Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press Genetic Approaches to Facilitate Antibacterial Drug Development DirkSchnappinger DepartmentofMicrobiologyandImmunology,WeillCornellMedicalCollege,NewYork,NewYork10065 Correspondence:[email protected] Very few chemically novel agents have been approved for antibacterial chemotherapies during the last 50yr. Yet new antibacterial drugs are needed to reduce the impact on globalhealthofanincreasingnumberofdrug-resistantinfections,includinghighlydrug- resistantformsoftuberculosis.Thisreviewdiscusseshowgeneticapproachescanbeusedto studythemechanismofactionofwhole-cellscreeninghitsandfacilitatetarget-drivenstrat- egiesforantimicrobialdrugdevelopment. Manyclassesofantibioticsinclinicaluseto- ease that now constitutes as a major public daystemfromthegoldenageofantibiotic healththreat.First-linetreatmentofTBconsists g discovery,whichhaditsmostproductiveperiod ofdrugsoriginallyidentifiedduringthegolden r o from 1940 to 1960 (Davies 2006; Silver 2011). ageofantibioticdiscovery.Togetherwithsocial e. n These drugs are one of the reasons why most changes, these drugs contributed to a drastic ci di bacterialinfectionscanbecuredwithafewpills, reduction of TB cases in Europe and North e m generallywithoutsideeffects,withinacoupleof AmericawhilecontinuingtokillmillionsinAf- n si weeks.Itisthuseasytoforgetthatbacterialin- ricaandAsia.Drug-resistantMycobacteriumtu- e v fectionshaveremainedamajorcauseofprevent- berculosis(Mtb)appearedshortlyaftertheintro- cti abledeathsindevelopingcountriesandcontin- duction of TBchemotherapyandevolved into e p s uetoexertaprofoundimpactonhumanhealth. extremely drug-resistant Mtb, which threatens r e p Therelativepaucityofnovelantibacterialsdis- theTBcontrolprogramsworldwide.Therefore, w. covered after 1960 coincided with the appear- theneedfornewtherapiesfortreatmentofthis w w anceandcontributedtothespreadofdrug-re- deadlydiseaseremainsunchangedsincethepre- sistant bacterial infections. When resistant to antibioticera.Thisreviewdiscusseshowgenetic notonlyone,butmultipledrugs,suchinfections approaches can facilitate the development of threaten to erode a cornerstone of modern drugsforsuchnewtherapies. healthcare. Tuberculosis(TB)isaprimeexampleofhow GENETICSANDCLASSICALWHOLE-CELL treatmenthassucceededindevelopedcountries SCREENING whilemeetingfrequentfailureinthedeveloping nations.Treatmentfailurecontributedtothere- Whole-cellscreening(WCS)-basedantibacteri- emergence of a thought-to-be-conquered dis- aldrugdiscoverybeginswithidentifyingsmall Editors:StefanH.E.Kaufmann,EricJ.Rubin,andAlimuddinZumla AdditionalPerspectivesonTuberculosisavailableatwww.perspectivesinmedicine.org Copyright#2015ColdSpringHarborLaboratoryPress;allrightsreserved AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 1 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press D.Schnappinger molecules (hits) that inhibit bacterial growth. ofthecompoundcanbeexploredinmorede- Thisinhibitor-firstapproachprovidedthefoun- tail. Fourth, and perhaps most importantly, dation of the golden age of antibacterial drug the antibacterialMOAofacompoundisade- discovery and remains the only development terminantofitsinvivopotency.Thisisexem- strategy that has delivered antibacterial drugs plified by recently identifiedpyrimidine-imid- to the clinic (Brotz-Oesterhelt and Sass 2010). azoles, which were active against Mtb in vitro, This includes all first-in-class drug candidates had appropriate pharmacokinetic properties, currently under clinical development for the but showed no potency in Mtb-infected mice treatment of TB (Lechartier et al. 2014). The (Petheetal.2013).Theactivityofthesemole- superiorsuccessrateofinhibitor-firststrategies culesreliedonthepresenceofglycerol,whichis isnotuniquetoantibacterialdrugdevelopment used in many standard liquid media, but it is asphenotypicscreeninghasbeenmoreproduc- not a physiological carbon source. Therefore, tivethantarget-drivenapproachesacrossaspec- lackofinvivopotencyinthesepyrimidine-im- trumofdiseases(SwinneyandAnthony2011). idazoleswasmechanism-based,leavingnopath Severalfeaturescontributetothesuccessof todevelopthesecompoundsfurther. classicalWCS.Thesescreensallowforselective The potential for discovering other com- investmentintothechemicalstructuresthatcan pounds with MOAs that intrinsically have no overcome the major challenge of antibacterial invivopotency(herereferredtoasnovipcom- drugdevelopment:abilitytopenetratethebac- pounds)issignificantbecausescreeningmedia terialcellenvelope.Furthermore,WCSprovides can, at best, only mimic some of the environ- anopportunitytodiscovercompoundsthatin- ments encountered during an infection. More hibitgrowthbydiversemechanisms,including often, they create a physiological context that g those that engage multiple targets. The draw- is