Graded or threshold response of the tet-controlled gene expression: all depends on the concentration of the transactivator.

1.2 MB·English

by  Heinz, Niels

Heinzetal.BMCBiotechnology2013,13:5
http://www.biomedcentral.com/1472-6750/13/5
METHODOLOGY ARTICLE Open Access
Graded or threshold response of the
tet-controlled gene expression: all depends on
the concentration of the transactivator
Niels Heinz1,2, Katharina Hennig1 and Rainer Loew1*
Abstract
Background: Currently, the step-wise integration of tet-dependent transactivatorand tet-responsive expression unit
is considered to be themost promising tool to achieve stable tet-controlled gene expression incell populations.
However, disadvantages of this strategy for integration intoprimary cells led us to develop an “All-In-One”vector
system, enablingsimultaneous integration of both components.The effecton tet-controlled gene expression was
analyzed for retroviral “All-In-One” vectors expressing the M2-transactivator either under control of a constitutive or
a new type ofautoregulated promoter.
Results: Determination ofluciferase activity intransducedcell populations indicated improvementof the dynamic
range of gene expression for the autoregulated system.Further differenceswere observed regardinginduction
kinetics and dose–response. Most notably, introduction of the autoregulated system resulted ina threshold mode
ofinduction, whereas theconstitutive system exhibited pronounced effector-dose dependence.
Conclusion: Tet-regulated gene expression in theapplied autoregulated system resembles a threshold mode,
whereby full inductionof the tet-unit can be achievedatotherwise limiting doxycycline concentrations.
Keywords: Tet-controlled gene expression, Transactivator concentration, Thresholdresponse, Self-contained,
Autoregulated
Background rtTA2s-M2 and rtTA-3 [1-4] in the Tet-on system.
The most commonly applied gene regulation system is Stable tet-controlled gene expression requires the trans-
the tetracycline inducible gene expression (tet-) system, fer of both (r)TA and TRP into the target cell. Their
originally described by Gossen and Bujard [1]. It allows step-wise integration/selection ensures independence of
effector dose-dependent regulation and consists of two the constitutive transactivator expression unit from the
components, a tetracycline controlled transactivator TRP driven regulated gene expression, thereby enabling
(tTA) and a tet-responsive promoter (TRP) regulating the selection of highly regulated clones. However, this
the gene of interest. The transactivator binds with high strategycannot successfullybeappliedtosystemswhere
affinity to the tetR-moiety of the TRP, a minimal pro- clonal selection is difficult or undesirable e.g. primary
moter physically linked to the tet-operator sequence. cells. To overcome this hurdle, so called “One-vector”
Two transactivator variants have been developed, differ- systems were developed that allow for simultaneous in-
ing primarily in their response to the effector molecule tegration of both components. These technologies have
tetracycline. In the Tet-off system, the tTA is released mostly been explored in the field of gene therapy, where
fromitsDNAbindingsiteinthepresenceofdoxycycline primarycellsare the major target. Almostall approaches
(Dox), a tetracycline derivative, thus abolishing gene werebasedoneitherretroviralorlentiviralvectors,since
they allow for highly-efficient and stable integration of
DNA into the host genome. Regarding the mode of
transactivator expression, two systems have been ap-
*Correspondence:[email protected]
plied. Transactivator expression is controlled by a con-
1EUFETSGmbH,Idar-Oberstein55743,Germany
Fulllistofauthorinformationisavailableattheendofthearticle stitutive promoter in self-contained vectors (Figure 1A)
©2013Nielsetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Heinzetal.BMCBiotechnology2013,13:5 Page2of12
http://www.biomedcentral.com/1472-6750/13/5
vectors were constructed as illustrated in Figure 1B. Al-
though proof of concept has been demonstrated for
autoregulated bidirectional TRP [19], only moderate in-
duction rates were achieved. Applying bidirectional lenti-
viral vectors of the self-contained type [28,29] resulted in
a dynamic gene induction range of around 50-100-fold.
Only one such approach has been reported for retroviral
vectors[27],whereapplicationofimprovedTRPsresulted
inanexcellentdynamicrangeofmorethan1000-fold.
In this study, we combined the key benefits of the
self-contained and the autoregulated system with a bi-
directional vector design. The two vectors explored in
Figure1Regulatoryprinciplesofretroviral“One-vector“ this study differed regarding their mode of transacti-
systems.(A)Unidirectionalprovirustransferringa“self-contained“ vator expression. In the “self-contained” MOV-scT6
One-vectorsystem.Thetet-responsivepromoter(TetO7:tet-operator vector, M2 transactivator expression is under control
heptamer;PR:regulatableminimalPromoter)drivesexpressionof of the human PGK promoter [27], while in the “auto-
thegeneofinterest(gene“X“).Itsinducibilityisindicatedbythe
regulated” MOV-scT6cA vector M2 transactivator ex-
blacktriangle.Aconstitutivepromoter(P )drivesexpressionofthe
C
tet-dependenttransactivator(hereexemplifiedbytTA)ataconstant pression is driven by the newly developed synthetic
lowlevel(blackline).TheunidirectionalsystemutilizestheviralpA "cA" promoter, a weak constitutive but inducible min-
signaltoterminatebothtranscriptsandtherebygenerates imal promoter. Selected cell populations were used to
overlappingtranscripts.(B)Thebidirectionalsystemgeneratestwo
compare the regulatory properties of both vectors
distinctmRNAs,thusrequirestheinsertionofanantisense
orientated(−strand)pA-signal.(C)Unidirectionalprovirus with respect to their effector dose–response and kin-
transferringan“autoregulated“One-vectorsystem.Abicistronicunit etics of activation.
couplestheopenreadingframesofthegeneofinterestandthe
transactivatorviaaninternalribosomalentrysite(IRES).The Results
expressionofbothgenesisdrivenbytheinduciblepromoter(P).
