Glycine receptor clusters and synapses

13 Pages·2000·0.5 MB·English

Journal of Cell Science 113, 2783-2795 (2000) 2783
Printed in Great Britain ©The Company of Biologists Limited 2000
JCS1263
Formation of glycine receptor clusters and their accumulation at synapses
Jochen Meier1, Claire Meunier-Durmort2, Claude Forest2, Antoine Triller1 and Christian Vannier1,*
1Laboratoire de Biologie Cellulaire de la Synapse Normale et Pathologique, INSERM U497, Ecole Normale Supérieure, 46 rue
d’Ulm, 75005 Paris, France
2CEREMOD, CNRS UPR 9078, 9 rue Jules Hetzel, 92190 Meudon, France
*Author for correspondence (e-mail: [email protected])
Accepted 23 May; published on WWW 10 July 2000
SUMMARY
The glycine receptor is highly enriched in microdomains of surface clusters after transfection. These clusters were not
the postsynaptic neuronal surface apposed to glycinergic colocalized with detectable endogenous gephyrin, and the
afferent endings. There is substantial evidence suggesting GlyR b subunit could not be detected in transfected cells.
that the selective clustering of glycine receptor at these sites Therefore, exogenous receptors were not assembled
is mediated by the cytoplasmic protein gephyrin. To as heteromeric complexes. A quantitative analysis
investigate the formation of postsynaptic glycine receptor demonstrated that newly synthesized glycine receptor
domains, we have examined the surface insertion of progressively populated endogenous gephyrin clusters,
epitope-tagged receptor a subunits in cultured spinal since association of both proteins increased as a function of
cord neurons after gene transfer by polyethylenimine- time after the onset of receptor synthesis. This phenomenon
adenofection. Expression studies were also carried was accelerated when glycine receptor contained the
out using the non-neuronal cell line COS-7. gephyrin-binding domain.
Immunofluorescence microscopy was performed using Together with previous results, these data support a
wild-type isoforms and an a mutant subunit bearing the two-step model for glycinergic synaptogenesis whereby
gephyrin-binding motif of the b subunit. In COS-7 cells, the gephyrin-independent formation of cell surface
transfected glycine receptor a subunits had a diffuse clusters precedes the gephyrin-mediated postsynaptic
surface distribution. Following cotransfection with accumulation of clusters.
gephyrin, only the mutant subunit formed cell surface
clusters. Key words: Glycine receptor, Gephyrin, Spinal cord neuron, Cell
In contrast, in neurons all subunits were able to form cell culture, Postsynaptic anchoring, Clustering, Transfection
INTRODUCTION respectively (Essrich et al., 1998; Nusser et al., 1998). Diffuse
GluR accumulates at synapses during the process of
The inhibitory glycine receptor (GlyR) is a ligand-gated synaptogenesis (Mammen et al., 1997; Rao et al., 1998).
chloride channel abundantly expressed in spinal cord and Although the existence of diffuse GlyR was suggested (Kirsch
brainstem (Aprison and Daly, 1978; Langosch et al., 1988). It et al., 1993; St John and Stephens, 1993), it could not be
is composed of two distinct transmembrane subunits, a 1 (Mr observed during development in spinal cord neurons (Béchade
48000) and b (Mr 58000), arranged as an a 3b 2 pentamer, and et al., 1996; Colin et al., 1996), though it has been described
of a peripheral membrane protein, gephyrin (Mr 93000) during early neocortical development (Flint et al., 1998).
(Schmitt et al., 1987; Vannier and Triller, 1997 and references Postsynaptic receptor clustering was first studied for the
therein). GlyR was the first neurotransmitter receptor shown to muscular nicotinic acetylcholine receptor (nAChR),
accumulate at postsynaptic membrane areas apposed to emphasizing the role of rapsyn (Mr 43000) (for a review, see
inhibitory presynaptic endings (Triller et al., 1985, 1987; Sanes, 1997). Cytoplasmic proteins interacting with
Altschuler et al., 1986; Todd et al., 1996; Colin et al., 1998). postsynaptic receptors have also been identified in the CNS.
This notion was further extended to GABA (GABAAR; e.g. Metabotropic glutamate, NMDA and AMPA receptors bind to
Baude et al., 1992; Todd et al., 1996) and glutamate (GluR; Homer (Brakeman et al., 1997), PSD-95/SAP90 (Kornau et al.,
e.g. Jones and Baughman, 1991; Baude et al., 1993; Nusser et 1995) and GRIP (Dong et al., 1997), respectively. For GlyR,
al., 1994) receptors. gephyrin serves a similar function (Kirsch et al., 1993),
Neurotransmitter receptors are also found at non-synaptic mediated through its binding to the M3-M4 intracellular loop
plasma membrane locations, as documented for GABAAR of the GlyR b subunit (Kirsch et al., 1995; Meyer et al., 1995).
(Nusser et al., 1998) and GluR (Baude et al., 1993; Nusser et Postsynaptic stabilization may involve a linkage of the
al., 1994). In cerebellar granule cells, g 2 or d subunit- receptor-gephyrin complex to subsynaptic microtubules
containing GABAAR are postsynaptic or extrasynaptic, (Kirsch et al., 1991, 1993). This may also hold for GABAAR
2784 J. Meier and others
(Essrich et al., 1998), perhaps through an interaction with the Isolation of gephyrin and GlyR cDNAs
GABAAR-associated protein (GABA-RAP; Wang et al., 1999). Total RNAs (Chirgwin et al., 1979), prepared from adult rat spinal
It is believed that interactions between receptors and the cord and from dissociated cells of embryonic spinal cord (E14), were
subsynaptic cytoplasmic proteins are crucial for tethering used to synthesize cDNAs corresponding to gephyrin and GlyR a 1
receptors as clusters within postsynaptic scaffolds (Sanes, subunit, and to GlyR a 2B subunit, respectively. Oligonucleotide
1997; O’Brien et al., 1998; Kim and Huganir, 1999). Multiple primers were designed according to the known rat GlyR a 1-sequence
(5¢ AACATCTTTGCACCCCCATAACTC 3¢ and 5¢ CCACCCCGTC-
interactions probably take place in these scaffolds (Kim et al.,
CCAGAGCCTTCA 3¢) and rat GlyR a 2B-sequence (5¢ TTGTCCT-
1996): NMDA receptor is still retained postsynaptically even
GGTCTTCTTTCTGGAATCA 3¢ and 5¢ GGATACATCTATTTCTT-
if the function of PSD-95 is impaired (Migaud et al., 1998). GTGGACATCT 3¢) (Grenningloh et al., 1987; Kuhse et al., 1991) and
Consequently, relationships between postsynaptic localization used to generate cDNAs by RT-PCR. The a 2B isoform will
and clustering cannot be simply determined. henceforth be referred to as a 2 subunit. Gephyrin cDNA
Gephyrin is required for the synaptic localization of GlyR; corresponding to the ORF of clone P1 (containing cassette C2 only;
however, antisense (Kirsch et al., 1993) and gene disruption Prior et al., 1992) was amplified by RT-PCR using oligonucleotides
(Feng et al., 1998b) experiments did not permit 5¢ TTCTCCCGGCTCCTGTCA 3¢ and 5¢ CATGCATCGAAACTTT-
discrimination between clustering and retention at synaptic CTCC 3¢ and selected using cassette C2 specific oligonucleotides. All
loci. To investigate this issue we analyzed the fate of cDNAs were subcloned using standard methods and sequences were
transfected tagged a 1 and a 2 subunits, and one a 1 (a 1-b gb) checked by DNA-sequencing using Thermosequenase (Amersham).