quite different from that within the host as r o back isthat the mechanism of all hits remains many standard media contain nutrients Mtb e. n tobedetermined. cannot obtain from the host in the provided ci di Whereas it is not required to understand a form (e.g., iron) (Rodriguez and Smith 2006), e m drug candidate’s mechanism of action (MOA) cannotobtainfromthehostatall(e.g.,biotin) n si to obtain regulatory approval for use in hu- (Sassetti and Rubin 2003; Woong Park et al. e v mans,knowing howacompoundexertsitsbi- 2011),andlacknutrientsthatMtbisapparently cti ologicalfunctionduringdevelopmentisdesir- abletoscavengefromthehost (e.g.,NADpre- e p s able for several reasons. First, many WCS hits cursors)(Boshoffetal.2008).Thesedifferences r e p actinanonspecificmanner(e.g.,asalkylating can cause some mutations to either result in w. w agents or detergents) and therefore cannot be deathofMtbinvitrobutnotduringinfections w developedintodrugs(Payneetal.2007;Roemer (e.g.,mutationsinnadA[Boshoffetal.2008]) and Boone 2013). Second, not all hitsthat are orpreventgrowthduringinfectionsbutnotin toxictothehosthavetobediscardedastoxicity standard media (e.g., mutations required to neednotnecessarilyresultfromacompound’s scavenge iron from the host [Rodriguez and antibacterialactivity.Antibacterialactivityand Smith 2006]). One conceptually straightfor- toxicity are linked if they both stem from in- ward strategy to reduce the risk of identifying hibition of the same target, for example, an novipcompoundsistoscreenagainstintracellu- enzymethatisconservedinboththepathogen larMtb(Christopheetal.2009).However,such and the host. Such compounds are not suited screeningprocedurescanalsorevealgenesthat for further development. However, in cases in arerequiredexvivobutnotduringaninfection which the mechanism of toxicity differs from (Munoz-Eliasetal.2006).Furthermore,Mtbin- that of bacterial growth inhibition, chemical ducesacomplexanddynamicpathologyandcan modificationscansometimeseliminateacom- befoundinmultipledifferentintracellularand pound’stoxicitywithoutcompromisingitsan- extracellularlocations(Barryetal.2009;Dartois tibacterial activity. Third, after identifying the andBarry2013).Someoftheselocationspermit target,thestructureactivityrelationship(SAR) the pathogen to replicate, whereas others may 2 AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press AntibacterialDrugDevelopment restrictitsgrowthandyetallowitspersistence. dium of reference profiles to which the RNA Therefore,itseemsimpossibletodesignscreen- profile induced by dyclonine could be com- ing conditions that mimic the pathophysiol- pared. Pattern matching algorithms revealed ogical context of an Mtb infection in humans thatdycloninecausedchangessimilartothose well enough to completely bias against novips. inducedbymutationsintheergosterolpathway. ThebestinsuranceagainstMOA-basedattrition This suggested that dyclonine inhibited sterol is therefore a solid understanding of a com- biosynthesis and follow-up experiments con- pound’sMOA. firmedthesterolisomeraseErg2pasatargetof dyclonine.Thispatternmatchingapproach,as illustrated in Figure 1, has since been used to GeneticStrategiesforStudyingthe uncover targets and the MOA of many other MOAofBioactiveSmallMolecules’ antimicrobialcompounds(BrazasandHancock RNAProfiling 2005; Smith et al. 2010; Wecke and Mascher Acell’sgenome-wideRNAprofileisdefinedby 2011).Indeed,Mtbmicroarrayswerefirstused theabundanceofthetotalRNAproducedata to study the effect of isoniazid on the RNA given time. Taking snapshots of these profiles profile of Mtb (Wilson et al. 1999). Hundreds becamestraightforwardafterDNAmicroarrays of compound-induced RNA profiles were re- wereinvented(Schenaetal.1995;Lashkarietal. ported5yrlaterinalandmarkstudybyBoshoff 1997),andtheycannowbereportedwitheven et al. (2004). These profiles helped to investi- higherresolutionbysequencingtotalRNAex- gateavarietyofantimycobacterialsmallmole- tracts (Nagalakshmi et al. 2008; Wilhelm et al. cules,includingcapreomycin(FuandShinnick 2008; Arnvig and Young 2012). The foremost 2007), isoniazid (Karakousis et al. 2008), PA- g study to show the use of genome-wide RNA 824 (Manjunatha et al. 2009), an inhibitor r e.o profiling forcharacterizing the MOAof bioac- of menaquinone production (Dhiman et al. n tivemoleculeswasperformedwiththeanesthet- 2009), b-lactams (Slayden and Belisle 2009), ci di icdyclonine(Hughesetal.2000).Hughesetal. vancomycin (Provvedi et al. 2009), the benzo- e m collectedSaccharomycescerevisiaeRNAprofiles thioazinone, BTZ043 (Makarov et al. 2009), n si induced by hundreds of different genetic or the natural product chelerythrine (Liang et al. e v chemicaltreatments.Thisgeneratedacompen- 2011),thioridazine(Thorsingetal.2013),and cti e p s r e p w. w w Compound No drug RIF INH of unknown MOA No