R Designofthebidirectionalvectors
As recently shown (Loew et al., 2010), introduction of
the tet-responsive Ptet-T6 promoter (Figure 2C) into the
[5-15], while both transactivator and transgene expres- ES.1 retroviral vector (ES.1-T6) resulted in an excellent
sion is driven by the TRP in autoregulated vectors dynamic rangeofreportergeneexpressionintransduced
(Figure 1C) [10,16-20]. So far, for both vectors dose- Hela-EM2 cells, constitutively expressing the doxycycline
dependent induction, as determined by either luciferase (Dox) responsive reverse M2-transactivator. MoMuLV-
or GFP reporter gene expression, did not exceed 400- based One-Vector systems (MOV) were constructed by
fold, with best regulatory properties being observed in insertion of a bidirectional expression cassette into the
clones rather than cell populations. While in self- ES.1backbone(Figure2A).TranscriptsinitiatedatPtet-
contained vectors potential promoter crosstalk between T6 were terminated at an antisense orientated SV40-pA
constitutive promoter and TRP might be responsible for signal (3´-5´, relative to the viral vector genome), fused
the observed low dynamic range [21], in autoregulated to the constitutive transport element (cte) of simian
vectors basal expression of the inducible cassette is an retrovirus 1 [9,30]. To determine transgene expression
essential requirement for initiation of the positive feed- levels in cell pools as well as at the single cell level, the
back loop. However, autoregulated vectors were gener- dual reporter gene lmg* [31] was employed, enabling
ally favored when employing Tet-on systems, since low simultaneous determination of luciferase activity and
transactivator abundance during the ”off-state“ mini- eGFPfluorescence.
mizes potential cytotoxicity [22,23] and immunogenicity Two MOV-vectors were constructed, “self-contained”
[24-26]. Additional problems arise in “One-vector” sys- (MOV-scT6) and “autoregulated” (MOV-scT6cA), where
tems, where transgene and transactivator reside on one M2-transactivator expression was either placed under
viral backbone. Unidirectional expression of the two control of the constitutive human phosphoglycerate
components can either be achieved by construction of kinase promoter (hPGK), or a newly designed tet-
bicistronic units (autoregulation) or by overlapping tran- responsive “cA”-promoter (Figure 2B, see below). MOV
scripts employing two promoters (self-contained). In vectors also contained a shortened version of the
both cases, transcription terminates at the polyadenyla- woodchuck hepatitis virus posttranscriptional regula-
tion (pA) signal located in the 3´-LTR, and expression tory element (pre*s; Additional file 1: Figure S2). M2
levels were shown to be negatively affected [14,27]. In transcripts were terminated at the pA signal of the viral
order to overcome this obstacle, bidirectional transfer 3´-LTR.
Heinzetal.BMCBiotechnology2013,13:5 Page3of12
http://www.biomedcentral.com/1472-6750/13/5
Figure2Viralvectorsandpromoters.(A)ProvirusoftheretroviralSIN-vector,ES.1[32],withdeletedviralenhancers(U3),containsenlarged
packagingregion(psi,psi+)andpol/envfragmentharboringthenativespliceacceptor(SA).Thetet-regulatoryexpressionunitisinsertedinsense
orientation(+strand)followedbythewoodchuckhepatitisvirusposttranscriptionalregulatoryelement(WPRE,[33]).Thetet-responsivepromoter,
Ptet-T6,wasfunctionallycoupledtothedualreportergenelmg*,forsimultaneousdeterminationofluciferaseandGFPactivities.ES.1-scT6viral
vectorcontainsaninvertedtet-regulatoryexpressionunit(−strand),transcriptswereterminatedattheSV40pAsitethatwasfusedtothe
constitutivetransportelementofSRV-1(cte,[30]).TheMOVbackboneisidenticalwithES.1-scT6,butcontainedasense(+strand)insertionofthe
PGK-orcA-promoterdrivenM2transactivator[2].Thewoodchuckhepatitisvirusposttranscriptionalregulatoryelement(pre*)differsinlength
fromtheES.1version.(B)Outlineoftheweakconstitutive(“c“)buttet-inducible(“A“)cA-promoter.TheCAATboxofMoMuLVwasaddedtoa
HIV-1derivedminimalpromoter−77/+77,containing3SP-1sitesandtheTATA-box.Positionsarenumberedrelativetothetranscriptionalstart
site.(C)Thetet-responsiveminimalpromoter(Ptet)usedinthisstudy,Ptet-T6,consistsofasyntheticminimalpromoterwithconsensusTATA-
boxandTFIIBbindingsite,theCMVinitiatorelementandaTYMV5´-UTRassembledwithatet-operatorheptamerwithcore-spacingof36nt
[31].Specificrestrictionsitesareindicated.
Propertiesoftheregulatoryunitwithinmonocistronic While the presence of the constitutive promoter might
vectorsandtheself-containedbidirectionalvector directly account for the observed slight increase in back-
Foracomparativeanalysisofthetet-responsivepromoter, ground expression level, the decrease in gene induction
theTRP-unitwasinvertedwithinthemonocistronicES.1- levels might be explained by an insufficient concentration
T6 vector (excluding interference with the constitutive ofM2-transactivatorgeneratedbythePGK-promoter.
promoter (PGK)), thus resembling the orientation of the Although the dynamic range of gene regulation was
TRP-unit within the MOV-vector setting (Figure 2A, C). shown to exceed previously published One-vector sys-
Following transduction and FACS-based enrichment of tems, further improvement was necessary to obtain full
Hela-EM2 cells, activities were analyzed in the “on-/off- induction.
states”.Whilebackgroundexpressionremainedfairlycon-
stant, the inducible activity of ES.1-scT6 was found to be Table1Expressionlevelandregulatorypotentialof
decreased,resultinginanoverallreductioningeneregula- unidirectionalandbidirectionalvectors
tion by 60% (Table 1). Since the observed phenomenon On Off Induction
canbeexplainedbytheabsenceofthepre*selementfrom Construct (rlu/μg) Cells
the resulting transcript, Ptet-T6 was considered to func- (x107) (x103) (x103)
tion independent of the orientation. Subsequent insertion
ES.1-Ptet-T6 4.1±0.6 4.1±0.1 9.8±1.5 HeLa-EM2
of the PGK-M2 expression unit into the ES.1-scT6 back-
bone resulted in the “self-contained” MOV-scT6 vector ES.1-scPtet-T6 1.9±0.2 4.7±0.6 4.0±0.8 HeLa-EM2
MOV-scT6 1.2±0.01 9.2±2.0 1.3±0,3 HeLa
(Figure 2A). Determination of luciferase activity in trans-
duced Hela cell populations indicated that both, back- Luciferaseactivity(rlu/μgprotein)wasdeterminedafterenrichmentof
transducedHela-EM2cells(ES.1vectors)constitutivelyprovidingtheM2
ground expression as well as inducible activity were transactivator,orHelacells(MOV-vector)inthepresence(“on“)orabsence
negatively affected by the insertion, resulting in a reduc- (“off“)ofdoxycycline(500ng/ml).Inductionwascalculatedfromtheactivities
determinedintheonandoffstate.±valuesreflectSEM.Foreachvector,two
tionofthedynamicrange(1300-fold)byabout70%,when
populationswereestablishedbyoneroundofsorting(poolpurity>90%)and
compared to the parental ES.1-scT6 vector (4000-fold). weremeasuredtwice.
Heinzetal.BMCBiotechnology2013,13:5 Page4of12
http://www.biomedcentral.com/1472-6750/13/5
ReplacementoftheconstitutivePGK-promoterbyan
artificialinducible-promoter
To improve vector performance, we developed a minimal
promoter designed to inhibit weak constitutive as well as
inducible activity, thus introducing the autoregulated
principle into bidirectional vectors. The newly designed
cApromoter(Figure2A,Additionalfile2:FigureS1)con-
sistsofanHIV-1minimalpromoter,withlowbackground
activity in the context of aTRP [30] fused to the CAAT-
boxoftheMoMuLV-LTRpromoter.Thelatterwasshown
to be sufficient to provide residual activity of a minimal
LTR [18]. This promoter was designed (i) to minimize
crosstalk with the TRP, and (ii) to guarantee low basal
levels of M2 transactivator during the “off-state”, while
being sufficiently active to initiate the positive feedback
loop. Replacing the PGK by the cA-promoter resulted in
thegenerationofMOV-scT6cAvector(Figure2A),which
was considered to be autoregulated, providing a low con-
stitutiveactivityforM2transactivatorexpression.
Comparison of the self-contained vector MOV-scT6
and autoregulated vector MOV-scT6cA was performed
in Ht1080 cell populations transduced at low MOI and
enriched by FACS (Figure 3A, left). While cell popula-
tions derived from the autoregulated vector showed
Figure3Comparisonofself-containedandautoregulated
reduced background expression, the level of induction OneVectorSystem.(A)Determinationofluciferaseactivityof
was maintained (1.3 and 1.4×107 rlu/μg protein, respect- Ht1080cellpopulationstransducedbyeitherMOV-scT6orMOV-
ively), resulting in a 3.7-fold increase in the dynamic scT6cAandenrichedbyFACS.Theleftpanelshowstheluciferase
activitydeterminedintheon/offstateofthesystemafter
range of gene regulation. Northern analysis (Figure 3B)
transductionwithlowMOI,therightpanelaftertransductionwith
of M2 steady state mRNA levels revealed reduced levels
highMOI.Twoindependentpopulationsweregeneratedatthe
for the autoregulated vector under non-inducing condi- indicatedconditionandeachwasmeasuredtwice.Inductionwas
tions, while levels strongly increased upon induction. calculatedfromtheluciferaseactivitiesdeterminedintheon/off
Interestingly, similar yet weaker effects were found for stateandgivenabovethebars.(B)Northernblotanalysisof
representativeHt1080cellpopulationstransducedbyeitherMOV-
theself-contained vector(see below).
scT6orMOVscT6cA.TheblotwasprobedfortheM2transactivator
Increasing gene dosage (Figure 3A, right) strongly
orGAPDH.
enhancedgeneexpressionuponinduction(upto108rlu/μg),
while the dynamic range of gene regulation was reduced.