subunit bearing the minimal gephyrin-binding motif of the b
DNA constructs
subunit (Meyer et al., 1995). In COS-7 cells, coexpression The isolated cDNAs of the GlyR a 1 and a 2 subunits were modified
studies with gephyrin showed that surface clusters formed
by the insertion of the sequence encoding either the 10-amino-acid c-
only if the b gb motif was present. In neurons, a 1 and a 2 myc peptide EQKLISEEDL (Evan et al., 1985) using the
formed clusters independently of the presence of this motif oligonucleotides 5¢ GCTGACGCTGCCCGA-GAG-CAA-AAG-
and of interactions with detectable gephyrin. In the absence CTG-ATT-TCT-GAG-GAG-GAT-CTG-TCTGCACCCAAGCCT 3¢
of gephyrin binding sites in these clusters, GlyR was able to and 5¢ GACCATG ACTCCAGG-GAG-CAA-AAG-CTG-ATT-TCT-
populate postsynaptic loci. The presence of the b gb GAG-GAG-GAT-CTG-TCTGGAAAACATCCC 3¢ for a 1 and a 2,
motif increased the rate of accumulation of GlyR at respectively, or the 9-amino-acid peptide YPYDVPDYA from
hemagglutinin (HA) of the influenza virus (Hamsikova et al., 1987)
gephyrin-containing postsynaptic differentiations. Altogether
using the oligonucleotides 5¢ GCTGACGCTGCCCGC-TAT-CCC-
these results indicate that cluster formation is not coupled
TAT-GAC-GTG-CCC-GAC-TAT-GCT-TCTGCACCCAAGCCT 3¢
to the gephyrin-mediated retention of receptor in synaptic and 5¢ CAAAGACCATGACTCCAGG-TAT-CCC-TAT-GAC-GTG-
loci. CCC-GAC-TAT-GCT-TCTGGAAAACATCCCTCG 3¢ for a 1 and
a 2, respectively. The epitopes were positioned by site-directed
mutagenesis between the second and third amino acids, and between
MATERIALS AND METHODS the sixth and seventh amino acids, of the mature protein a 1 and a 2,
respectively (Kunkel, 1985). A chimeric a 1 subunit (a 1-b gb) bearing
the gephyrin-binding motif of the GlyR b subunit (Meyer et al., 1995)
Cell culture
was constructed by site-directed mutagenesis. The 18-residue
Cell lines
gephyrin recognition sequence was inserted into the c-myc- and HA-
African green monkey kidney (COS-7) cells and human embryonic tagged a 1-ORF between amino acids 363 and 364 (Grenningloh et
kidney 293 (HEK 293) cells were plated either on glass coverslips or al., 1990b) using the oligonucleotide 5¢ CCAACAACAACAACAC-
into 10 cm plastic dishes and grown in Dulbecco’s modified Eagle’s CACGA-GAT-CAA-ATG-ATT-TCA-GCA-TTG-TAG-GCA-GCT-
medium (DMEM) containing 10% fetal calf serum (FCS; Gibco) at TAC-CAA-GAG-ATT-TTG-AAT-TAT-CCA-ACCCCGCTCCTGC-
37°C and 7.5% CO2. AC 3,¢ by site-directed mutagenesis. The green fluorescent protein
(GFP, obtained from the pEGFP-N1 plasmid; Clontech) was fused to
Preparation of neuronal primary cultures of rat spinal cord
the gephyrin C terminus with a GGS spacer sequence using standard
Spinal cord neurons from Sprague-Dawley rats were prepared at day recombination methods. cDNA of all epitope-tagged (HA and/or c-
14 of gestation (E14) as previously described (Béchade et al., 1996). myc, respectively) forms of the a 1, a 1b gb and a 2 subunits, including
Glass coverslips (12 mm diameter) were coated with 15m g/ml poly- the gephyrin-GFP chimera, were subcloned into a eukaryotic
DL-ornithine (Sigma) in water and then incubated with 5% heat- expression vector derived from pEGFP-N1 (Clontech) with a
inactivated FCS in Leibovitz medium (L15, Gibco). Routinely, cytomegalovirus (CMV) promotor. The primary structure of the
neurons were plated at a density of 7.5· 104cells/cm2in 16 mm wells. various constructs was verified by DNA sequencing.
After the neurons had attached, coverslips were transferred (cell side
down) to dishes containing a glial cell monolayer. They were then Transient transfection protocols
cultured for up to 14 days, in a 5% CO2atmosphere at 37°C. All plasmid DNAs were prepared by anion-exchange chromatography
(Qiagen resin).