drug RIF INH Compound of unknown MOA Figure1.RNAprofiling.RNAmoleculesproducedbyfourgenesoftheMtbgenomewithandwithoutdrug treatmentarerepresentedascoloredlines.ThecolorofthesquaresdepictedbelowtheRNAmoleculesreflects theirabundance,withdarkercolorsidentifyingmoreabundantRNAs.Thefictionaldataherewouldsuggestthat thecompoundofunknownMOAfunctionsinamannersimilartoRIF. AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 3 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press D.Schnappinger severalotherWCShits(Stanleyetal.2013;Wang parently identical experiments can be a chal- etal.2013). lenge. Description of all experimental details, The principal limitations of RNAprofiling strictstandardization, andavoidanceofproce- aretwofold.First,these profiles failto identify duralchangesofgeneexpression(ascanoccur, the direct target of a compound as they only forexample, bycentrifugation of live Mtb)are reveal the biological pathway(s) that respond therefore crucial for producing informative to the drug. In part, this is because inhibition RNAprofiles. of different proteins can produce similar RNA profiles,suchasinsituationsinwhichthepro- SelectionandIdentificationofResistance teins form a complex or are required for the Mutations same metabolic pathway. Second, the profiles (and other pattern matching approaches) are Thefirstindicationthatbedaquiline(BDQ,for- mostinformativeforcompounds,whichinduce merly known as TMC207 and originally pub- a signature similar to the compounds with a lishedasR207910)preventsthegrowthofMtb known MOA. Specific predictions are difficult byinhibitingtheadenosinetriphosphate(ATP) tomakeforcompoundswithanentirelynovel synthasewasprovidedby themutantsselected MOAasappropriatereferenceprofilesarelack- fortheirabilitytogrowinthepresenceofBDQ ing in such cases. This drawback can be over- (Andriesetal.2005).Whole-genomesequenc- come by enriching the reference compendium ingoftheseBDQ-resistantstrainsrevealedpoint withRNAprofilesfromgeneticallydefinedmu- mutationsinatpE,whichencodessubunitcof tants(Hughesetal.2000;Mnaimnehetal.2004; ATPsynthase.Geneticandbiochemicalstudies Freiberg et al. 2005). Unfortunately, too few furtherestablishedthatBDQinhibitsATPsyn- g such profiles are available for Mtb to apply thesisbybindingtoAtpE,thusconfirmingATP r o this principle to facilitate the analysis of anti- synthase as a direct target (Koul et al. 2007). e. n mycobacterialcompounds. Selecting for resistance followed by whole-ge- ci di Evenforrelativelysmallbacterialgenomes, nomesequencing(Fig.2A)hasidentifiedmu- e m genome-wide RNA profiles consist of thou- tations that permit growth in the presence of n si sands of individual measurements. This com- several other small molecules with antimyco- e v plexity offers the potential to generate unique bacterialactivities.Examplesincludemutations cti signatures for many bioactive small molecules in genes involved in respiration (qcrB) (Abra- e p s while making it difficult to identify the most hamsetal.2012b;Petheetal.2013),fattyacid r e p informativeRNAs.Theamountof datagener- synthesis (inhA) (Hartkoorn et al. 2012), pro- w. w ated by RNA profiling is not only large, but teinsynthesis(aspS)(Ioergeretal.2013),pro- w more importantly, the biological responses to teinsecretion(eccB3)(Ioergeretal.2013),poly- growth perturbation are often complex. This ketidebiosynthesis(pks13)(Ioergeretal.2013; foremost applies to RNA profiles collected at Wilson et al. 2013), mycolic acid transport timepointsoratdrugconcentrationsthatim- (mmpL3)(Grzegorzewiczetal.2012;LaRosaet pacttheabundanceofhundredsofRNAs.The al.2012;Stanleyetal.2012;Tahlanetal.2012; nonspecific stress responses contained in such Ioergeretal.2013;Remuinanetal.2013),and profiles can mask a compound-specific re- arabinogalactan synthesis (dprE1) (Christophe sponse. Reducing the treatment time and/or et al. 2009; Makarovet al. 2009; Magnet et al. drugconcentrationoftensimplifiestheanalysis 2010;Stanleyetal.2012;Wangetal.2013). of bioactive molecules by RNA profiling. Fur- Resistance mutations can directly identify thermore,theabilityofgenome-wideRNAanal- high-value drug targets. Selection and identi- ysestodetectminutechangesinanysinglegene fication of such mutations requires no target- coupledwitha highlydynamic transcriptional specific assay development, can be fast, and is response prevalent in bacteria increases the comprehensiveasitsurveystheentiregenome. existing complexity by severalfold. Therefore, However, this approach is not without limita- obtainingverysimilarRNAprofilesintwoap- tionsandfailswhenaresistantstraincannotbe 4 AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press AntibacterialDrugDevelopment A B C Underexpressor Select Growth drug-resistant without drug mutant WT Whole-genome sequencing Growth with drug Overexpressor GATAAATCTGGTCTTATTTCC g Wild type g/u Growth owth with druwth without dr GATAAATCTGGCCTTATTTCC Drug Grgro Mutant Figure2.ForwardandreversegeneticapproachestoinvestigatesmallmoleculeMOAs.