1, M2 and M4 receptors structural alterations. 1
9
by Western blot. We found that after oxo-M To determine cholinergic function, we used
stimulation, M1 receptor remaining on the high K+-evoked [3H]Ach release from
membrane in the GFP, dnGRK5 and wtGRK5 hippocampal slices. We found that the ACh
HT22 cells was equivalent (Fig. 4A & B). release from GRK5KO hippocampal slices was
However, the remaining membrane M2 and M4 approximately 40% lower than from WT slices
receptors were significantly higher in the dnGRK5 (p<0.05), and that the M2/M4R antagonist
cells (p<0.01 for both M2 and M4), but lower in methoctramine (20 nM) not only increased ACh
the wtGRK5 cells (p<0.001 for M2 and p<0.05 for release from both the WT and GRK5KO, but also
M4), as compared to those in the GFP cells. In fully corrected the difference between GRK5KO
addition, we also found that following oxo-M and WT (Fig. 6A). Moreover, when the
stimulation, cytosolic (internalized) M2 and M4, hippocampal slices were pretreated with a
but not M1, were lower in the dnGRK5 cells and saturating concentration of the non-selective
higher in the wtGRK5 cells as compared to those muscarinic agonist carbachol (1mM), we found
in the GFP cells (data not shown), which is that the difference in high K+-evoked [3H]Ach
consistent with the higher membrane retention of release between the WT and GRK5KO became
6
more dramatic (p<0.01), due to increased ACh same mechanism (promoting receptor association
release from the WT but not from the GRK5 with β-arrestin proteins) (Kohout 2003; Premont
knockout tissue. When co-perfused with 20 nM 2007), we used agonist-stimulated receptor
methoctramine, high K+ evoked ACh release from internalization as a surrogate measure for GRK-
the WT slices did not increase further compared to mediated receptor desensitization.
K+ alone, but the ACh release from GRK5KO This study utilized an in vitro model, HT22
increased significantly compared to K+ alone, to cholinergic neurons that over-express kinase-
the level equivalent to that in the K+-treated WT inactive dnGRK5, and an ex vivo model,
(Fig. 6A). In addition to ACh release, we also hippocampal slices from GRK5KO mice, to
examined the total [3H]choline uptake by the WT mimic functional GRK5 deficiency, and
and GRK5KO hippocampal slices, and we found investigated effects of the GRK5 deficiency on
no difference between them (Fig. 6B), suggesting ACh release and desensitization of M1, M2 and
that the difference in ACh release between the WT M4 muscarinic receptors. In the in vitro model,
and GRK5KO cannot be attributed to an alteration the K215R dnGRK5 was over-expressed to
of choline reuptake activity. Because hippocampal compete with the intrinsic GRK5, to create a
M2/M4 receptors are primarily presynaptic functional GRK5 deficiency (16). As a result, this
autoreceptors that inhibit ACh release (12,13), functional GRK5 deficiency led to reduced ACh
these results suggest that the GRK5 deficiency release, which could be corrected by preventing D
o
leads to a significant reduction of hippocampal muscarinic receptor activation of Gi/Go proteins w
n
ACh release through an impaired desensitization (PTX), and by antagonizing all muscarinic lo
a
d
of M2 and/or M4 receptors. receptors (atropine) or just M2/M4 receptors ed
To further investigate the effect of GRK5 on (methoctramine). Moreover, the GRK5 deficiency fro