Preparation of glial cultures of rat spinal cord
Glial cell suspensions were obtained at E14. Cells were plated at a PEI-adenofection of neurons
density of 4· 104 cells/cm2 in 35 mm dishes (Nunc) coated with Neurons were transfected 8 days after plating. To this end, they were
15m g/ml poly-DL-ornithine and grown to confluency (2-3 weeks) at transferred to 4-well plates containing 300 m l of fresh serum-free
37°C and 5% CO2 in complete L15 culture medium (Henderson et Neurobasal medium, supplemented with 0.25 mM L-glutamine
al., 1995) supplemented with 10% horse serum (Gibco). Culture (Gibco) and equilibrated at 37°C and 7.5% CO2. Transfection was
medium was changed after 7 and 14 days. 1 day before neuron plating, performed by polyethylenimine (PEI)-mediated DNA transfer as
the growth medium was replaced with serum-free Neurobasal medium described previously for other differentiated cells (Meunier-Durmort
supplemented with B27 (Gibco) to optimize neuronal survival et al., 1997). Briefly, complexes of PEI/DNA were formed by mixing
(Brewer et al., 1993). PEI (800 kDa, Fluka) and plasmid in 0.15 M NaCl at a molar charge
Glycine receptor clusters and synapses 2785
ratio r +/- =3 (assuming that every sixth nitrogen in PEI is positive at conjugated goat secondary antibody. They were finally processed for
pH 7.3). After 10 minutes, adenovirus (replication-deficient, Ad-RSV- enhanced chemiluminescence (ECL, Amersham).
nlsLacZ) was added to the complex, and the ternary complex (10 m l)
was diluted in the medium of the wells. Typically, neurons were Quantitative analysis
treated using 200 ng of DNA combined with 150 plaque-forming units The colocalization index in transfected cells was determined by visual
(pfu) of Ad-RSV-nlsLacZ per cell. Contact was allowed for 2hours, analysis using a standard fluorescence microscope (Leica; objective
then the neurons were returned to the glial cell monolayer for exogene · 63). Double-labeled cells (FITC/Cy3) were digitized and
expression for times ranging from 4 to 24 hours. superimposed using image display (Molecular Dynamics) software.
For determination of colocalization, spots were counted manually for
Transfection of cell lines each cell. Values are expressed as means ±s.e.m. of 12 independent
For COS-7 cells, experiments were performed on subconfluent cells per receptor subunit and time point. A mask corresponding to
cultures (60-70% confluency) using the DEAE-Dextran method. HEK gephyrin-immunoreactive spots was created. It allowed automatic
293 cells used for immunoblotting and electrophysiological analyses discrimination between gephyrin-associated and gephyrin-negative
were grown to 80% confluency and transfected using the calcium GlyR clusters. The threshold intensity for detection and measurements
phosphate method (Chen and Okayama, 1987). Usually, 2 or 10 m g was set manually at the limit in order to avoid coalescence of spots.
of plasmid DNA were added to 35 or 100 mm dishes, respectively. The surface area of peripheral clusters was determined using NIH 1.52
Transient protein expression was allowed to proceed for 24-48 hours software on the above cells. Both channels were analyzed separately.
at 37°C and 7.5% CO2. The statistical analysis of the results was carried out with StatView
F.4.11 software.
Antibodies
The following antibodies were used: mouse anti-gephyrin monoclonal Confocal microscopy
antibody (mAb7a) at a dilution 1/100 (Pfeiffer et al., 1984; Boehringer Confocal analysis were carried on a Leica microscope equipped with
Mannheim); anti-c-myc antibody (clone 9E10) at a concentration of an Argon Kripton laser. Excitation of the FITC and Cy3
10m g/ml (Boehringer Mannheim). The HA epitope was detected with fluorochromes was performed at 488 and 568 nm, respectively, and
a rat monoclonal antibody (clone 3F10) at a concentration of 10m g/ml the intensities were set to abolish cross-excitation. Appropriate filters
(Boehringer Mannheim). MAP2 protein was detected with a allowed the detection of FITC and Cy3 fluorescence without any
1/300 dilution of a specific rabbit polyclonal antibody (Sigma). crosstalk. Data were acquired with an · 100 (n.a. 1.4) objective. The
Secondary antibodies were used at a dilution of 1/200: digitized planes were transformed using a 3· 3 Gaussian filter, and
carboxymethylindocyanine-3 (Cy3)-conjugated affinity-purified goat superimposed using false colors.
anti-mouse IgG (depleted in anti-rat IgG activity), fluorescein (FITC)-
conjugated affinity-purified goat anti-rat IgG (depleted in anti-mouse
IgG activity) and (Cy3)-conjugated affinity-purified goat anti-rabbit
RESULTS
IgG were from Jackson Laboratories.
Immunofluorescence Construction and expression in non-neuronal cells
Immunofluorescence was performed as described previously (Lévi et of tagged GlyR subunits
al., 1998). Cells were fixed in 4% (w/v) paraformaldehyde in cDNAs encoding the full-length subunits of GlyR, namely a 1
phosphate-buffered saline (PBS) for 15 minutes, then washed with and a 2, and of gephyrin, were obtained as described in
PBS and permeabilized with PBS containing 0.12% (w/v) Triton X-
Materials and Methods. They were modified by adding the
100 and 0.12% (w/v) gelatin for 4 minutes. Cells were then incubated
coding sequence of either HA or c-myc epitope-tags and
(1 hour, room temperature) with primary antibodies in PBS containing
Aequorea victoriaGFP, respectively (Fig. 1A). A chimeric a 1
0.12% (w/v) gelatin. After extensive washes with the same buffer,
secondary antibodies were reacted for 45 minutes. Detection of subunit (a 1-b gb) was also created by inserting the 18-amino-
surface antigens was performed on unfixed cells. This approach allows acid sequence from the b subunit (gb) responsible for gephyrin
identification of external epitopes only (Misek et al., 1984; Pfeiffer et binding in thecytoplasmic loop (Meyer et al., 1995) (Fig. 1A).
al., 1985). For this, cells were incubated directly with primary All modified cDNAs were subcloned into an expression vector
antibodies for 30 minutes on ice, either in PBS containing 2 mg/ml allowing a constitutive expression driven by the CMV
bovine serum albumin (BSA), 1mM Ca2+and 1mM Mg2+(COS-7 promotor. The sizes of the corresponding proteins were
cells) or in air-equilibrated L15 medium supplemented with 20 mM
checked by transfection of HEK 293 cells followed by
glucose and 1mg/ml BSA (neurons). After extensive washes on ice,
SDS-PAGE and immunoblotting performed on whole cell
cells were fixed in paraformaldehyde as above, then reacted with
lysates (Fig. 1B). As expected, each of the various a constructs
secondary antibodies.
gave rise to a single species of Mr48,000-49,000, detected after
Immunoblotting reaction with the anti-c-myc antibody. The gephyrin-GFP
Transfected HEK 293 cells were washed with ice-cold PBS containing fusion protein, reacted with a GFP-specific antibody, appeared
2 mM EDTA, scraped and directly solubilized in non-reducing as a homogenous species of Mr 105,000.