(A)Selectionofresistant mutants. Mutants that are resistant to the compound are selected on agar plates supplemented with the g compound of interest. The mutations present in these resistant isolates are identified by whole-genome se- r e.o quencing.(B)Under/over-expression.Reducingorincreasingtheexpressionofacandidatetarget(blackcircles) n caneitherdecreaseorincreasetheMICofacompound(yellowtriangle)inhibitingthetarget.(C)Phenotyping dici pooledmutants.Mutantsarelabeledwithageneticbarcodeandtheirfitnessisanalyzedinacompetitivegrowth e experiment.Thisprinciplecanbeappliedtodeletionmutants,underexpressors,overexpressors,oramixof m n thesestrains.Theorange-labelmutantshowsincreasedsensitivitytothetesteddrug;theblack-labeledmutant esi (whichisonlyshowninthegraph)showsdecreasedsensitivity. v cti e p s obtained. Furthermore,alterationofthetarget LinkingSmallMoleculestoCandidate r e p responsible for the growth inhibitory effect of TargetsbyIncreasingorReducing w. w a small molecule constitutes only one of the GeneActivity w several mechanisms by which mutations can impart resistance. Alternatively, methods such TobedirectlyinvolvedintheMOAofabioactive as chemical inactivation, efflux, or failure to small molecule, a protein hasto physically in- transform an inactive prodrug into its active teract with that small molecule. That a candi- derivativecanformthebasisofresistance.The date protein has the potential for such an in- knowledge of mutation frequencies that cause teractionwithinlivebacteriacanbeconfirmed resistance by these mechanisms proves highly indirectlybyshowinganimmediatecorrelation useful to determine the value of acompound. betweentheprotein’sabundanceandthemin- A high frequency of resistance owing to such imalinhibitorconcentrationrequiredtoinhib- mechanisms significantly devalues the com- itgrowth(MIC)(Fig.2B).Thistypeofexperi- pound. However, this knowledge rarely plays ment has helped to clarify the MOA of INH a role in defining acompound’s MOA. Never- (isoniazid), which was debated to impair one theless, in scenarios in which a mutation can of two enzymes involved in fatty acid biosyn- bemappedtoatruetarget,resistancemutation thesis,InhAorKasA.Strainsthatoverexpressed provides one of the simplest ways to define a theseproteinswereanalyzedfortheirsuscepti- compound’sMOA. bilitiestoINHandtheKasAinhibitorthiolac- AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 5 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press D.Schnappinger tomycin (TLM). Overexpression of InhA in- family will increase the MIC even when only creased the MIC of INH but did not change one family member isthe physiological target. the MIC of TLM; overexpression of KasA had This has been discussed for inosine-50-mono- the opposite effect (Larsen et al. 2002). These phosphate (IMP) dehydrogenases (GuaB1/2/ resultssupportedtheviewthatInhAandKasA 3) (Usha et al. 2011), ketoacyl-ACP synthases are primary targets of INH and TLM, respec- (KasA/B)(Brownetal.2009),andmethionine tively.Similaroverexpressionstudieshaveoften aminopeptidases (MapA/B) (Olaleye et al. beenperformedwithMycobacteriumsmegmatis 2010). In some of these cases, the MIC may in which the MOA of different inhibitors was have increased because the overproduced pro- linked to one or more targets, including D-cy- tein sequestered the inhibitor from its physio- closerine to alanine racemase (Alr) and D-ala- logicaltarget. D-alaligase(Ddl)(FengandBarletta2003),pla- As target overexpression should increase a tensimycin to KasA and KasB (Brown et al. compound’s MIC, so should target underex- 2009),ethambutoltothearabinosyltransferases pression decrease the MIC (Fig. 2B). This was EmbBandEmbC(Goudeetal.2009),andcer- indeedobservedforseveralconditionalM.smeg- tain diphenylurea compounds to inosine mo- matis knockdown mutants described recently. nophosphate dehydrogenase (Olaleye et al. Underexpression of gyrase subunit A (GyrA, 2010;Ushaetal.2011). target of quinolones [Sugino et al. 1977], Alr In mycobacteria, overexpression has pri- [Caceres et al. 1997], dihydrofolate reductase marilybeenusedtoevaluatetheroleofspecif- [DHFR, target of trimethoprim] [Schweitzer ic candidate target proteins for compound etal.1990],RNApolymerasesubunitB[RpoB, activity,butitcanalsoprovideameanstofind targetofRIF][Lancinietal.1969]),andprotein g candidate targets foracompound with an en- biotin ligase (BirA, target of BioAMS [Duck- r o tirely unknown MOA. To achieve this, librar- worth et al. 2011]) sensitized M. smegmatisto e. cin ies of overexpression clones are systematically ciprofloxacin, D-cycloserine, trimethoprim, di screened for those that