m
mAChRs in vivo, we also examined membrane also resulted in an impaired internalization of M2 h
ttp
retention of M1, M2 and M4 receptors after and M4, but not M1 receptors, in response to ://w
treatment with a saturating dose of carbachol in saturating treatment with the non-selective w
w
hippocampal slices. After treatment with 1 mM muscarining agonist oxotremorine-M. It is known .jb
c
carbachol for 20 minutes, the slices were that M2R and M4R function as presynaptic .o
rg
fractionated to obtain P1 (nuclear), P2 autoreceptors in hippocampal cholinergic neurons, b/
y
(mitochondria and microsomes), and P3 (crude to inhibit ACh release (12,13). In addition, g
u
e
membrane) pellet fractions. Western blots activation of these receptors leads to the receptor st o
revealed that there were no differences for either desensitization and internalization by either GRKs n A
p
PG1R Ka5nKd OP i3n afrnayc tcioasness , bbeuttw teheant tthhee mWemTb raannde oinrt eortnhaelirz aktiinoans eosf (M1,22/)M. 4TRh eirne ftohree ,d tnhGeR iKm5p acierlelds ril 5, 2
0
fraction (P3) showed significantly more retention indicates that a sufficient amount of fully 1
9
in the GRK5KO for M2R (p<0.001, as compared functional GRK5 is essential for the
to the WT) and M4R (p<0.05, as compared to the desensitization and internalization of M2/M4
WT), but not for M1R (Fig. 7A-D). These results receptors in these cells. Taken together, these in
suggest that the GRK5 deficiency in vivo robustly vitro results suggest that the functional GRK5
impairs the internalization of M2R and to a deficiency in the HT22 hippocampal cholinergic
slightly lesser extentaffects M4R, but has no effect neuronal model leads to decreased ACh release
on M1 receptor. through a selective impairment of M2/M4 receptor
desensitization/internalization.
DISCUSSION Based on the in vitro findings, we went further
to determine effects of the GRK5 deficiency on
Since GRK-mediated phosphorylation of a ACh release and desensitization of M1, M2 and
receptor leads both to receptor desensitization M4 receptors in an ex vivo model, hippocampal
(uncoupling from G protein activation) and to slices from GRK5KO mice. Aged GRK5KO mice
receptor sequestration (internalization from the displayed mild cholinergic and synaptic
cell surface into endosomal vesicles) through the degenerative changes (5). Therefore, without
7
correction of their structural abnormalities, it is observed that the aged GRK5KO mice displayed
impropriate to direct compare the cholinergic mild cholinergic and synaptic degenerative
functional difference between aged WT and changes (5). In this study, we showed that the
GRK5KO mice. In the three month-old GRK5KO hippocampal cholinergic hypofunction can occur
mice, however, our characterization indicates that without obvious structural degenerative changes,
these young adults had normal levels of and this hippocampal cholinergic hypofunction
cholinergic and synaptic markers as compared to without structural degeneration in young mice
age-matched WT animals, and therefore these precedes hypofunction with structural
younger mice are suitable for direct comparison of degeneration in aged GRK5KO mice. Therefore, it
cholinergic functions. Using the hippocampal raises the question of whether the latter is a direct
slices from these young animals, we found a consequence of the former.
significant reduction in ACh release in response to We have previously shown that GRK5
high K+-stimulation in the GRK5KO mice. deficiency is associated with soluble Aβ
Consistent with the in vitro findings, the reduced accumulation in AD (3 Suo, 2005, S2-291). Now
ACh release was fully corrected by the M2/M4 we find that the hippocampal cholinergic
receptor antagonist, methoctramine. In parallel, hypofunction directly results from GRK5
we desensitized the muscarinic receptors with a deficiency. Moreover, the hippocampal
saturating dose of carbachol before high K+- cholinergic hypofunction in the GRK5KO mice D
o
stimulation, and ound that WT slices released can be corrected by a selective M2/M4 antagonist, w
n
significantly more ACh (due to reduced indicating that resynaptic M2/M4 autoreceptors lo
a
d
autoreceptor inhibition of release) but that the may be valuable therapeutic targets in AD, at least ed
inhibited ACh release in the GRK5KO mice in the sense of combating the cholinergic fro
m
remained (consistent with undesensitized hypofunction in AD. h
ttp
autoreceptors). Again, the difference between the Among the FDA-approved AD medications ://w
WT and GRK5KO was corrected by are mainly cholinesterase inhibitors (CIs) that aim w
w
methoctramine treatment. Furthermore, when the at halting the ACh degradation at the synaptic .jb
c
carbachol-desensitized slices were fractionated, clefts. While the CIs are expected to increase the .o
rg
we found retention of membrane M2R and ACh concentration at synaptic clefts and enhance b/
y
membrane M4R in the GRK5KO samples the postsynaptic cholinergic activities, the g
u
e
compared to WT samples, consistent with a failure increased ACh should also act on presynaptic st o
to internalize after receptor activation. These autoreceptors to inhibit further ACh release. The n A
p
rdeesfuicltise ntcoyg estheeler ctsitvreolnyg lyim spuagirgse stM t2h aat nGd RMK54 ldartatemr aetifcfaecllty, aes ndheamncoends trainte dt hine tphirse ssetnucdey , oisf ril 5, 2
0
receptor desensitization/internalization both in functional GRK5 deficiency, as in AD. The 1
9
vitro and in vivo, and the consequence of this sustained presynaptic inhibitory effect may lead to
impaired desensitization of presynaptic M2/M4 an opposite consequence to what the CIs were
receptors is the prolonged inhibitory M2/M4 originally designed for, and could have adverse
receptor signaling, which leads to reduced ACh effects on patients in long term, especially if
release and an overall hippocampal cholinergic functional cholinergic deficiency can lead to later
hypofunction. cholinergic degeneration. Therefore, further
Cholinergic hypofunction is one of the key studies are warranted to clarify whether CI drugs
neurochemical changes in AD. It is worth noting indeed exacerbate presynaptic M2/M4
that the "cholinergic hypofunction" conventionally hyperactivity and lead to a sustained inhibition of
refers to reduced cholinergic activity associated ACh release, and whether addition of an M2/M4
with cholinergic neuronal degeneration or receptor antagonist in addition to the CIs gives an
postsynaptic M1 and nicotinic degenerative improved outcome for combating the cholinergic
changes (14). Here we show a clear presynaptic hypofunction in AD.
cholinergic hypofunction in the absence of
degenerative changes. We have previously
8
References
1. Kohout, T. A., and Lefkowitz, R. J. (2003) Mol Pharmacol 63, 9-18
2. Pitcher, J. A., Freedman, N. J., and Lefkowitz, R. J. (1998) Annu Rev Biochem 67, 653-692
3. Suo, Z., Wu, M., Citron, B. A., Wong, G. T., and Festoff, B. W. (2004) J Neurosci 24, 3444-3452
4. Suo, Z., Wu, M., Citron, B. A., Wong, G. T., and Festoff, B. W. (2005) Neurobiol Aging 25, S2-
291
5. Suo, Z., Cox, A. A., Bartelli, N., Rasul, I., Festoff, B. W., Premont, R. T., and Arendash, G. W.
(2007) Neurobiol Aging 28, 1873-1888
6. Li, L., Liu, J., and Suo, W. Z. (2008) J Neuroinflammation 5, 24
7. Jaber, M., Koch, W. J., Rockman, H., Smith, B., Bond, R. A., Sulik, K. K., Ross, J., Jr.,
Lefkowitz, R. J., Caron, M. G., and Giros, B. (1996) Proc Natl Acad Sci U S A 93, 12974-12979
8. Gainetdinov, R. R., Bohn, L. M., Sotnikova, T. D., Cyr, M., Laakso, A., Macrae, A. D., Torres,
G. E., Kim, K. M., Lefkowitz, R. J., Caron, M. G., and Premont, R. T. (2003) Neuron 38, 291-
303
9. Gainetdinov, R. R., Bohn, L. M., Walker, J. K., Laporte, S. A., Macrae, A. D., Caron, M. G.,
Lefkowitz, R. J., and Premont, R. T. (1999) Neuron 24, 1029-1036 D
o
10. Walker, J. K., Gainetdinov, R. R., Feldman, D. S., McFawn, P. K., Caron, M. G., Lefkowitz, R. w
n
J., Premont, R. T., and Fisher, J. T. (2004) Am J Physiol Lung Cell Mol Physiol 286, L312-319 lo
a
d
11. Matsui, M., Yamada, S., Oki, T., Manabe, T., Taketo, M. M., and Ehlert, F. J. (2004) Life Sci 75, ed
2971-2981 fro
m
12. Levey, A. I. (1996) Proc Natl Acad Sci U S A 93, 13541-13546 h
ttp
13. Zhang, W., Basile, A. S., Gomeza, J., Volpicelli, L. A., Levey, A. I., and Wess, J. (2002) J ://w
Neurosci 22, 1709-1717 w
w
14. Terry, A. V., Jr., and Buccafusco, J. J. (2003) J Pharmacol Exp Ther 306, 821-827 .jb
c
15. Wess, J. (2004) Annu Rev Pharmacol Toxicol 44, 423-450 .o
rg
16. Pitcher, J. A., Fredericks, Z. L., Stone, W. C., Premont, R. T., Stoffel, R. H., Koch, W. J., and b/
y
Lefkowitz, R. J. (1996) J Biol Chem 271, 24907-24913 g
u
e
17. Li, Y., Maher, P., and Schubert, D. (1997) Neuron 19, 453-463 st o
n
18. Li, Y., Maher, P., and Schubert, D. (1998) Proc Natl Acad Sci U S A 95, 7748-7753 A
p
19. Suo, Z., Wu, M., Citron, B. A., Palazzo, R. E., and Festoff, B. W. (2003) J Biol Chem 278, ril 5
37681-37689 , 2
0
20. Pittel, Z., Heldman, E., Rubinstein, R., and Cohen, S. (1990) J Neurochem 55, 665-672 1
9
21. Gifford, A. N., Bruneus, M., Gatley, S. J., Lan, R., Makriyannis, A., and Volkow, N. D. (1999) J
Pharmacol Exp Ther 288, 478-483
22. Liu, J., Li, L., and Suo, W. Z. (2008) Life Sci, in press
23. Li, L., Rasul, I., Liu, J., Zhao, B., Tang, R., Premont, R. T., and Suo, W. Z. (2008) Brain Res
Bull, in press
24. Rogers, S. W., Hughes, T. E., Hollmann, M., Gasic, G. P., Deneris, E. S., and Heinemann, S.
(1991) J Neurosci 11, 2713-2724
25. Suo, Z., Wu, M., Citron, B. A., Gao, C., and Festoff, B. W. (2003) J Biol Chem 278, 31177-
31183
26. Suo, Z., Wu, M., Ameenuddin, S., Anderson, H. E., Zoloty, J. E., Citron, B. A., Andrade-Gordon,
P., and Festoff, B. W. (2002) J Neurochem 80, 655-666
27. Guidry, G., Willison, B. D., Blakely, R. D., Landis, S. C., and Habecker, B. A. (2005) Auton
Neurosci 123, 54-61
28. Amadeo, A., Arcelli, P., Spreafico, R., and De Biasi, S. (1995) Neurosci Lett 184, 161-164
29. Premont, R. T., and Gainetdinov, R. R. (2007) Annu Rev Physiol 69, 511-534
9
Acknowledgements:
This study was supported by grants to WZS from the Medical Research and Development
Service, Department of Veterans Affairs, the American Federation for Aging Research, and resources
from the Midwest Biomedical Research Foundation. In addition, we sincerely thank Dr. Robert J.
Lefkowitz at Duke University for providing the original GRK5KO mouse breeding pairs, consultations
and review of this manuscript.