Laemmli sample buffer. Proteins (25 m g) were separated by SDS- From the known topology of the GlyR subunits (Betz, 1991),
polyacrylamide gel electrophoresis (SDS-PAGE, 10% acrylamide), it was anticipated that positioning epitope tags at or close to
and transferred onto nitrocellulose (BA85 Schleicher and Schuell, the N terminus of the polypeptide would lead to exclusive
0.45 m m) using 20% methanol, 0.1% SDS, 20 mM Tris-base, 150 mM
detection at the cell surface in non-permeabilized, intact living
glycine, pH 8.3. Nitrocellulose membranes were blocked by
cells. This approach (see Materials and Methods) proved
incubating in 10% (w/v) low-fat milk powder in PBS for 1-2 hours at
successful with both non-neuronal cells and neurons. The
room temperature (RT), then incubated overnight with mAb 9E10 (1.5
m g/ml; Boehringer Mannheim) at 4°C, and with a rabbit polyclonal behavior of the tagged proteins was analyzed in transfected
anti-GFP antibody (1.5m g/ml; Clontech) in PBS containing 1 mg/ml COS-7 cells using immunofluorescence microscopy. Results
BSA and 0.3% (w/v) Tween 20. Blots were washed with the same obtained with c-myc-tagged subunits are reported in Fig. 2.
buffer and reacted with the appropriate horseradish peroxidase (HRP)- They were identical to those obtained with HA-tagged subunits
2786 J. Meier and others
with gephyrin-GFP (Fig. 2D,E). The distribution
pattern of gephyrin in cells coexpressing the chimeric
a 1-b gb subunit was modified (Fig. 2F,G). In these
experiments gephyrin still formed numerous
intracellular aggregates of heterogeneous size, and part
of the gephyrin pool (and only under these conditions,
compare with Fig. 2D,E) was found under the plasma
membrane. There, gephyrin formed clusters and was
colocalized with a 1-b gb inserted in the plasma
membrane (93±0.55% of peripheral gephyrin
aggregates were colocalized with cell surface GlyR
clusters). The colocalization of surface clusters of GlyR
a 1 chimera with clusters of gephyrin is illustrated in
Fig. 2F3, arrowheads. This result indicated that the
gephyrin-binding domain of the b subunit was active
when inserted in a heterologous polypeptide and could
mediate the interaction of the two transfected proteins.
This result also meant that relocation of gephyrin
beneath the membrane resulted from an interaction
with clustered a 1-b gb subunit. Moreover, the
colocalization of gephyrin and a 1-b gb was not
restricted to the plasma membrane since gephyrin
interaction also occurred with the intracellular chimera
Fig. 1.Structure and expression of constructs used in this study. (A) Diagram
of the structures of the tagged a 1 and a 2 subunits and of gephyrin. In a 1, a 2 (Fig. 2G). Altogether, these experiments indicated that:
and a 1-b gb sequences, the black box is either the c-myc or the HA sequence (1) the GlyR a subunits alone are not able to form
inserted downstream of the indicated N-terminal amino acid residues, and clusters, (2) gephyrin alone is not able to translocate
the hatched boxes represent the four transmembrane domains (M1-M4). In beneath the plasma membrane, (3) binding of gephyrin
the a 1-b gb molecule, the black hatched box between M3 and M4 is the to a transmembrane subunit can relocate gephyrin and,
gephyrin-binding site from the GlyR b subunit inserted after residue 363. finally, (4) gephyrin promotes the formation of GlyR
The gephyrin-GFP chimera contains GFP (black bar) fused to the tripeptide a subunit clusters.
spacer GGS, added after residue 736 of gephyrin. (B) Immunoblotting
analysis of transfected HEK 293 cells. Cells transfected with gephyrin-GFP Clusters of exogenous subunits over the
(lane 1) or myc-tagged subunits a 1 (lane 2), a 2 (lane 3) or a 1-b gb (lane 4), somatodendritic compartment
were lysed 24 hours after transfection. Following SDS-PAGE and
In order to obtain a short-term expression of exogenous
electroblotting (see Materials and Methods), transferred proteins were
GlyR components in differentiated neurons, primary
probed with anti-GFP-antibody and anti-c-myc-antibody and revealed using
ECL. cultures of spinal cord cells were transfected using a
ternary complex of polyethylenimine/DNA/adenovirus,
as described in Materials and Methods. This method,
(not shown). 24 hours after transfection, the a 1, a 2 and a 1-b gb in which LipofectAMINE can also be used in place of
subunits were expressed at high levels, as judged from the polyethylenimine, was initially utilized for transient expression
bright perinuclear staining seen in permeabilized cells reacted in established cell lines (Meunier-Durmort et al., 1996, 1997).
with the anti-c-myc antibody (Fig. 2A2-C2). This pattern was It was preferred in the present study because the low toxicity
distinct from that obtained following exposure of living cells of the transfection medium ensured better neuron survival (for
to the anti-c-myc antibody at 0°C (Fig. 2A1-C1). In this case, cells taken 7-15 days after plating) than protocols involving
the diffuse labeling of the plasma membrane demonstrated other polycation-mediated condensations. This was assessed
both proper transport of the modified subunits to the cell by estimating morphological alterations and fragmentation of
surface and their acquisition of the expected topology. In nuclei (unpublished observations). The maximum efficiency of
agreement with this, patch-clamp analysis in the whole-cell gene transfer (up to 5% of neuronal cells were transfected) was
configuration (Hamill et al., 1981) on HEK 293 cells achieved at a charge ratio of 2.5-3 with PEI 800 kDa (see
expressing tagged a 1 or a 1-b gb, revealed that glycine (40 m M, Materials and Methods), whereas no transfer could be obtained
bath application) elicited chloride currents characterized (not with PEI 25 kDa (data not shown).