improve growth in the RIF, and BioAMS, respectively (Duckworth e m presenceoftheinhibitor.Suchascreen,which et al. 2011; Kim et al. 2010; Wei et al. 2011). n si usedanorderedlibraryofoverexpressionclones Similar observations were made with Mtb, in e v forallessentialEscherichiacoligenes,identified whichpartialgeneticinactivationofthebiotin cti the lipoprotein chaperon,LolA, asacandidate synthesis enzyme BioA or DHFR increased its e p s target of the novel antibacterial compound, susceptibility toward the novel inhibitors of r e p MAC12343. Biochemical studies confirmed these enzymes (Shi et al. 2011; Kumar et al. w. w that MAC12343 binds LolA and perturbs 2012). For many of these mutants, it was also w lipoprotein trafficking (Pathania et al. 2009). shownthattheyweremoststronglysensitizedto Similaroverexpressionlibrariesareundercon- inhibitors of the partially depleted protein. struction forMtbandwillhopefullybeavaila- These and otherdata(Giaeveret al. 1999; De- blesoon. Vitoetal.2002;Lumetal.2004;Yinetal.2004; A complication of overexpression screens, Donaldetal.2009;Abrahamsetal.2012a;Ol- especially when using random libraries, is the lingeretal.2012)confirmedthatpartialdeple- frequent isolation of efflux pumps. These tionofaninvitroessentialproteinoftencauses pumpsincreaseresistancebyloweringtheintra- compound-specific MIC shifts and can thus cellularconcentrationofthecompoundunder provideinformationontheMOAofabioactive investigation, and their isolation does not re- smallmolecule.However,asisthecaseforover- vealacompound’sMOA.Difficulttointerpret expression, underexpression studies by them- MIC shifts can also occurif the candidate tar- selvesarenotsufficienttoclaimtheunderpro- getbelongstoaproteinfamilyofwhichsever- ducedproteinastheMICdeterminingtargetof al members are encoded in the same genome. aninhibitor,asunderexpressioncouldalsode- Iftheinhibitorbindingsiteisconserved,over- creasetheMICbysensitizingotherenzymesin expression of any member of such a protein thesamepathwaytochemicalinhibition. 6 AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press AntibacterialDrugDevelopment Thatunderexpressionneverthelessprovides pound’s activity. Evidence for this came from a powerful tool for identifying candidate tar- several studies including those that used the gets is apparent from work with S. cerevisiae. E.coliKeiocollection.Thislibrarycontainsal- Construction of underexpressors is relatively most 4000 mutants each of which has a sin- straightforward in S. cerevisiae and is often gle gene deleted. Of these 4000 mutants, 283 achieved with deletion of one gene copy. Such showed greater sensitivity thanwild type to at heterozygous deletion strains are available for least one of the 14 different antibiotics tested almost all S. cerevisiae genes including those (Tamae et al. 2008; Liu et al. 2010). Whereas thatareessentialfornormalgrowth.Thismu- some strains were more susceptible to several tant collection has been used extensively to classesofantibiotics,otherswereonlysensitized study the MOA of bioactive small molecules tocompoundswiththesameMOA(Girgisetal. by drug-induced haploinsufficiency profiling 2009;Liuetal.2010).Thedrugsensitivitypro- (HIP). HIP measures the effect of sublethal filesofthelattermutantscanbeusedtoclassifya drugconcentrationsontherelativegrowthrates compound’s MOA with strategies similar to ofindividualmutants(Fig.2C).Primarily,these thoseimplemented inRNAprofiling.Thedis- studies confirmed that the mutants of known criminative power of these profiles can be en- targetsofantimicrobialagentsareamongthose riched with mutations that decrease antibiotic mostsusceptibletogrowthinhibitionbythere- susceptibility,whichinE.coliareasfrequentas spectivedrug(Giaeveretal.1999,2004;Lumet those that increase susceptibility (Girgis et al. al. 2004) and were later implemented in iden- 2009). tification of novel candidate targets for estab- The homozygous deletion mutants in S. lisheddrugs.ThisincludedtherRNAprocessing cerevisiaeareequivalenttotheE.coliKeiomu- g exosome,whichwaspredictedbyHIP(Giaever tants.Chemicalprofilingofsuchmutants(ho- r o etal.2004;Lumetal.2004)andconfirmedby mozygous deletion profiling, HOP) has been e. n variousexperiments(Fangetal.2004;Hoskins particularly useful for compounds whose pri- ci di andScottButler2007;HoskinsandButler2008; mary target is not a protein. For example, me Kammleretal.2008)tobeinvolvedintheMOA HOP of (cid:2)4700 S. cerevisiae mutants revealed n si of the anticancer drug 5-fluorouracil. In the thatfitnessdefectscausedbydeletionofgenes e v opportunisticpathogenCandidaalbicans,HIP involved in DNA repair or in survival during cti helpedtoidentifytheguaninemonophosphate DNAdamagecanbediagnosticforDNA-dam- e p s synthase(Rodriguez-Suarezetal.2007),afatty aging agents. In fact, the profiles of these mu- r