This phenomenon was observed in both vector systems. were performed to further characterize the two construc-
Based on luciferase data, a reduction in background activity tionprinciples.
couldonlybedemonstratedforcellpopulationsoftheauto- Ht1080cellpopulationstransducedbyeitherMOV-scT6
regulated vector, transduced at low MOI. This observation or MOV-scT6cA vectors were cultivated in the “off-state”,
reveals the impact of the integration site, since under this followingcellsortingforaminimumof10days.Cellswere
conditionvariationduetopositioneffectispronounced. induced for 96 hours at the indicated Dox concentrations
Furthermore,severeeffectsoncellgrowthwereobserved (Figure 4) to allow for adjustment of the steady state ex-
fortheautoregulatedvectorsystem,whencellsweretreated pression levels. Determination of luciferase activity
with high gene dosage, followed by induction (Additional (Figure 4A) revealed a similar induction response for both
file3:FigureS3).Thiseffectcanmostlikelybeattributedto vectors,wherebyfullactivationofthereportergeneexpres-
hightransactivatorabundanceandhencesquelching. sionwasdemonstratedateffectorconcentrationsofaround
300 ng Dox/ml. However, at low effector (Dox) concentra-
tions, populations transduced by MOV-scT6cA displayed
Autoregulationalteredthemodeofinducedgene reducedbackgroundactivityyetslightlyincreasedinduction
expression rates,indicatinganincreaseddynamicrangefortheautore-
As generally accepted, tet-controlled gene expression gulatedvector.
enables effector-dose dependent adjustment of transgene Further differences between the two vectors were
steady state levels. Therefore, dose–response experiments revealed by FACS-based analysis of enriched Ht1080 cell
Heinzetal.BMCBiotechnology2013,13:5 Page5of12
http://www.biomedcentral.com/1472-6750/13/5
Figure4Doseresponsekinetic.(A)LuciferaseactivityofenrichedHt1080cellpopulationstransducedwithMOV-scT6orMOV-scT6cAvectors.
Doxycyclineconcentrationswerekeptconstantforfourdaysbydailymediumexchange.Valuesrepresentdatafromtwoindependently
generatedpopulations.Allmeasurementswereaccomplishedinduplicate.(B)Onerepresentativepopulationwasusedforaparallel
determinationofGFPfluorescencebyflowcytometry.ThepercentGFP-positivecells(x-axis)aregivenwithineachblotmeasuredagainst
propidiumiodide(PI,1μg/ml)staineddeadcells(y-axis).Itshouldbenoted,thatthepurityoftheenrichedpopulationsdifferedslightly.
(C)Percentpositivecellsofthetwoindependentlygeneratedpopulations.Allmeasurementswereaccomplishedinduplicate.
populations (Figure 4B). As expected, transgene expres- differences (1 vs. 1.3) during the off-state. However, in-
sion was found to be effector dose-dependent in cells duction at 30 ng/ml Dox led to a 2.5-fold increase in M2-
transduced by the self-contained MOV-scT6 vector, with mRNA in the enriched population. Contrary to what we
considerable intermediate levels at 10–100 ng Dox/ml. observedfortheself-containedvector,analysisoftheauto-
In contrast, full induction rates were observed at already regulated MOV-scT6cA vector showed that M2-mRNA
lower effector concentrations for the autoregulated levels in the off-state were approximately doubled (0.5 vs.
MOV-scT6cA vector and further increase in effector 1.2) in the enriched population and strongly increased
(Dox) concentration resulted only in increased numbers uponinductionatlowDoxconcentration(Figure5B).Yet,
of induced cells (Figure 4C). Therefore, kinetics of the onlyasubsetofcellsoftheenrichedpopulations(25%for
autoregulated vector ratherresembledathresholdmode. MOV-scT6 and 44% for MOV-scT6cA, respectively)
According to the law of mass action, the ability to dis- exhibited induction at 30 ng/ml Dox (Figure 5A), while
play a threshold response should be dependent on the full induction could be achieved at maximum effector
abundance of the M2 transactivator during the off-state rates, 1000 ng/ml Dox (>95%). We therefore assumed,
(since it triggers the positive feed back loop) and there- that in the remaining cells at low effector concentrations
foreonthebasalactivityofthe cA-promoter.Forfurther M2transactivatorlevelsmightnotbesufficienti)tosatur-
clarification, sub-populations of the originally tested cell ate the tet-operators of the TRP or with respect to the
pools displaying high induction levels at low effector autoregulated vector ii) to trigger the positive feedback
concentrations (30 ng/ml Dox) were enriched (>95%, loop.