shown) by parameters similar to those already reported for the It was important to determine whether plasmid DNA
transfected subunit (Bormann et al., 1987; Sontheimer et al., transferred into spinal neurons using this protocol allowed a
1989; Grenningloh et al., 1990a). These results indicated that proper expression and localization of encoded GlyR subunits.
subunit activity was not grossly altered by the tag sequence. As determined by immunocytochemistry of the HA-tag on
A feature of gephyrin, when transfected in HEK 293 cells, non-permeabilized living cells, all the HA-a 1, HA-a 2 and
was the formation of cytoplasmic aggregates, probably HA-a 1-b gb subunits could be detected at the cell surface. Tags
reflecting concentration-dependent homophilic interactions, as could be detected as early as 4 hours following transfection.
observed by others (Kirsch et al., 1995). These aggregates were The exclusive labeling of the exogenous subunits present at the
also observed in transfected COS-7 cells, and do not seem to cell surface with mAb3F10 (anti-HA) was confirmed by the
perturb surface insertion of either a 1 or a 2 upon cotransfection membrane impermeability toward antibodies, as ascertained
Glycine receptor clusters and synapses 2787
Fig. 2. Surface expression of myc-tagged GlyR subunits in COS-7 cells. (A-C) Cells were transfected with a 1, a 2 or a 1-b gb. After a 24 hour
expression period the c-mycepitope was revealed on intact living cells (no permeabilization; A1-C1) or on fixed and permeabilized cells
(A2-C2). A1,2, a 1; B1,2, a 2; C1,2, a 1-b gb. In the absence of permeabilization, myc-tagged proteins are diffusely distributed at the cell surface
(arrowheads). After fixation and permeabilization tags are also detected intracellularly (arrows). (D-G) Coexpression of gephyrin-GFP chimera
and myc-tagged subunits. Localization of proteins was analyzed 24 hours after transfection by myc-immunostaining and GFP-fluorescence on
living non-permeabilized (D1-F3), and on fixed and permeabilized (G1-3) cells. D1-3,gephyrinand a 1; E1-3, gephyrinand a 2; F1-G3,
gephyrinand a 1-b gb. The c-myc epitope was visualized using mAb 9E10 and a Cy3-conjugated secondary antibody (red, arrowheads; D1-G1),
and gephyrin by GFP fluorescence (green, arrows; D2-G2). Higher magnifications of superimposed images are shown in D3-G3. Note the
presence of clusters of both gephyrin and GlyR a 1-b gb subunit at the plasma membrane (F3, arrowheads) and in intracellular compartments
(G3, arrows) in coexpression experiments. Bars, 10 m m (5.4 m m in D3-G3).
2788 J. Meier and others
Fig. 3. Somatodendritic surface expression of tagged GlyR subunits in cultured rat spinal neurons. Neurons were transfected with a 1, a 2 or
a 1-b gb, 8 days after plating. After an 8 hour expression period, cell surface HA-immunofluorescence (green) was visualized on living non-
permeabilized cells. After permeabilization, somatodendritic compartments were identified using anti-MAP2 antibody (red). Note the
discontinuous labeling at the cell surface for all constructs. (A) HA-GlyR a 1; (B) HA-GlyR a 2; (C) HA-GlyR a 1-b gb. Lower panels: higher
magnifications of the area delineated in the upper panels. Bars, 10 m m (upper panels) and 2.7 m m (lower panels).
by the lack of reactivity of the anti-MAP2 antibody ratio present in the a 1-b gb chimera. In accordance with this,
upon coincubation with mAb3F10 (not shown). The when the b gb sequence was present, the a 1-b gb and gephyrin
immunoreactivity of these subunits was not randomly localized strongly colocalized at both intracellular compartments (Fig.
at the cell surface. First, as illustrated in Fig. 3, the anti-HA 4C) and cell surface (Fig. 4D). Using western blotting analysis
antibody stained only the dendritic and somatic membranes we also ascertained that transient expression of either a 1or a 2
and not the axons, since HA- and MAP2-immunoreactivities in neurons did not induce b subunit synthesis. We used the 4a
were found in the same processes (Fig. 3), and HA labeling antibody, which recognizes GlyR a and b subunits, and allows
was absent from compartments devoid of MAP2 (not shown). their simultaneous detection in purified spinal cord hetero-
In the illustrated experiment, the HA-tag was labelled prior oligomeric receptor (Pfeiffer et al., 1984). In cells transfected
to permeabilization on unfixed living cells (see Materials at 2 and 7 days after plating (Fig. 4E), the expression of
and Methods) whereas MAP2 was labelled following exogenous a 1 or a 2 subunits was not accompanied by the
permeabilization. Immunoreactivity of all three a subunit appearance of the b subunit (Fig. 4E, lanes 1,2 and 5,6). As
forms was restricted to the MAP2 compartment over a 24-hour expected, b subunit was not synthesized in cells expressing
period after the onset of expression (not shown). This is GFP alone or in non-transfected cells (Fig. 4E, lanes 3,4 and
consistent with the known distribution of endogenous GlyR in 7,8), in agreement with published data (Hoch et al., 1989) on
the somatodendritic compartment (Béchade et al., 1996). similar cell cultures.
Second, once detectable, the immunoreactivity of cell surface Our results on the expression of tagged receptors
GlyR subunits appeared as spots of variable size scattered over demonstrate that: (1) cell surface exogenous GlyR a subunits
the somatodendritic domain. are localized over the somato-dendritic compartment, (2) GlyR
The formation of these spots could result from the a 1subunits form clusters that do not contain gephyrin-binding
oligomerization of exogenous a subunits with endogenous b sites and (3) GlyR a subunits are not oligomerized with an
subunit, thus allowing tagged heteromeric GlyR to interact endogenous GlyR b subunit.
with endogenous gephyrin. To test the possibility of the
presence of a gephyrin-binding site, we first compared Relationship of exogenously expressed GlyR a
the localization of exogenous a 1 or a 1-b gb in neurons subunits to postsynaptic loci
cotransfected with GFP-tagged gephyrin. If oligomerization The clusters of exogenous GlyR a subunits at the cell
with endogenous b subunit occurred, both exogenous a 1 and periphery are reminiscent of those previously reported for
a 1-b gb should be colocalized with gephyrin-GFP. The endogenous receptor, indicating that exogenous subunits can
gephyrin-binding domain is a potent signal since it can relocate clusterize in the plasma membrane of transfected neurons.