e p acid desaturase (Xu et al. 2009), and poly(A) tants were distinct for chemicals that damage w. w polymerase(Jiangetal.2008)astargetsofnovel DNA by different mechanisms as they could w inhibitors.Experimentsconceptuallysimilarto distinguish compounds that generate inter- HIPhavebeenperformedinbacteriawheregene strand cross-links from those that do not (Lee expression can be efficiently reduced by anti- et al. 2005). The interpretation of HOPexper- sense RNAs (Donald et al. 2009; Huber et al. iments can be facilitated by data from genetic 2009; Xu et al.2010). Unfortunately,antisense interaction studies. Two genes are defined as RNAs have only rarely been efficient in Mtb. interactingifthephenotypeoftheirdoublemu- Currently, the generation of a large collection tant deviates from the expected phenotypes of ofMtbunderexpressorsdependsonapproaches thetwosinglegenemutants(Dixonetal.2009). thatrequirehomologousrecombinationduring InS.cerevisiae,manysuchdigenicinteractions mutantconstruction,suchastranscriptionalor havebeendefined.Theseinteractionsarevalu- proteolyticsilencing(Ehrtetal.2005;Weietal. able for analyses of bioactive small molecules 2011). asthe genetic interaction profile of a gene can WCS hits are growth inhibitory by defini- besimilar totheHOPprofileofasmallmole- tion and thus should primarily target the es- cule and thus link the small molecule to the sential gene products. Nevertheless, mutations respectivegene(Parsonsetal.2004,2006;Cos- in nonessential genes often modulate a com- tanzoetal.2010). AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 7 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press D.Schnappinger FACILITATINGTARGET-BASEDDRUG toxicityinhibitors,(4)amenabletobiochemical DISCOVERY HTS,and(5)requiredforbacterialgrowth(or survival) in a manner that its partial inactiva- Target-based approaches typically begin with tion suffices to improve a patient’s health. a screen for inhibitors of a purified enzyme. Showing that a target fulfills all these criteria Unfortunately,mostinhibitorsidentifiedinsev- requires asmall-moleculeinhibitor thatissafe eralhigh-throughputscreenings(HTSs)against for use in humans (i.e., a drug). Trying to de- bacterial enzymes had no activity against live velop drugs against new targets, therefore, al- bacteria (Payne et al. 2007). Nevertheless, tar- waysbearstheadditionalriskthatcomesfrom get-basedapproacheshavetheirownadvantag- working against a target that is yet to be fully es.Primarily,MOAstudiesaremorestraightfor- validated.Thisadditionalriskappliestoinhib- wardforatarget-basedapproachthanforWCS itorsidentifiedfromeitherWCSorbiochemical hits.Forexample,abisubstrateinhibitor(Bio- screensandisoneofthefactorscausingthehigh AMS)designedtoinactivatetheproteinbiotin rate of attrition of compounds with entirely ligase (BirA) was recently found to inhibit the novelMOAs(KolaandLandis2004). growthofMtb.ThestudyconductedbyDuck- Druggabilityassessmentsevaluatepotential worthetal.(2011)examinedtheimpactofBio- bindingpocketsbycomputationalorchemical AMSongrowthandbiotinylationofproteinsin methods(Perotetal.2010;BarelierandKrimm M.smegmatisandMtb.Asexpected,theactivity 2011; Fauman et al. 2011); sequence conser- of BioAMS (but not of INH or ethambutol) vation—within bacteria and between bacterial againstMtbandM.smegmatisdirectlycorrelat- and human homologs—can be assessed with edwithexpressionofBirA,andgrowthinhibi- genomesequencedata.Animportantcontribu- tioncoincidedwiththedepletionofbiotinylated g tion of genetics to the evaluation of potential or proteins.Together,thesestraightforwardobser- targetsisitsabilitytodeterminetheimportance ne. vationsconfirmedBirAastheprimarytargetof of a potential target for growth and survival. ci BioAMS (Duckworth et al. 2011). The second di Themostcompletesourceforthisinformation e main advantage of target-based approaches is m stems from transposon mutagenesis. Many of n that they can survey a much larger chemical si the genes that Mtb requires to grow normally e space thanwhat can be covered in phenotypic v in vitro (Sassetti et al. 2001, 2003), in macro- cti screens,especiallyiffragment-basedapproaches phages (Rengarajan et al. 2005), or in mouse e p areincluded(Scottetal.2012).Thisissignifi- s spleens (Sassetti and Rubin, 2003) were de- r e cant because the physicochemical properties p finedbytransposonsitehybridization(TraSH). w. ofmostmoleculesinatypicalWCSlibraryare w TraSHusesDNAmicroarraystosimultaneously w different from those of known antibacterials mapandanalyzethephenotypicconsequences (Brotz-OesterheltandSass2010). ofthousandsoftransposoninsertions.Recently, Tn-seq, which uses next-generation DNA se- quencinginsteadofmicroarrays,hasimproved ThePowerandLimitsofGeneticTarget these analyses by providing single-nucleotide Validation