Figure 5A). Total RNA was prepared from the popula- Increasing the overall cellular abundance of M2 trans-
tions in the on- and off-states and analyzed by Northern activator might be an approach to overcome this obs-
blot for steady state levels of M2-mRNA. Comparison of tacle. To test this hypothesis, Hela-EM2 cells, which
the initial and enriched sub-populations for the self- provide background levels of M2-transactivator via the
contained MOV-scT6 vector revealed only minor EF1-promoter, were transduced with either MOV-scT6
Heinzetal.BMCBiotechnology2013,13:5 Page6of12
http://www.biomedcentral.com/1472-6750/13/5
Figure5Ht1080populationstransducedbyeitherMOV-scT6orMOV-scT6cAwereenrichedviaFACS.Frombothinitialpopulationsthe
fractionsofcellsinducibleat30ng/mlDox(circles)wereenrichedclosetohomogeneity.(A)Fluorescencebasedanalysisofinductionprofilesof
initialandenrichedpopulations.Thepercentageofinduciblecells(R2)atdifferentDoxconcentrationsisinsertedintotheblots.(B)Northernblot
analysisofinitial(pool)andenriched(T6+orT6cA+)populations.TotalRNAwasextractedfromcellsinducedfor96hrswith30ng/mlDoxand
analysedafterseparationon1.2%Agarose-MOPS-formaldehydegel.DetectionwasperformedwithbiotinylatedprobesagainsttheM2-
transactivatororGAPDH.Becauseofsubsequentdevelopmentoftheblots,theM2signalswerepartiallyvisibleintheblotprobedwithGAPDH.
Densitometricanalysiswasdoneonappropriatedevelopedblots(NIH1.57software),therelativevaluesobtainedforMOV-scT6cellsintheoff-
state(pool-Dox)wassetto1.ThesignalintensityoftheT6cA+couldnotbetriggeredintoalinearrangeofsignalintensity(*).
or MOV-scT6cA. Hela-EM2 pools were generated at Variations observed at single cell level indicated insuffi-
low MOI and further enriched by one round of FACS. cient M2-transactivator levels for a subset of the trans-
All cells transduced by the autoregulated vector duced cells. Since this could be overcome in systems
MOV-scT6cA showed full induction at 30 ng/ml Dox were transactivator was provided from an independent
(Figure 6). Surprisingly, a less pronounced effect could locus, basal activity of the cA-promoter rather than of
alsobedemonstratedfortheself-containedvector. theTRPhadbeenaffected attheintegration site.
Taken together, tet-regulated transgene expression was
found to resemble a threshold mode in the autoregu- Inductionkineticsofself-containedandautoregulated
lated system. Following the law of mass action, full vectors
induction rates depended on the concentrations of Sinceonlysubsetsofcellstransducedbytheautoregulated
M2-transactivator and its ligand (Dox), respectively. vector had the potential to become fully activated at low
Heinzetal.BMCBiotechnology2013,13:5 Page7of12
http://www.biomedcentral.com/1472-6750/13/5
tet-system componentsinto targetcells.However, achiev-
ing tight control in “One-vector systems” has remained a
challenge, as the dynamic range of gene expression was
found to be hampered by high background and/or low
transgene expression. In this study, we report on the de-
sign of a new MoMuLV-based One-vector system, with
promisingfeatures.Firstly,openreadingframesofthetwo
components were expressed bidirectionally. Overlapping
transcriptscanthusbeavoided,asthesemightreduceex-
pression levels and negatively effect the dynamic range of
tet-regulatedgeneexpression[20,27,29].Secondly,expres-
sion of the M2-transactivator was driven by the newly
designed “cA” promoter, which exhibited weak basal as
well as inducible activity. Results obtained from Ht1080
cellpopulationstransducedwitheitherthenewlydesigned
autoregulated vector, MOV-scT6cA, or the self-contained
vector, MOV-scT6, demonstrate the superiority of the
Figure6Hela-EM2cellstransducedandenrichedbyFACS.Cells
developed One-vector system (Figure 3). While both vec-
wereinducedfor96hrswiththeindicatedDoxconcentrations.The
torsshowedhighinducibleexpression,basedonluciferase
percentofGFPpositivecellswasinsertedintotheblots.
activity(bulkassay),thedynamicrangeofgeneregulation
intheautoregulatedMOV-scT6cAvectorwasfoundtobe
Doxconcentrations,especiallyafterenrichment(Figure6), increased by3.7-fold as compared withthe self-contained
populationsgeneratedwiththeself-containedvectorwere MOV-scT6 vector (4.8×103 vs. 1.3×103-fold). This im-
thought to display a different induction kinetic. Trans- provementwaslargelyduetothereducedbackgroundac-
duced Ht1080 populations were cultured in saturating tivity in the autoregulated MOV-scT6cA vector. Our
Dox concentrations (1000 ng/ml) for different time peri- resultsfurthersuggestthatpromoterinterference[21]be-
ods and Luciferase activity was analyzed. As expected, tween the tet-responsive Ptet-T6 and cA-promoter was
populations of the self-contained MOV-scT6 vector dis- reduced compared to the combination of Ptet-T6 and
playedfasterinductionkinetics,beforetheyfinallyreached PGK-promoter and that a selection for integration sites
a steady state level (Figure 7A). This finding was further promoting basal activity of theTRP/cA-promoter did not
supportedbyGFPfluorescenceanalysisat single celllevel occur.Theseobservationsareinaccordancewiththefind-
(Figure7B).MOV-scT6transducedcellsmigrated as total ings of Lindemann and co-workers [18], who reported
population starting about 2 hours following induction, best results for an autoregulated MoMuLV-based system
reaching a maximum of GFP accumulation within 24–48 withrespecttoexpressionlevelsandregulatoryproperties
hours. In contrast, only a subset of MOV-scT6cA trans- in vitro and in vivo, when transactivator expression was
duced cells showed a fast response upon induction, while driven by an enhancer-deleted LTR. Functionality of the
themajorityofcellsremainedatthebackgroundlevel,in- cA-promoterdesignwasfurtherdemonstratedbyanalysis
dicatingtemporalcontrolofthepositivefeedbackloop. oftheM2-mRNAsteadystatelevelintheabsenceofDox,
This important difference is further illustrated in revealing a50%reductioncomparedtothePGK-promoter
Figure 7C. While about 60% of the cells transduced by (Figure 5B). Infection of cell populations at increasing
the self-contained MOV-scT6 vector showed clear in- MOIs led to enhanced expression levels of the dual re-
duction after about 4 hours, only about 10% ofthe popu- porter gene lmg*, demonstrating an increase in gene
lation transduced by the autoregulated MOV-scT6cA dosage.However,athighMOI(≥1),cellpopulationstrans-
vectordisplayedafastresponse.Duringfurtherinduction, duced by MOV-scT6cA displayed strong growth retard-
thepercentageofinducedcellsincreasedonlyslowlycom- ation under inducing conditions (Additional file 3: Figure
pared totherapid activationof allcellstransducedby the S3), suggesting massive accumulation of M2-transactivator
self-contained MOV-scT6 vector, suggesting involvement to levels that caused squelching [23,34,35]. The moderate
of particular cellular events, which influence the chromo- growth retardation observed in cells transduced by MOV-
somal environment and thereby the activity of the TRP/ scT6 might be explained by exhaustion of other essential
cApromoter. cellcomponents,e.g.aminoacidsornucleotides,sincehere
expression levels of the dual reporter gene lmg* went into
Discussion extremes(>4×107rlu/μgprotein).
Since the mid 90‘s, numerous studies have explored Asexpected,thedose–responseanalysisofthetwovec-
strategiesfor simultaneous (andreliable)transferof both tor types, self-contained (MOV-scT6) and autoregulated
Heinzetal.BMCBiotechnology2013,13:5 Page8of12
http://www.biomedcentral.com/1472-6750/13/5
Figure7InductionkineticsofMOV-scT6andMOV-scT6cA.(A)LuciferaseactivityofenrichedHt1080cellpopulationstransducedwithMOV-
T6scorMOV-scT6cAvectors.Doxycyclineconcentration(1000ng/ml)waskeptconstantduringtheexperimentbydailymediumexchange.
Valuesrepresentdatafromtwoindependentlygeneratedpopulations.Allmeasurementswereaccomplishedinduplicate.(B)Onerepresentative
populationisshownforaparalleldeterminationofGFPfluorescenceinFACS.TheM1-regionwasusedforthedeterminationofthepercentage
ofGFPpositivecells.(C)Inducedcells(reachingM1-regionin“B“).Meanvaluesoftwoindependentlygeneratedpopulations.Allmeasurements
weredoneasduplicates.
(MOV-scT6cA), revealed a significant difference in their (Figure 5 in their paper). From the combined results it
response mechanism (Figures 4 and 5). While the self- may be concluded that the threshold response was due
containedvectorexhibitedamoregraded,Dox-dependent to the autoregulated mode for transactivator expression.
induction of gene expression [36,37], a threshold mode Further observations support the hypothesis that basal
wasobservedfortheautoregulatedvector.Thisimportant transactivator abundance might be the limiting factor:
difference was only detected at the single cell level, as i) a sub population, enriched for its ability to achieve full
demonstrated in cell based analysis of eGFP fluorescence induction levels at 30 ng/ml Dox, displayed an increased
ofthedualreportergenelmg*,sinceitwasmaskedinluci- steady state level of M2-mRNA already before induction
feraseanalysisofbulkcultures. (Figure 5B), and (ii) Hela-EM2 cells, which provide a
Markusic and co-workers obtained similar results [10] basal abundance of M2 transactivator, showed a thresh-
by direct comparison of a self-contained and an autore- old response of the total cell population at 30 ng/ml
gulated unidirectional lentiviral vector. In their study, Dox, when transduced by the autoregulated MOV-
populations transduced by the autoregulated vector dis- scT6cAvector.
played a nearly full induction of gene expression at yet From these observations, a model following the law of
intermediate effector (Dox) concentrations and an in- mass action can be derived, with activation of transgene
crease in positive cells at higher Dox concentration expression being proportional to the product of the
Heinzetal.BMCBiotechnology2013,13:5 Page9of12
http://www.biomedcentral.com/1472-6750/13/5
concentrations of M2-transactivator and its effector were transferred to 60 mm dishes the day before trans-
Dox. Thus, full activation of the TRP-driven transgene fection. A total amount of 15 μg plasmid DNA was
could be achieved at low M2-transactivator levels, given transfected containing 5 μg pHIT60 (gag/pol expression
that effector concentration remained at optimum level plasmid; [39]), 5 μg pczVSV-G (VSV-G envelope expres-
(Figures 4, 5; 1000 ng/ml Dox), or, vice versa, at high sion plasmid [40]) and 5 μg ofthe transfer vector. 16–18
levels of M2-transactivator at otherwise limiting Dox hours after transfection the medium was replaced by
concentrations (Figures 5,6;30ng/ml Dox). 3 ml DMEM-medium, supplemented with 5 mM Na-
Our data further suggest that the basal activity of the butyrate, which was exchanged for DMEM-medium
cA-promoter is dependent upon the integration sites. without Na-butyrate after additional 6–8 hours. 16–18
Onlylocithatfavouredthestartoftheautoregulatedcir- hours following medium exchange the supernatant was
cuit were able to induce the threshold response of the harvested, filtrated (0,45 μm, Nunc), supplemented with
Tet-system at low Dox concentrations. The accessibility polybrene (5 μg/ml, SIGMA), aliquoted and stored at
of theTRP at the chromosomal integration site seems to −80°Cforlateruse.
be of minor importance for the conversion of the graded All titrations were performed on Ht1080 cells using
toathresholdresponse. serial dilutions of the obtained supernatants (5-10-20-
40-80-160-fold, respectively). Briefly, 2×105 cells were
Conclusions transferred to a 6well plate the day before infection. 24
In summary, our results demonstrated the advantageous hours later medium was replaced by 1 ml of fresh cul-
properties of the autoregulatory compared to the self- ture medium supplemented with polybrene (5 μg/ml)
contained principle for M2-transactivator expression, and premixed with supernatant. After about 18–20 hours
when using retroviral vectors with a bidirectional design, medium was renewed and cells were cultivated under
combined with the inducible cA-promoter. However, induced conditions (Dox 1000 ng/ml). Fluorescence acti-
limitations occur when high vector dosages are applied. vated cell sorting (FACS) or otherwise analysis of cell
In particular, the observed on/off switch may have sig- populations were performed on day 6 (about 96 hours
nificant advantages, especially considering that full acti- post induction). For calculation of viral titers the number
vation was achieved at suboptimal Dox concentrations of GFP positive cells (about 4×105 cells × % GFPpos/100)
and thus might help to overcome induction problems wasdetermined,acorrectionfactorof2wasappliedtoac-
relatedto tissue-specific barriersfor effector penetration. count for cell division during infection. In general, titers
However, graded induction of gene expression is not intherangeof1-3×106IP/mlcouldbeobtained.
possible with the autoregulated cA promoter and thus
excludes this promoter design from experiments where Establishingtransducedcellpopulations
an adjustablemodeoftransgeneexpressionis mandatory. About 4×105 cells (Hela-M2) were infected (always in
Moreover, the dependence ofinduced gene expression on the absence of Dox) on 6well plates with serial dilutions
the cellular abundance of the transactivator provides im- of the transiently produced vectors and induced after
portantevidencetohelpexplainthelargedifferenceofef- the first split for four to five days at 1000 ng/ml Dox.
fector concentrations reported to fully activate TRPs in Appropriate infected populations (1-3% positive cells)
variouscellsystems. were used for the enrichment by one round of FACS.
These conditions ensured, that mostly single copy inte-
Methods grates of the vectors were generated. In general, the
Cellculture established individual populations were adjusted to
293T (ATCC # CRL-11268), Hela-EM2 [38] and Ht1080 present >15.000independentclones.
cells were cultured in Dulbecco´s modified Eagles
medium (DMEM, Invitrogen) supplemented with 10%, Determinationofluciferaseactivity
heat inactivated fetal bovine serum (FBS, PAA) at 5% Purified transduced cell populations had to be cultivated
CO and 37°C. Cultures were split at 70-80% confluency. in the “off-state” for a period of least 10 days, due to the
2
Following a washing step with PBS and incubation for prolonged half life of luciferase in the fusion protein
3–5 min in the presence of PBS/EDTA (0,8 mM), cells lmg* and the high expression level of the tet-units. In-
were harvested and either transferred into fresh medium duction experiments were started by splitting 0.5-1×105
orusedinsubsequent analysis. cells into cell culture medium with or without Dox
(500 ng/ml). After 96 (72) hours incubation cells were
Transientvectorproductionandtitration harvested with PBS/EDTA and GFP fluorescence and
Transient production of viral vectors was carried out by luciferase activity were analyzed simultaneously. 0.5-2 μl
lipofection with the TransIt293 reagent (Mirus, CA) as of bulk cell lysate were used for analysis of luciferase
recommended by the supplier. About 1.5×106 293Tcells activity by luminescence detection (Lumat, Berthold,
Heinzetal.BMCBiotechnology2013,13:5 Page10of12
http://www.biomedcentral.com/1472-6750/13/5
Germany),essentiallyasdescribedearlier[41].Proteincon- componentswassubclonedintopBluescriptSKII+plasmid
centration was determined according to the method of backbone (Stratagene, CA) by standard techniques [47]
Bradford[42]andspecificluciferaseactivitywascalculated. andsequenced(Eurofins,Germany).
In general, treatment of cells was similar in dose The WPRE element, which already contained muta-
response experiments, except for a daily medium ex- tions of “atg´s” of the original element, was newly
change. This was applied in order to counteract the po- synthesized by PCR, using the SIN11 vector [33] as
tential degradation of Dox, which may affect the level of template. Sequence alignment to the WPRE used in
induction especially at low concentrations. Medium was the lentiviral vectors of the Naldini Lab [9] showed a
supplementedwiththeindicatedDox-concentrations. 400 bp homologous stretch. This sequence, common
Experiments on induction kinetics required transfer of to both WPRE elements, was PCR amplified and used
individual cell numbers, thus, allowing the harvest of a for generation of the constructs (Additional file 1:
sufficient amount of cells for short term cultures, and Figure S2).
avoidingovergrowthofthecellsusedforprolongedcul- The cA-promoter was PCR amplified using the
tivation. Ingeneral, cellsfor short term analysis(e.g. 0.5 S2f-clHCg [30] as template. The CAAT-box of
hours of induction) were splitted to high density (5×105 MoMuLV was introduced upstream of the SP-1 sites
cells/6well), while cells for the 24/48/72/96 hours in- by amplification with the particular sense oligo. The
duction were transferred at about 4-2-1 or 0.5 × 105 full sequence is given in Additional file 2: Figure S1.
cells/6well.