NMDAR to intracellular gephyrin-rich loci when incorporated The postsynaptic localization of clusters of endogenous GlyR
in the C terminus of the NR1 subunit (Kins et al., 1999). Others in cultured neurons is also well established (Béchade et al.,
used similar redistribution experiments in non-neuronal cell 1996; Nicola et al., 1997). We therefore further characterized
systems (Kirsch et al., 1995) to detect interactions with the distribution pattern of the exogenous subunits and
gephyrin. Therefore, a lack of colocalization of a 1 subunit to determined whether the new a 1, a 2 and a 1-b gb clusters
gephyrin intracellular blobs would indicate that GlyR has not could be associated with a known postsynaptic marker.
incorporated the b subunit. As shown in Fig. 4A,B, we found Double immunostaining experiments were performed in
that myc-tagged a 1subunit and gephyrin-GFP exhibit very low order to compare the respective distributions of HA-tagged
colocalization at the cell surface and intracellularly. This subunits and of gephyrin (Fig. 5A-C). For all three subunits,
indicates that almost all exogenous a 1subunits synthesized in surface clusters of exogenous origin, specifically labeled with
neurons transfected 7 days after plating did not oligomerize mAb3F10, were colocalized with a large fraction of the pool
with the b subunit. If any oligomerization were to occur with of endogenous gephyrin clusters visualized with mAb7a (Fig.
an endogenous GlyR b subunit, then the stoichiometry of the 5A-C). However, the extent of association of gephyrin
gephyrin-binding site to a 1 subunit would be far below the 1:1 clusters with exogenous GlyR, as determined after 24-hours
Glycine receptor clusters and synapses 2789
Fig. 4. Absence of detectable b subunit in exogenously expressed GlyR in neurons after transfection. (A-D) Localization of myc-tagged GlyR a
subunits and GFP-tagged gephyrin in cultured rat spinal neurons. Experiments were carried out on neurons as in Fig. 3. The tagged GlyR a
subunits (red) and the exogenous gephyrin (green) are revealed as in Fig. 2. Cotransfection of GlyR a 1subunit and gephyrin (A,B) or GlyR
a 1-b gb and gephyrin (C,D), followed by immunostaining with (A,C) or without (B,D) permeabilization, respectively. Note that colocalization
(yellow) occurs intracellularly (crossed arrows) or at the cell surface (open arrowheads) only if the b gb sequence is present. Open arrowheads
and arrows indicate surface expressed tagged GlyR a 1-b gb and tagged GlyR a 1, colocalized or not with gephyrin-GFP, respectively; crossed
and tailed arrows, intracellular tagged GlyR a 1-b gb and tagged GlyR a 1, colocalized or not with gephyrin-GFP, respectively; arrows,
intracellular gephyrin-GFP. Bar, 5 m m. (E) Analysis of lysates of neurons transfected 2 or 7 days after plating. Cells transfected with myc-
tagged a 1 (lanes 1,5), a 2 (lanes 2,6) subunits or GFP (lanes 3,7), and non-transfected cells (lanes 4,8) were homogenized 24 hours after
transfection and a post-nuclear fraction was prepared. 10 m g protein fractions were used for SDS-PAGE and electroblotting. Transferred
material was probed with the monoclonal anti-a /b antibody (mAb4a) and revealed using ECL. The arrowhead indicates the position expected
for the b subunit (Mr58,000).
post-transfection, depended on the transfected subunits (a 1, and (3) the level of association with postsynaptic loci depends
72%±4.51; a 2, 54%±4.1; a 1-b gb, 86%±0.86 (means ± on the transfected subunit.
s.e.m.); see Fig. 8).
As shown in Fig. 5, tagged-GlyR a 1 partially associates with Tagged GlyR a subunit clusters can be independent
endogenous gephyrin, whereas it was rarely associated with of gephyrin in transfected neurons
intracellular aggregates of exogenous gephyrin-GFP (see Fig. Clusters formed by the three tagged a subunits were classified
4). Various explanations may account for this apparent into two groups, according to whether HA-epitope and
discrepancy. First, the GFP-tagged gephyrin used in this endogenous gephyrin immunoreactivities were colocalized. As
experiment (cassette 2 only) could be different from the illustrated by the immunostaining of the two antigens on
endogenous gephyrin recruiting GlyR at synapses (Fig. 5). dendrites after 8 hours of expression (Fig. 6), the tagged GlyR
Second, this difference could result from routing. Tagged-GlyR clusters, associated or not with gephyrin, displayed size
a 1 would be delivered to the plasma membrane prior to heterogeneity over the entire surface of the soma and dendrites.
association with pre-existing subsynaptic clusters of Quantitative analysis revealed that gephyrin-associated clusters
endogenous gephyrin. In cotransfected cells, it would escape of a 1 and a 2 subunits were significantly larger than gephyrin-
trapping by exogenous gephyrin aggregates because of its low negative ones, independent of the expression time (4-24 hours)
affinity for gephyrin, and therefore reach the cell surface. As a following transfection (Fig. 7). The size distribution of a 1
result, only associations between tagged-GlyR a 1 and clusters 8 hours post-transfection is shown in Fig. 7A1,2. The
endogenous gephyrin would be detected. colocalization with gephyrin aggregates was associated with an
These transfection and colocalization experiments indicate increase in the mean surface area, and the fraction of clusters
that: (1) tagged GlyR a subunits are able to form clusters smaller than 0.1 m m2 was 75% in the gephyrin-negative
associated or not with postsynaptic loci, (2) in neurons only, population, as compared to 38% in the positive one. Size
clusters can form independently of interaction with gephyrin, differences were also observed for a 1 and a 2 at various time-
2790 J. Meier and others
Fig. 5. Relationship of tagged GlyR subunits with synaptic components in transfected neurons. Experiments were carried out as in Figs 3 and 4
on neurons transfected 8 days after plating with HA-tagged a 1, a 2 or a 1-b gb. (A-C) HA-tagged GlyR subunits and gephyrin. HA-
immunoreactivity (IR) (A1-C1), 24 hours after transfection, visualized on intact living cells prior to fixation (A1, a 1; B1, a 2; C1, a 1-b gb).