Figure Legends:
Fig. 1. Construction and expression of dnGRK5GFP and M2 in HT22 cells. (A) Schematic
illustration of the plasmids that contain hrGFP, bovine dnGRK5GFP or wtGRK5GFP cDNA inserts at
MCS1 and M2 cDNA at MCS2 of pVITRO1. (B) Semi-quantitative RT-PCR and Western blot
characterization of dnGRK5GFP and wtGRK5GFP expression in the HT22 cells stably transfected with
pVITRO1-GFP-M2, pVITRO1-dnGRK5GFP-M2, and pVITRO1-wtGRK5GFP-M2 (abbreviated as GFP,
DN and WT, respectively). bGRK5 refers to exogenous bovine GRK5; mGRK5 refers to intrinsic murine
GRK5. GAPDH was used as an internal reference for RT-PCR. (C) Western blot characterization of
cholinergic markers (ChAT, HACT, M1, M2, and M4), in the GFP, dnGRK5, and wtGRK5 transfected
D
o
cells. Actin was used as an internal control. w
n
lo
a
d
Fig. 2. Membrane localization of GRK5GFP fusion proteins and their colocalization with ed
M2 at synaptic terminals. (A), (D), and (G), representative images of the expression and subcellular fro
m
distribution of GFP, dnGRK5GFP and wtGRK5GFP fusions in the GFP, dnGRK5, and wtGRK5 cell h
ttp
lines, respectively. (B), (E), and (H), representative images of ICC staining with antibody to M2 (red) in ://w
the GFP, dnGRK5, and wtGRK5 cell lines, respectively. (C), (F), and (I), merged panels for GFP imaging w
w
and M2 ICC staining in the GFP, dnGRK5, and wtGRK5 cell lines, respectively. The inserts in the panels .jb
c
(C), (F), and (I) show the high power views of the overlap of GFP imaging and M2 ICC staining at .o
rg
synaptic terminals as indicated by the arrowheads. DAPI (blue) stains all nuclei. Scale bar in (A) is for all b/
y
panels, 30 µM. g
u
e
s
t o
Fig. 3. Effects of PTX and muscarinic antagonists on high potassium-evoked [3H]ACh n A
rdenlGeaRsKe 5f,r aonmd wthteG RGKR5K c5e ldlse. fAic iseinntg lHe Top2t2im caell lcso. n(cAen),t rahtiigohn Kof+ -peovtoaksseidu m[3 H(5]0A CmhM r)e wleaass eu sined thtoe eGvoFkPe, pril 5, 2
the [3H]ACh release. n≥3. * P<0.05, as compared to the GFP cells. (B), (C), and (D) show the effects of 01
9
PTX (100 ng/ml), atropine (1 µM), and MT (100 nM) on the ACh release in the GFP, dnGRK5, and
wtGRK5 cells, respectively. **P<0.001, as compared to the potassium-alone treated vehicles.
Fig. 4. Membrane retention of M1, M2, and M4 receptors in the GRK5 deficient HT22 cells.
The dnGRK5 cells, along with the GFP and wtGRK5 control cells, were treated with a saturation
concentration of oxo-M (5 mM) before the membrane proteins were separated for Western blotting
analysis. (A), representative Western blots for M1, M2, and M4 receptors in the membrane fraction in the
presence and absence of the saturated oxo-M challenge. (B), the semi-quantification of the Western
blotting results. The data was expressed as the percentage of the receptors remained in the membrane
after the oxo-M treatment (the treated divided by the untreated). n≥3. Separate one-way ANOVA for M1,
M2, and M4, respectively, revealed significant membrane retention of M2 and M4 (p<0.01 for both), but
not M1, in the GRK5 deficient dnGRK5 cells. In the contrast, the wtGRK5-overexpressing cells
displayed significant less membrane retention of M2 (p<0.001) and M4 (p<0.05), but not M1, as
compared to the GFP control cells. *p<0.05, **p<0.01, and p<0.001, as compared to the corresponding
GFP controls.
10