resolutionandalargerdynamicrange(Griffin Choosing a poor target will doom a target- et al. 2012; Zhang et al. 2012, 2013). TraSH based drug discovery program from the start, andTn-seqhavecontributedmoretothephe- yetthismightbecomeobviousonlyafter years notypic characterization of gene functions in of work and millions of dollars have been in- Mtbthananyothergeneticapproach.However, vested. Identifying appropriate targets is thus they are not ideal tovalidate gene products as crucial. Ideally, the selected protein should be targets for drug development for two reasons. (1)conservedamongallisolatesofthetargeted First, TraSH and Tn-seq can identify in vitro pathogen(s), (2) susceptible to inhibition bya essentialgenes,butneitherapproachgenerates smallmolecule, (3)differentenoughfromany mutantsforsuchgenesthatcould beanalyzed human homolog to allow development of low underavarietyofconditions.Inthesameman- 8 AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press AntibacterialDrugDevelopment nerasWCScanidentifynovipcompounds,ge- ficient to rapidly eliminate culturable bacteria neticscreenscanidentifynoviptargets(i.e.,tar- from mouse lungs and spleens during acute getswhoseinactivationkillsMtbunderaspecific and chronic infections (Kim et al. 2013). Es- in vitro condition but does not prevent per- sentialityofNadEforviabilityofMtbunderall sistenceorevengrowthinanimalsorhumans). conditions tested so far strongly suggests that Itisthereforeimportanttoevaluatetheroleofa this enzyme is also required for growth and geneproductforsurvivalunderavarietyofcon- survival under most (if not all) conditions ditions including those that induce nonrepli- that Mtb encounters in humans. Whether it cating persistence. For genesthat Mtb requires allows the development of small-molecule in- togrowunderstandardlaboratoryconditions, hibitors that would be safe for use in humans whichareamongthemostattractivetargetsfor remainsto beshown. drugdevelopment,theseanalysesrequirecondi- ThesecondlimitationofTraSHandTn-seq tionalknockdownmutants. is that they do not allow measurement of the The construction of conditional knock- extenttowhichageneproductneedstobein- down mutants in Mtb became possible with activatedtoimpairgrowth.Althoughtheimpact the development of chemically controlled ge- ofatransposoninsertionongenefunctioncan neticswitchesformycobacteria(Schnappinger vary with its insertion site, the phenotypes re- and Ehrt 2014). Many of the switches devel- portedbyTraSH/Tn-seqareoftenattributable oped for mycobacteria depend on placing the toinsertionsthatcreateanullallele.Complete gene of interest downstream from a modified inactivationofaproteininlivebacteriaisrarely, promotersothatitstranscriptioncanberegu- ifever,achievedbysmallmolecules.Thepheno- lated by a tetracycline repressor and a tetracy- typesthat are caused by complete deletion are g cline derivative (Blokpoel et al. 2005; Carroll thuslessrelevanttoevaluatinganewtargetfor r o et al. 2005; Ehrt et al. 2005; Klotzsche et al. drugdevelopmentthanthosethatresultfromits e. n 2009; Boldrin et al. 2010). These regulatory partialdepletion.Allotherfactorsbeingequal,a ci di systemsfacilitatedtheanalysesofseveralgenes protein that needsto be inactivated by .90% e m inMtb(SchnappingerandEhrt2014),butthey (orless)isamoreattractivetargetthanonethat n si dependonsecondaryevents,mostnotablycell needsto be inhibited by 90% before growth is e v division,todepletetheproteinofinterest.They inhibited.Thatvulnerabilityofmycobacteriato cti are therefore less suited to study the impor- partialdepletionindeedvariesamongdifferent e p s tanceofgenefunctionsforsurvivalofnonrep- essentialproteinswasfirstshowninM.smegma- r e p licating Mtb.Analysesofnonreplicating bacte- tis.Forexample, HIV-protease-induced degra- w. w ria can be performed more efficiently with dation depleted M. smegmatis of .97% of w regulatorysystemsthatdirectlyincreaseprotein DHFR and Alr, but this depletion onlyslowed turnover.InMtb,thiscanbeachievedbymod- growth down. In contrast, even modest deple- ifying a gene’s 30 end so that it encodes the tionofRpoBwassufficienttostopgrowthen- sequence of the DASþ4 degradation tag (Kim tirely(Weietal.2011).Unfortunately,theextent etal.2010).Conditionalityisachievedbycon- of functional inactivation that is necessary to trollingtheexpressionofaprotein(SspB)that impair the growth of Mtb is known only fora activates the degradation tag. Recently, tran- few proteins, including BioA and PptT, which scriptionalandproteolyticmodesofregulation arerequiredforthesynthesisofbiotinandpoly- have been combined in a dual-control (DUC) ketides,respectively.Mtbisnotparticularlyvul- switch, which can achieve efficient and robust nerabletopartialinactivationofeitherenzyme, gene inactivation in growing and nonreplicat- asbothrequiretobedepletedby.90%toaffect ing Mtb (Kim