Gephyrin was immunostained following fixation and permeabilization (A2-C2). Higher magnifications (A3-C3) of superimposed images
corresponding to outlined regions. Arrows, HA-associated IR; crossed arrows, gephyrin IR; arrowheads, examples of colocalization. Bar,
10m m (5.8 m m in A3-C3).
points after transfection, as compared to a 1-b gb (Fig. 7B). exogenous tagged GlyR was investigated as a function of the
Independent of the expression time (4, 8 or 24 hours), a 1 and expression time (Fig. 8). A colocalization index was defined by
a 2 clusters associated with gephyrin were significantly the ratio of the number of gephyrin clusters positive for HA-tag
(P<0.001, ANOVA, F of Scheffe) larger than those not staining to the total number of gephyrin clusters and was
associated with gephyrin. Moreover, gephyrin-associated a 1 expressed as a percentage. Counts were carried out on
and a 2 clusters displayed sizes identical to those of a 1-b gb, transfected neurons as shown in Figs 5 and 6 using
independent of the association of the latter subunit with superimposed images. Between 4 and 24 hours following
gephyrin. transfection, the colocalization index increased significantly
The amount of cell surface GlyR results from continuous (P<0.001, ANOVA, F of Scheffe) for both a 1 (34.9±4.4% to
insertion and internalization in and from the plasma membrane. 72.4±4.5%) and a 1-b gp (54.2±4.9% to 86±0.86%). A
Despite this dynamic process a significant fraction of the significantly more rapid increase was also revealed over 24
exogenous subunit clusters was associated with endogenous hours, in the a 1-b gb index as compared to that of a 1, and at
gephyrin. Therefore we wondered whether this colocalization time 8 hours the indices were 81±1.7% (***) and 29±5.4%,
resulted from a progressive association process. Thus, the level respectively. This difference could very likely be accounted for
of occupation of endogenous postsynaptic gephyrin clusters by by the expected greater ability of the a 1-b gb subunit to bind
Fig. 6.Relationships of cell-surface clusters of HA-tagged GlyR subunits to gephyrin clusters. Neurons were transfected and stained as in
Fig. 5. Clusters are exemplified here on dendrites (A1, a 1; B1, a 2; C1, a 1-b gb; A2-C2, gephyrin). Arrows, HA-IR clusters without gephyrin
IR; arrowheads, HA-IR clusters colocalized with gephyrin IR; crossed arrows, clusters of gephyrin-IR without HA-IR clusters. Bar, 2 m m.
Glycine receptor clusters and synapses 2791
A1 A2
0.20 Not colocalized with gephyrin 0.20 Colocalized with gephyrin
cy 0.15 cy 0.15
n n
e mean 0.090 e mean 0.159
u u
q s.d. 0.054 q s.d. 0.105
e e
Fr 0.10 s.e.m. 0.002 Fr 0.10 s.e.m. 0.005
n 1100 n 539
0.05 0.05
0 0.1 0.2 0.3 0.4 0.5 0.6 0 0.1 0.2 0.3 0.4 0.5 0.6
Surface Area (µm2) Surface Area (µm2)
B1 B2
0.20 Not colocalized with gephyrin 0.20 Colocalized with gephyrin
4h 8h 24h
2) 2)
m m
0.15 0.15
µ µ
a ( a (
Are *** *** Are
e 0.10 * e 0.10
c c
a a
urf urf
S S
0.05 0.05
0 0
HA-a 1 HA-a 2 HA-a 1-b gb HA-a 1 HA-a 2 HA-a 1-b gb
Fig. 7.Measurement of the surface area of HA-tagged subunit clusters. Neurons were transfected as in Fig. 5, and protein expression was
allowed for the indicated time. Visualization of HA-tagged GlyR subunits and gephyrin was as in Figs 5 and 6. (A1,2) Example of frequency
distribution of the surface area of HA-a 1 clusters associated (A2) or not (A1) with gephyrin clusters after an 8 hour expression period. (B1,2)
Mean surface area of HA-tagged subunit clusters after expression for 4 , 8 and 24hours, not associated (B1) or associated (B2) with gephyrin
clusters. Note that surface area of gephyrin-negative a 1 and a 2 clusters (B1, 0.09 m m2±0.004; 0.097 m m2±0.004) are significantly (***) smaller
than those of gephyrin-positive a 1 and a 2 clusters (B2, 0.15 m m2±0.004; 0,15 m m2±0.01), and significantly (*) smaller than gephyrin-negative
a 1-b gb cluster surface areas (B1, 0.13±0.01 m m2; see Fig. 6C1, arrows). In contrast, there is almost no difference between gephyrin-negative
and gephyrin-positive cluster surface areas of GlyR a 1-b gb (negative: B1, 0.13 m m2±0.01; positive: B2, 0.15 m m2±0.01). Values are means ±
s.e.m. Scheffe test: ***, P<0.001; *, P<0.05.
endogenous gephyrin, a hypothesis that needs to be confirmed. were routed to the cell surface. Second, though being
It is important to note, however, that the increase in the overexpressed in neurons, they accumulated only over the
colocalization index from 4 to 24 hours post-transfection proved somatodendritic domain, suggesting that machinery operating
that GlyR-binding sites (i.e. endogenous gephyrin clusters) in in GlyR compartmentation was not saturated with exogenous
transfected neurons were not saturated during the experiments. receptor.
Altogether, these quantifications indicate that: (1) the surface
areas of a 1 and a 2 GlyR subunit clusters are larger when Patchy distribution of cell surface GlyR in
associated with gephyrin immunoreactivity, (2) the surface areas transfected neurons
of a 1-b gb GlyR subunit clusters are independent of their GlyR a subunits can form functional chloride channels upon
association with detectable gephyrin, and finally (3) the presence heterologous expression in HEK 293 cells (Sontheimer et al.,
of the b gb sequence increases the rate of accumulation of the a 1 1989) elicited by receptors evenly distributed in the plasma
subunit at gephyrin-IR postsynaptic differentiations. membrane (Kirsch et al., 1995). The diffuse surface labeling
of GlyR that we found in COS-7 cells is therefore not
surprising. However, the distribution pattern of cell surface
DISCUSSION tagged molecules was dramatically different when neurons
instead of COS-7 cells were transfected: in neurons, normal
Two facts provided the basis for analyzing the non-steady state and mutant a 1, or a 2 subunits formed numerous patches
distribution of exogenous GlyR in neurons. First, all isoforms distributed in the somatodendritic plasma membrane. Patches
2792 J. Meier and others
100 4h 8h 24h differentiation from the association of newly synthesized
receptors with submembranous, pre-existing gephyrin
%) 80 *** *** aggregates (see references in Vannier and Triller, 1997; Betz,
x ( 1998). This key function of gephyrin in directing the
de localization of GlyR to specific sites of the plasma membrane
n
n i 60 was established from the consequences of antisense (Kirsch et
o al., 1993) and knock-out strategies (Feng et al., 1998b). This
ati function is thought to be linked to a cluster-inducing activity
z 40
ali of gephyrin. The present study, however, reveals an unnoticed
c
o property of GlyR in a homologous neuronal context, where
Col 20 normal synaptogenesis takes place: the formation of a 1 or a 2
subunit-based GlyR clusters without the involvement of
0 gephyrin. In our experiments, the GlyR patches generated in
HA-a 1 HA-a 2 HA-a 1-b gb neurons following transfection might have resulted from the
activity of endogenous gephyrin. This is not the case because
Fig. 8. Time-dependent association of HA-tagged subunit clusters tagged GlyR a 1 and a 2 subunits, including the a 1-b gb mutant,
with gephyrin clusters. Experiments were carried out as in Fig. 5 on
formed cell surface clusters independently of detectable
neurons transfected with a 1, a 2 or a 1-b gb 8 days after plating. The
colocalization with endogenous gephyrin. The lack of
colocalization index, expressed as a percentage, was calculated as the
association of either a 1 or a 2 with gephyrin is not unexpected
ratio of the number of gephyrin clusters positive for HA-tag staining
because the sequence so far identified as a gephyrin-binding
to the total number of gephyrin clusters (see Results for definition).
Cells were observed 4, 8 or 24 hours after transfection (n=12 cells site is not present in these polypeptides (Meyer et al., 1995).
for each subunit and each time point). Note that for a 1, the Incorporation of this binding site in a 1 polypeptide leads to a
colocalization index increases significantly (P<0.001) from more extensive association of corresponding clusters with
34.9±4.4% to 72.4±4.51% (*** P<0.001, Scheffe test) within 20 gephyrin. Interestingly, clusters are smaller when not
hours of expression. In contrast, a 1-b gb is very rapidly colocalized associated with gephyrin. The smaller size of the gephyrin-free
with gephyrin and at 8 hours post-transfection reaches a value of clusters might be ascribed to the absence of gephyrin-mediated
81±1.67%***, which is significantly different from that of a 1
interactions between GlyR and microtubules (Kirsch and Betz,
(29±5.39%). In contrast, colocalization of a 2 is stable (66±4.66%)
1995).
and does not increase over time. Values are means ±s.e.m.
Spontaneous clustering of GlyR could explain two sets of
previous observations. First, a careful analysis of inhibitory
of exogenous GlyR in neurons cannot be attributed to a mere synaptogenesis in primary cultures of spinal cord neurons
concentration-dependent aggregation phenomenon, since they indicates that from 3-11 days after plating 8-14% of the GlyR
were not observed in COS-7 cells, which display a high cell clusters are not apposed to inhibitory terminals (Dumoulin, A.,
surface immunoreactivity. Thus, the clusterization of GlyR in Lévi, S., Riveau, B., Gasnier, B. and Triller, A., unpublished).
spinal cord cells is compatible with underlying neuron-specific Second, when motoneurons are cultured in the absence of
mechanisms. glycine- and GABAergic presynaptic innervation, endogenous
In our experiments, it can be assumed that the rate of GlyR as well as GABAAR clusters not associated with
synthesis of exogenous subunits largely exceeds that of synapses are detected at the somato-dendritic surface, some of
endogenous GlyR components, including the b subunit, since them not associated with gephyrin (Lévi et al., 1999). When
the latter are produced during the comparatively slow the inhibitory innervation is permitted, extrasynaptic clusters
maturation process of the cells (Hoch et al., 1989; Béchade et of GlyR and GABAAR become prominently synaptic, but
al., 1996). In the present experiments, cell surface clusters of about 10% of extrasynaptic clusters remain.
exogenous GlyR were first present from 2-4 hours after In neurons, patches formed by the a 1 or a 2 subunit were
transfection, and a large number were detected 8 hours after partially associated with endogenous gephyrin. Therefore, an
transfection (see Fig. 6). It is therefore likely that the bulk of important question was whether or not the exogenous a
a subunits synthesized in transfected neurons assemble into subunits could oligomerize with endogenous b subunit and in
homomeric channels, which account for clusters that are turn explain this postsynaptic location. Although there is
detected at the cell surface. Heterologous expression studies substantial evidence that cultured spinal cord neurons
have clearly shown that a subunits have the ability to self- reproduce the developmental a 2 to a 1 transition (Bormann et
assemble into agonist-gated, strychnine-sensitive GlyRs (e.g. al., 1987; Hoch et al., 1989, 1992; St John and Stephens, 1993),
Sontheimer et al., 1989). Homomeric GlyR may also have a the production of the gephyrin-binding b subunit has never
functional significance in vivo (Bormann et al., 1993), a notion been firmly demonstrated in this system. Western blot analysis
supported by pharmacological studies suggesting that the (see Fig. 4) revealed that synthesis of the b subunit was not
Mauthner cell of the zebrafish brain possesses postsynaptic induced in neurons transfected with any of the a subunits. This
glycine-gated, a /b heteromeric and a homomeric channels further supports the notion that surface exogenous GlyR
(Legendre, 1997). Therefore, the clusters of homomeric GlyR lack gephyrin-binding sites and therefore the b subunit.
are more likely to be functional in transfected neurons. Furthermore, the ratio of exogenous to endogenous GlyR
synthesized per time unit (see above) should lead to a very low,
Association of transfected subunits with gephyrin if any, incorporation of the b subunit in clusters of exogenous
Current evidence indicates that endogenous GlyR-enriched a 1 or a 2 subunits. Consequently, the mechanism of a 1 and a 2
postsynaptic domains at the neuronal surface arise during cell clustering, though to be uncovered, does not rely on an obvious