Additional files
NorthernanalysisoftotalRNA
For RNA analysis the enriched populations were grown
Additionalfile1:FigureS2.AlignmentoftheWPREelementusedin
on 9cm dishes either in the absence or presence of Dox.
thelentiviralpRRL.SIN.vector([15],N,uppersequence),andtheWPRE*
After 96 hours the cells were harvested and total RNA elementasusedintheSIN11retroviralvector([33]B,lowersequence).
wasextractedbytheacidicphenolmethod[43].Northern Mutationsintroducedtoeliminatethe“atg´s“areboxed.TheWPRE*-
shortfragment(pre*s)usedthroughoutthisworkisunderlined.
analysiswasperformedasdescribedearlier[44].Detection
Additionalfile2:FigureS1.cA-promoter.Completesequenceofthe
was carried out withavidin conjugated alkaline phosphat-
artificialpromoterisshown.5´and3´cloningsitesareunderlined.The
ase (Molecular Probes) and CDP-Star (Tropix) as sub- MoMuLVsequence(italic)containingtheCAAT-Boxelementwasfused
strate for chemiluminescent detection. Rat GAPDH viaPCRtotheHIV-1LTRfragmentcontainingthreeSP1-sites(bold)and
theTATA-box(underlined).
cDNA served as an internal mRNA standard. All probes
Additionalfile3:FigureS3.Inducedsquelchingathighmultiplicityof
used were biotin-labeled during PCR-synthesis. Detection
infection(MOI).TheincreasedsteadystatelevelsofM2transactivatorunder
of the mRNA steady states was achieved by exposure to inducingconditions(Figure2C)implied,thatespeciallyfortheauto-
X-Ray film (Kodak Bio-Max light, Sigma). Sizes of the regulatorycircuitthetransactivatormightaccumulatetolevelsthatwere
nottoleratedbythecellsandthusprovokecollateraldamageby
RNA marker (Promega) are indicated in the figures. The
squelching.Themostconsistentsideeffectrelatedtosquelchingisa
following oligonucleotides were used for probe synthesis: reducedgrowthcapacityofthecells[23]andatlaterstagesalsoareduced
sense 5´- TTACAGATGCACATATCGAGG, antisense: overallcapacityforgeneinduction,bothmostlikelyresultingfromtitrating
outessentialfactorsforthebasaltranscriptionalmachinery[48].Inorderto
5´-CCTCTGGATCTACTGGGTTA (rat GAPDH) and
verifythis,wedeterminedtheluciferaseactivityaswellasgrowth
sense 5´- tctagactggacaagagc, antisense: 5’- ccgccgctttc characteristicsofcellstransducedatlow,intermediateandhighmultiplicity
gcactt (rtTA2s-M2). Densitometric analysis of appropri- ofinfection(MOI0.1,1and3).Itshouldbenoted,thatthepopulations
generatedatMOI0.1(generating1-3%positivecells)wereenrichedbyone
ately exposed films was performed by use of NIH 1.57
roundofFACSsorting,whileMOI1andMOI3populationsweremeasured
software. withoutanyenrichment.Theresultsoftheexperiments(after4daysof
inductionwith1000ngDox/ml)indicatedthattheluciferaseactivityinthe
on-andtheoff-statecorrelatedwiththeMOIinthetransducedpopulations,
Plasmidconstructs
althoughmuchlesspositivecellscontributedtotheluciferaseactivity,as
The retroviral SIN-vector “pES.1” used for the transfer wasdeterminedinFACS.Thus,increasedgenetransferwasestablishedfor
ofthetet-response unitshadbeen described earlier [31]. bothvectorsresultinginadecreaseddynamicrangeofgeneregulation
(~1000-foldinduction)atMOI3.Thepopulationsestablishedwiththeself-
The inducible expression cassette consisted of a tet-
containedMOV-scT6vectordisplayedonlyamoderatedecreaseofcell
operator heptamer, the Ptet-T6 TRP, the dual reporter growth,whilegrowthofthepopulationsestablishedwithauto-regulated
gene lmg* and a modified (see below) posttranscriptional MOV-scT6cAwasstronglyaffecteduponinductionofgeneexpression.
Whilegrowthofpopulationscontainingmostlyasinglecopyintegrateof
regulatory element of the woodchuck hepatitis virus thevector(MOI≤0.1)wasnotdecreased,anincreasedgenedosageleadto
(WPRE, [45]). While the transcription of the ES.1-T6 stronggrowthretardationafterinduction.Proposingthatahighergene
vector was terminated at the pA-signal of the viral dosagewillleadtoincreasedconcentrationoftransactivator,thisindeed
maybeadirecteffectofsquelching.Theobservation(notshown)thata
3-LTR, the ES.1-T6sc transcripts were terminated at the
prolongedinductionwasabletorecovergrowthcapacitybyfurther
antisense orientatedSV40(late)polyadenylationsignalfused reducingtheproportionofpositivecellsinthosepopulationssupported
to the constitutive transport element (cte) of SRV-1 thisassumptionastheresidual,transgenenegativecellsstartedtoovergrow
thetransgenepositivecells.
[32,46]. The tet-responsive promoter as all other