et al. 2013). Application of the growth (Woong Parketal.2011; Leblancet al. DUCswitchtoanalysesoftheNADsynthetase 2012). Applying conditional gene inactivation (NadE) identified this enzyme to be essential systems to the characterization of more genes for survival of both replicating and nonrepli- willhopefullyidentifyproteinsthatneedtobe catingbacteria.Itsinactivationwasfurthersuf- depleted.90%tostopMtbfromgrowing. AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139 9 Downloaded from http://perspectivesinmedicine.cshlp.org/ on January 22, 2023 - Published by Cold Spring Harbor Laboratory Press D.Schnappinger Target-DirectedWCS 2000 million (Adams and Brantner 2006; Paul et al. 2010). Late-stage attrition can therefore ClassicalWCSoftenrequirescomplexstudiesto draintheresourcesofcommerciallyunattractive define the MOA of hits; biochemical screens areas,likeantibacterialdrugdevelopment,and rarelyidentifyinhibitorsthatcanpenetratethe causethemtofailentirelyoveralongperiodof bacterial cell envelope. Both difficulties can be time.Thetwomaincausesoflate-stageattrition overcomewithtarget-directedWCS.Theprin- arelackofsafetyandefficacyinpeople(Kolaand ciple of this approach was first established in Landis2004;Bennani2012).Predictingclinical Staphylococcusaureus.OverexpressionofafabF efficacy will remain imprecise. However, if we antisense RNA caused the 50 end of the fabF understand the MOA of the drug candidates mRNA to be degraded. This decreased the ex- that are being tested in the clinic, it should be pression of FabF, an enzyme required for fatty possibletoavoidtrialswithchemicallydifferent acid biosynthesis, and increased the sensitivity compounds that fail for the same mechanistic of S. aureus to FabF inhibitors (Young et al. reasons.Thegeneticapproachesdiscussedhere 2006). Agardiffusion assays werethen used to havehelpedtocharacterizetheMOAofseveral screensmall-moleculelibrariesagainstwild-type antibacterial compounds. However, the MOA S. aureus and the FabF underexpressor. Mole- of manyantibacterials is complex and new in- cules that were more active against the under- sightsarestillgainedintotheMOAofdrugsthat expressorincludedplatencinandplatensimycin, have been in clinical use for decades (Chakra- two novel inhibitors of fatty acid biosynthesis bortyetal.2013).Nosingleapproachwillthere- with broad-spectrum activity against Gram- fore be sufficient to define the MOA of most positivebacteria(Wangetal.2006,2007;Jaya- antibacterials.Studiesthatcombineseveralap- suriyaetal.2007;FischbachandWalsh2009).In g proaches—forexample,underexpression,over- or Mtb,transcriptionalrepressioninsteadofanti- expression,resistanceselection,andbiochemi- e. sense RNA has been used to generate mutants n calstudies(Huberetal.2009)—promisetobe ci expressinglowerthanwild-typelevelsofpanto- di themostsuccessful.Drugcandidateswithnovel e thenatesynthase (PanC),diaminopimelatede- m MOAsareattractivebecausetheycouldimprove n carboxylase(LysA),isocitratelyase(Icl1),orthe si TB chemotherapy fundamentally (e.g., by re- e typeIsignalpeptidase(LepB).Inaddition,these v ducing its duration). But they bear a higher cti recently constructed mutants show target-spe- riskoflate-stagefailureiftheyinactivatetargets e p cificchangesin theirsusceptibility todifferent s thathavenotyetbeenclinicallyvalidated.Mea- er small-molecule inhibitors (Abrahams et al. p suringtheeffectsthatcanbeachievedbyinacti- w. 2012a; Ollinger et al. 2012). WCS with these w vatingsuchnoveltargets(e.g.,bygeneticmeans) w strainspromisestoidentifynewinhibitorsthat inavarietyofassays,includinganimalmodels, areabletoreachthecytoplasmofMtbandin- seemsprudent. hibitadesiredtarget. Second,geneticscanalsocontributetodrug developmentbyprovidingsingle-geneunderex- pressorsthathelpincreasethesensitivityofWCS CONCLUDINGREMARKS andbiashitstowardadesiredtarget.Underex- Noneoftheapproachesdiscussedinthisreview pressorscanfurthermorebeusedinasecondary existedduringthegoldenageofantibioticdis- assay to evaluate biochemical HTS hits. This covery,andantibacterialdrugdiscoverycanbe distinguishes compounds that penetrate the pursued without them. However, modern ge- bacterialcellenvelopepoorly(andarenotactive neticscanhelpimproveaprocessthathasdeliv- against wild type but active against an under- eredfewnovelmolecularentitiesduringthelast expressor) from those that do not penetrate at 50yr.Oneimportantcontributionwouldbeto all(andareactiveneitheragainstwildtypenor help reduce late-stage attrition (i.e., failure in theunderexpressor).Suchcompoundscouldbe clinical trials). The cost of introducing a new starting points for medicinal chemistryefforts drugtothemarketvariesbetweenUS$500and toimprovecompoundefficacyagainstwild-type 10 AdvancedOnlineArticle.CitethisarticleasColdSpringHarbPerspectMeddoi:10.1101/cshperspect.a021139
Description: