Gene expression and antiviral activity of interleukin-35 in response to influenza A virus infection

31 Pages·2016·1.37 MB·English

JBC Papers in Press. Published on June 15, 2016 as Manuscript M115.693101
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M115.693101
IL-35 mediates antiviral activity
Gene Expression and Antiviral Activity of Interleukin-35 in Response to Influenza A Virus Infection

Li Wang, Shengli Zhu, Gang Xu, Jian Feng, Tao Han, Fanpeng Zhao, Ying-Long She, Shi Liu,
Linbai Ye, Ying Zhu*

The State Key Laboratory of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei
430072, China

Running title: IL-35 mediates antiviral activity

* To whom correspondence should be addressed: Address correspondence and reprint requests to Ying
Zhu, Ph.D., the State Key Laboratory of Virology and College of Life Sciences, Wuhan University,
Wuhan 430072, China. Tel: [phone]; Fax: [phone]; Email: [email protected]
D
ow
n
Keywords: IL-35, IAV, NF-κB/p65, antiviral activity, IFN loa
d
e
d
  fro
m
ABSTRACT leading to activation of downstream IFN effectors, h
ttp
Interleukin (IL)-35 is a newly described including double-stranded RNA-dependent ://w
w
member of the IL-12 family. It has been reported protein kinase, 2’, 5’-oligoadenylate synthetase, w
.jb
to inhibit inflammation and autoimmune and myxovirus resistance protein. IL-35 exhibited c.o
rg
inflammatory disease, and can increase apoptotic extensive antiviral activity against the hepatitis B b/
y
g
sensitivity. Little is known about the role of IL-35 virus, enterovirus 71, and vesicular stomatitis u
e
s
during viral infection. Herein, high levels of IL-35 virus. Our results demonstrate that IL-35 is a t on
A
were found in peripheral blood mononuclear cells novel IAV-inducible cytokine, and its production pril 5
and throat swabs from patients with seasonal elicits antiviral activity. , 2
0
1
influenza A virus (IAV) relative to healthy 9
individuals. IAV infection of human lung Seasonal influenza A virus (IAV) is a
epithelial and primary cells increased levels of common human infection, resulting in significant
IL-35 mRNA and protein. Further studies morbidity and mortality (1). It is a negative-sense
demonstrated that IAV-induced IL-35 transcription RNA virus of the Orthomyxoviridae family (2).
is regulated by NF-κB. IL-35 expression was IAV attaches to membrane receptors and enters
significantly suppressed by selective inhibitors of epithelial, macrophage, and dendritic cells (3).
cyclooxygenase-2 (COX-2) and inducible nitric These cells release large quantities of antiviral and
oxide synthase (iNOS), indicating their immunostimulatory cytokines during IAV
involvement in IL-35 expression. Interestingly, infection. An extensive array of cytokines and
IL-35 production may have suppressed IAV RNA chemokines are produced by host cells in response
replication and viral protein synthesis via to IAV infection, including interleukin (IL)-1, IL-2,
induction of type I and III interferons (IFN), IL-8, IL-10, IL-15, IL-18, IL-27, IL-32, TNF-α,
1 

Copyright 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
IL-35 mediates antiviral activity
IFN-α/β/γ , MIP-1α/β (4-7), and other cytokines be required for maximal suppressive activity (27).
and related pathway factors (1,8). There remain While studies report that IL-35 is expressed in
many unknown cytokines induced by and patients infected with the hepatitis B virus (HBV)
involved in the response to IAV infection. Further (29-31), the role of IL-35 during infection,
investigation of factors activated by IAV infection particularly, IAV infection is largely unknown.
is critical to better understand host-virus Herein, we show that IL-35 expression is
interaction and advance antiviral research. induced by IAV infection and is regulated by the
IL-35 is the newest member of the IL-12 transcription factor, NF-κB. The inflammatory
family, which includes IL-12, IL-23, and IL-27 (9). factors, cyclooxygenase-2 (COX-2) and inducible
These proteins are comprised of an α (p19, p28, nitric oxide synthase (iNOS), may also be
p35) and β (p40, EBI3) chain (10). IL-35, involved in this signaling cascade. IL-35 also
originally named by Niedbala et al. (11), consists activated the IFN pathway and indirectly elicited
of an IL-12/p35 and IL27/EBI3 chain. antiviral activity in response to viral infection.
D
Epstein-Barr virus-induced gene 3 (EBI3) encodes Our results provide a basis for further ow
n
a 34-kDa glycoprotein homologous to IL-12/p40 investigation of the relationship between IAV and loa
d
e
d
(12). EBI3 heterodimerizes with p35, forming a IL-35 and suggest that IL-35 might be a potential fro
m
hematoprotein in BJAB B lymphoma, COS7, and novel target for antiviral therapies. h
ttp
human placental trophoblast cells (13). IL-35 ://w
w
signals conduct through either a unique RESULTS w
.jb
heterodimer of IL-12Rb2 and gp130 or IL-35 expression is elevated in patients c.o
rg
homodimers of each chain (14). infected with IAV—IL-35 consists of the b/
y
g
IL-35 has been linked to various disease, heterodimeric IL-27/EBI3 chain and the u
e
s
including autoimmune encephalomyelitis (15), IL-12/p35 chain (11). To investigate induction of t on
A
autoimmune diabetes (16), inflammatory bowel IL-35 expression during IAV infection, PBMCs pril 5
disorder (17), collagen II-induced arthritis (11), were isolated from IAV-infected patients and , 2
0
1
airway inflammation (18), allergic asthma (18,19), healthy individuals (controls). EBI3 mRNA levels 9
multiple sclerosis (20), and chronic and aggressive were approximately 3-fold higher (IAV,
periodontitis (21). It also impacts colorectal 20.21±1.312, n=12, black box; controls,
cancer progression and prognosis (22), and is 6.275±0.9348, n=12, white box; **p<0.01, Fig.
highly expressed in tumor tissue in lung and colon 1A, left) and p35 mRNA levels were
cancer, and esophageal, hepatocellular, and approximately 6-fold higher (IAV, 38.70±12.80,
cervical carcinomas (23). Regulatory T cells n=12, black box; controls, 6.638±1.188, n=12,
(Tregs) are a critical sub-population of CD4+ T white box; **p<0.01, Fig. 1A, right) in
cells essential to immune response (24,25). IL-35 IAV-infected patients compared with controls.
can convert naïve T cells into strongly suppressive These results are similar to those obtained from
Tregs (26), promote Treg expansion, and suppress throat swabs: EBI3 mRNA levels were
proliferation of conventional T cells (27,28). It approximately 6-fold higher (IAV, 56.09±10.23,
might be specifically produced by Tregs and may n=10, black box; controls,10.44±3.803, n=10,
2
IL-35 mediates antiviral activity
white box; **p<0.01, Fig. 1B, left) and p35 reached peak expression 24 hpi (data not shown).
mRNA levels were approximately 4-fold higher Based on these results, 24 hpi was the chosen
(IAV, 98.30±21.82, n=10, black box; controls, time-point for measurement of IL-35 mRNA
26.57±7.483, n=10, white box ,**p<0.01, Fig. 1B, expression in subsequent experiments. These
right) in IAV-infected patients compared with results indicate that IAV infection induces IL-35
controls. These data indicate that IL-35 is elevated expression in a time-dependent manner.
in IAV-infected patients. Quantitative-PCR analysis showed that IAV
To verify whether IL-35 expression was (MOI=1) infection of A549 cells significantly
related to virus infection, IAV NP and IL-35 increased IL-35 mRNA expression compared with
mRNA levels were analyzed using Pearson’s mock infection (Fig. 2C). Moreover, p19 (the
correlation. A statistically significant correlation subunit of IL-23), p28 (the subunit of IL-27) and
was observed between NP and IL-35 mRNA p40 (the subunit of IL-12) were upregulated (Fig.
levels in PBMCs from IAV-infected patients (NP 2C). The results are consistent with previous
D
and IL-35/EBI3: r=0.70, n=33, **p<0.01, Fig. 1C, reports (32-35). In contrast, heat-inactivated IAV ow
n
left; NP and IL-35/p35: r=0.73, n=33, **p<0. 01, did not significantly increase IL-35 expression. An loa
d
e
d
Fig. 1C, right). These data indicate that IL-35 ELISA kit was used to measure IL-35 protein fro
m
expression positively correlates with IAV expression in culture supernatants. IL-35 h
ttp
infection. expression was up-regulated approximately 2-fold ://w
w
IAV-induced IL-35 expression in different cell by IAV infection compared with mock infection w
.jb
types—Since high levels of IL-35 mRNA were (Fig. 2D). Similar results were obtained in freshly c.o
rg
observed in IAV-infected patients, we next isolated PBMCs and AT II cells (Fig. 2E, F, b/
y
g
assessed in vitro changes in IL-35 expression in respectively), wherein IL-35 mRNA levels were u
e
s
response to IAV infection. A549 cells were up-regulated by IAV infection. In the meantime, t on
A
infected with IAV at various doses. IAV-induced NF-κB was activated by IAV infection with p-IκB pril 5
(MOI<1) IL-35 mRNA expression was positively (36,37) levels measured in A549 cells (Fig. 2G). , 2
0
1
correlated with the infectious dose of IAV (Fig. These data indicate that IAV infection can induce 9
2A). Viral infection induced maximal expression IL-35 mRNA and protein expression. 
at 1 MOI. These data suggest that IAV stimulates IL-35 expression is induced by IAV at the
IL-35 mRNA expression in a dose-dependent transcriptional level — To investigate the
manner (MOI<1). molecular underpinnings of IAV-induced IL-35
Expression of the two IL-35 subunits at up-regulation in A549 cells, promoter reporter
various time-points was measured in A549 cells assays were performed. As IL-35 consists of EBI3
infected with 1 MOI IAV. IL-35 was and p35, luciferase reporter plasmids containing
significantly up-regulated 12 hpi (Fig. 2B). the EBI3 (pIL-35/EBI3-Luc) and p35
IL-35/p35 mRNA reached peak expression 24 hpi; (pIL-35/p35-Luc) promoters were constructed.
IL-35/EBI3 mRNA reached peak expression 48 A549 cells were co-transfected with pIL-35-Luc
hpi. Similar results were obtained in IAV-infected and pRL-TK and infected or not infected with IAV
PBMCs: both IL-35/EBI3 and IL-35/p35 mRNA (MOI=1). IAV infection significantly increased
3
IL-35 mediates antiviral activity
the activities of pIL-35/EBI3-Luc and compared with activity using the wild-type
pIL-35/p35-Luc (Fig. 3A). These results suggest promoter (Fig. 3B, C).
that IAV can induce IL-35 expression at the To confirm whether p50 or p65 regulates
transcriptional level. IL-35 promoter activity, over-expression and
Transcription factor binding sites at the IL-35 knockdown experiments of p50 or p65 were
promoter were predicted by transcription factor performed. Over-expression of p65, but not p50,
assay databases, including JARSPAR significantly increased IL-35/EBI3 and IL-35/p35
DATABASE, ALGGEN, Biobase, Gene luciferase activity in cells infected with IAV
regulation and Transgene. Diagrams showing relative to control (Fig. 3D). Knockdown of
comprehensive analysis of these sites at the IL-35 NF-κB with shRNA-p65, but not shRNA-p50,
promoter are shown in Fig. 3 (B, C). To identify significantly decreased IAV-induced IL-35/EBI3
potential regulatory sites, a series of truncated and IL-35/p35 luciferase activity relative to the
IL-35 promoters was constructed. Luciferase shRNA-control (Fig. 3E). These data suggest that
D
activity assays showed that elimination of the -150 NF-κB/p65 might be a vital transcription factor ow
n
to -450 region of pIL-35/EBI3-Luc greatly regulating IL-35 promoter activity. loa
d
e
d
decreased promoter activity (Fig. 3B). The results We also investigated whether CREB binding fro
m
further suggest that the -360 to -347 and -233 to sites on the IL-35 promoter are important for h
ttp
-242 NF-κB (p65/p50) binding sites are important IAV-induced promoter activity. Our results show ://w
w
for IAV-induced activation of the IL-35/EBI3 that over-expression (Fig. 3F) or knockdown of w
.jb
promoter. Elimination of the -1110 to -1509 CREB with shRNA-CREB (Fig. 3G) does not c.o
rg
region of pIL-35/p35-Luc significantly decreased influence IL-35 promoter activity. To verify b/
y
g
IAV-induced IL-35/p35 promoter activity (Fig. whether NF-κB/p65 binds to the IL-35 promoter, u
e
s
3C). Our results indicate that the -1434 to -1444 ChIP assays were performed. Results show that t on
A
NF-κB/p50 binding site and the -1368 to -1378 three fragments on the IL-35/EBI3 promoter (Fig. pril 5
NF-κB/p65 binding site may be important for 3H) and one on the IL-35/p35 promoter (Fig. 3I) , 2
0
1
IAV-induced activation of the IL-35/p35 promoter. were bound by p65 at much higher levels with 9
Four mutant reporters were constructed for IAV infection compared with control. These data
the NF-κB binding sites. These reporters suggest that NF-κB/p65 is an important element
encompassed site 1 (-360 to -347), site 2 (-233 to required for IAV-induced activation of the IL-35
-242), and site 3 (-84 to -97) regions of promoter.
pIL-35/EBI3-Luc. Site 3 is important COX-2 and iNOS are involved in
cis-regulatory element binding site in IL-18 and IAV-induced IL-35 expression—COX-2 and iNOS
IL-1β-induced IL-27/EBI3 promoter activity (38). are important inflammatory factors regulating
Mutant reporters also encompassed the site 4 interleukins expression induced by viral infection
region (-1368 to -1378) on pIL-35/p35-Luc. Our (6,39,40). We, thus, investigated the roles of
results suggest that there was a decrease in COX-2 and iNOS in IAV-induced IL-35
IAV-induced mutant reporter luciferase activity expression. A549 cells were transfected with a
COX-2 expression plasmid (pCMV-COX-2) or a
4
IL-35 mediates antiviral activity
vector for 24 h and then infected with IAV. IL-35 iNOS inhibitor (Fig. 4G). And IL-35 mRNA
mRNA levels increased with COX-2 decreased (Fig. 4I) with si-iNOS-#3 (Fig. 4H)
over-expression (data not shown). A549 cells were transfected. Meanwhile, IL-35 mRNAs were
then treated with Etoricoxib, a selective COX-2 upregulated in A549 cells with SNP incubation
inhibitor, for 2 h, at different doses (10, 50, or 100 (Fig. 4J). To verify the relationship between IL-35
μM) prior to infection with IAV (MOI=1). DMSO and iNOS expression during IAV infection,
and IAV infection without inhibitor were used as PBMCs were isolated from IAV-infected patients.
solvent and positive controls, respectively. Our IL-35 and iNOS mRNA levels were measured and
results show that IL-35 mRNA levels decreased in analyzed using Pearson’s correlation. A
a dose-dependent manner with pre-treatment with statistically significant correlation was found
Etoricoxib (Fig. 4A). A549 cells were transfected between IL-35 and iNOS expression (IL-35/EBI3
with two different COX-2 specific siRNAs that and iNOS: r=0.65, **p<0.01, n=32, Fig 4K;
modestly reduced levels of COX-2 mRNA and IL-35/p35 and iNOS: r=0.68, **p<0.01, n=32, Fig
D
protein (Fig. 4B). IL-35 expressions were 4L). Collectively, our results suggest that both ow
n
confirmed to be down-regulated by COX-2 COX-2 and iNOS may positively regulate loa
d
e
d
silencing with siCOX-2-#2 (Fig. 4C). These data IAV-induced IL-35 expression in A549 cells. fro
m
suggest that COX-2 positively regulates IL-35 hampers Virus replication—We sought h
ttp
IAV-induced IL-35 expression. It is reported that to determine the biological function of IL-35 ://w
w
Overexpressed COX-2 contributed to during virus infection. Recombinant pCMV-IL-35 w
.jb
prostaglandins (PGs) overproduction (41), we plasmids were constructed (Fig. 5A) , and western c.o
rg
incubated A549 cells with the dissolved blots with EBI3 and p35 antibodies were used to b/
y
g
prostaglandin E2 (PGE2) for 2 h, then infected confirm the cellular overexpression IL-35 (Fig. u
e
s
with IAV (MOI=1). The results showed that 5B). However, over-expression of IL-35 in A549 t on
A
expression of IL-35 mRNA was significantly cells did not strongly affect IAV replication (data pril 5
up-regulated by PGE2 (Fig. 4D). not shown). Li has shown that IL-32γ does not , 2
0
1
We next determined whether IL-35 directly affect HBV replication in HepG2.2.15 9
expression correlates with COX-2 levels in cells, and subsequently established protocols
clinical samples. IL-35 and COX-2 mRNA levels utilizing collection of supernatants from
were measured in PBMCs from IAV-infected IL-32γ-treated PBMCs for indirect antiviral assays
patients then subjected to correlation analysis. (42). Using the method mentioned above, Jurkat
There were statistically significant correlations cells were first electroporated with pCMV-IL-35;
between IL-35 and COX-2 mRNA levels after 36 h, the IL-35 protein level in the
(IL-35/EBI3 and COX-2: r=0.51, *p<0.05, n=20, supernatants were measured by ELISA (Fig 5C),
Fig. 4E; IL-35/p35 and COX-2: r=0.47, *p<0.05, and the supernatants were collected for antiviral
n=20, Fig. 4F; Pearson’s correlation). Similarly, experiments. A549 cells were incubated with the
IL-35 mRNA levels decreased in a collected supernatants of Jurkat cells and then
dose-dependent manner when A549 cells were infected with IAV (MOI=1). IAV NP RNA levels,
treated with SMT (50, 100 μM), the selective including plus-sense RNA and minus-sense RNA
5
IL-35 mediates antiviral activity
were measured 3 hpi via qRT-PCR; supernatant suggest that the incubation of A549 cells with the
IAV titers were measured using a hemagglutinin supernatants of rhIL-35 and IFNγ treated Jurkat
assay 24 hpi. This treatment significantly cells can restrict IAV infection enormously.
decreased NP RNA levels (Fig. 6A) and Next, we investigated whether IL-35 has
significantly decreased IAV titers (Fig. 6B). Our wide-ranging antiviral function. RD cells were
results indicate that the incubation of A549 cells incubated with the supernatants of Jurkat cells
with the supernatants of IL-35-transfected Jurkat described in Fig. 5A or C, and then infected with
cells can inhibit IAV replication effectively. EV71 (MOI=1). 12 hours later, EV71 VP1
We next investigated whether secreted IL-35 expression was measured using absolute qRT-PCR.
can inhibit IAV replication using commercial Replication of EV71 was inhibited by IL-35
rhIL-35. Previous studies demonstrated overexpression (Fig 6G) and EV71 copy numbers
interactions between interleukins and IFNγ. IL-12 were significantly reduced by this treatment of
was positively regulated by IFNγ (43,44), and rhIL-35 and IFNγ (Fig 6H). Next, Huh7 cells were
D
IL-23 interacted with IL-12, IL-18, and IL-2 to transfected with pHBV and incubated with ow
n
promote IFNγ production in NK cells (45). In turn, supernatants from Jurkat cells described in Fig. loa
d
e
d
IFNγ interacted with IL-27 to induce Treg 5A or C. Our results show relatively lower HBeAg fro
m
proliferation, limiting pathology due to infection and HBsAg levels when cells were incubated with h
ttp
(46). Evidence also suggested that IFNγ and Jurkat cell-derived supernatants compared with ://w
w
STAT1-dependent expression of IL-12Rβ2 were control (Fig. 6I, J). We then assessed the effects w
.jb
crucial for T cell activation (47). In human cancer of the above protocol on the production of c.o
rg
cell lines, IL-35 expression can be induced recombinant VSV-eGFP in A549 cells. Consistent b/
y
g
following TNF-α and IFNγ stimulation (23). IL-35 with our other results, VSV-eGFP infection was u
e
s
not only decreased production of IL-17, but can significantly reduced when cells were incubated t on
A
also increase IFNγ production (11). Jurkat cells with Jurkat cell-derived supernatants compared pril 5
were incubated with 100 ng/ml of rhIL-35 (11) with control (Fig. 6K) and the number of infected , 2
0
1
and 2 ug/ml IFNγ for 24 h and the supernatants cells decreased from 75.94% to 38.97%, as 9
were collected for antiviral assays. A549 cells measured by flow cytometry. However, there were
were subsequently incubated with these no antiviral effects in Vero cells on VSV-eGFP
supernatants, and then infected with IAV (MOI=1). expression (Fig. 6K). Because Vero cells lack
IAV NP RNA levels were measured via qRT-PCR functional IFN gene expression (48-50), we
(Fig. 6C) and IAV titers were measured using a inferred that any potential antiviral functions of
hemagglutinin assay (Fig. 6D). Jurkat cell IL-35 require IFN production.
viability was not affected by 24 h-incubation with Similar results utilizing the above protocol
rhIL-35(at different doses) and with or without 2 were obtained when PBMCs were used. Freshly
μg/ml IFNγ(Fig. 6E).The activity of A549 cells isolated PBMCs from healthy donors were
was not affected by incubation with supernatants electroporated with pCMV-IL-35 or vector and the
from Jurkat cells treated with 100 ng/ml rhIL-35 supernatants were collected for antiviral assays.
with or without 2 μg/ml IFNγ (Fig. 6F). The data IAV NP RNA levels and virus titers (data not
6
IL-35 mediates antiviral activity
shown) were reduced in IAV (MOI=1)-infected pCMV-IL-35 and the supernatants were collected
A549 cells incubated with the above after 36 h. A549 cells were subsequently
PBMC-derived supernatants. HBeAg and HBsAg incubated with these Jurkat cell-derived
expression was reduced in pHBV-transfected supernatants and infected with 1 MOI IAV.
Huh7 cells cultured with the same PBMC-derived qRT-PCR analysis and western blots revealed that
supernatants (data not shown). EV71 copy intracellular PKR, OAS, and Mx mRNA and
numbers were also reduced in 1 MOI protein levels increased with this treatment (Fig.
EV71-infected RD cells cultured with these 7F, G). Similar results were obtained using
PBMC-derived supernatants (data not shown). rhIL-35. The expression of IFN-α, IFN-β, and
These data indicate that treatment with the above IFN-λ1 were all induced by rhIL-35 in a
PBMC-derived supernatants had antiviral time-dependent manner (Fig. 7H). And the PKR,
functions not only in IAV infection, but also in OAS and Mx were also upregulated (Fig. 7I).
VSV, HBV, and EV71 infection. Taking together, To investigate whether the IFNs mediated
D
IL-35 has extensive antiviral activity to DNA and IL-35 anti-viral action, IFNAR1 or IFNLR1 were ow
n
RNA viruses. knocked down by shIFNAR1 or shIFNLR1 (Fig. loa
d
e
d
IL-35-induced IFN production — To 7J), and the anti-viral action of IL-35 was not fro
m
investigate whether the effects of IL-35 on detected in the presence of either shIFNAR1 or h
ttp
antiviral activity depends on the presence of IFNs, shIFNLR1 (Fig. 7K). Collectively, these data ://w
w
Jurkat cells were electroporated with pCMV-IL-35 demonstrate that IL-35 can induce IFN production w
.jb
plasmids for 24 h. Total cellular RNA was and stimulate expression of downstream IFN c.o
rg
extracted, and IFN-α, IFN-β, and IFN-λ1 mRNA effectors, and the induced IFNs mediate IL-35 b/
y
g
levels were quantified using qRT-PCR. IFN-α, anti-viral activity. u
e
s
IFN-β, and IFN-λ1 mRNA levels significantly t on
A
increased with pCMV-IL-35 transfection DISCUSSION pril 5
compared with vector transfection (Fig. 7A). Herein, we investigated IL-35 expression , 2
0
1
Similar results were observed in PBMCs during IAV infection. IAV is one of the most 9
transfected with pCMV-IL-35. IFN-α, IFN-β, and common causes of infection in humans (51),
IFN-λ1 mRNA levels were up-regulated in which can lead to high morbidity and significant
pCMV-IL-35-transfected PBMCs compared with mortality. Host cells secrete a variety of cytokines
vector transfection (Fig. 7B). Furthermore, IFN-α and chemokines in response to IAV infection
(Fig. 7C), IFN-β (Fig. 7D) and IFN-λ1 (Fig. 7E) (1,4-7). We present the first evidence from clinical
were activated in pCMV-IL-35-transfected Jurkat samples that IL-35 expression may change in
cells compared with vector transfection. These response to IAV infection, consistent with
data suggest that IFN expression can be induced additional findings that IL-35 mRNA levels were
by IL-35. positively correlated with IAV NP mRNA levels.
We next explored whether expression of We used various cell lines in this study for
downstream IFN effectors can be induced by different purposes. Lung epithelial cells are the
IL-35. Jurkat cells were transfected with primary targets of IAV infection (52). AT II cells
7
IL-35 mediates antiviral activity
constitute approximately 60% of alveolar infection in A549 cells (61). It can regulate protein
epithelial cells and about 15% of all lung expression, including that of CRC3, IL-10, and
parenchymal cells. A549 cells are IL-17 (62). iNOS is an inducible and
adenocarcinomic human alveolar basal epithelial calcium-independent isoform of NO synthetase. It
cells commonly used in IAV research. PBMCs are plays a critical modulatory role in immune
widely used to investigate immune response to response, chronic inflammation, and
viral and microbial infections (53,54). Our carcinogenesis, and can be stimulated by viral
findings suggest that IL-35 is significantly infection (6,63,64). Our findings suggest that
up-regulated in these three cell types during IAV COX-2 and iNOS may be important factors in
infection in a time- and dose-dependent manner. IAV-induced IL-35 expression. Furthermore, both
Our results suggest that IAV infection can COX-2 and iNOS mRNA levels are positively
induce IL-35 expression via the transcription correlated with IL-35 mRNA levels in
factor, NF-kB/p65, and the inflammatory factors, IAV-infected blood samples.
D
COX-2 and iNOS. IL-35 can also activate the IFN IL-35 is detectable in peripheral CD4+ T cells ow
n
pathway and may have potential antiviral activity. and is believed to play important functions in loa
d
e
d
Consistent with these findings, others have shown inhibition of the immune response during chronic fro
m
that HBV infection can induce IL-35 expression. HBV infection (56), suggesting it may be a h
ttp
One report shows that IL-35 mRNA and protein potential therapeutic target to control HBV ://w
are detectable in CD4+ T cells in patients with infection (29). Thus, we investigated the ww
.jb
chronic hepatitis B (55). Likewise, in patients biological function of virus-induced IL-35 c.o
rg
chronically infected with HBV, CD4+ T cells have expression. Using the indirect approach, we b/
y
g
significantly higher levels of EBI3 mRNA and demonstrate that over-expression of IL-35 and u
e
s
protein compared with healthy individuals and incubation with rhIL-35 may suppress IAV, EV71, t on
A
patients in whom HBV infection had resolved. VSV, and HBV replication and viral production. pril 5
Furthermore, IL-35 has also been shown to IFN-α/β is the host’s central innate immune , 2
0
1
suppress proliferation of HBV antigen-specific response to viral infection (65), although IFN-λ1 9
cytotoxic T-lymphocytes and IFN-γ production in has also been shown to inhibit replication of a
vitro (56). number of viruses (66). In this study, the indirect
NF-κB is inactive in the cytoplasm due to antiviral effect of IL-35 was abolished in
IκB masking its nuclear localization sequence (57). IFN-deficient Vero cells (48), suggesting that
Upon viral infection, phosphorylated IKK can IL-35 function during viral infection depends on
phosphorylate IκBα, which is then ubiquitinated expression of IFN. Our findings show that IL-35
(58,59), allowing NF-κB to enter the nucleus (39). can induce IFN-α, IFN-β, and IFN-λ1 mRNA
We show that binding of NF-κB/p65 to the p65 expression and increases PKR, OAS, and Mx
transcription binding site initiates IL-35 mRNA and protein expression. And we found
transcription during IAV infection. upregulated expression of IL-35 receptors
COX-2 is critical to the inflammatory (14), including gp130 and IL-12Rb2,
response (60) and can be activated by IAV concurrent with IFN production (data not
8
IL-35 mediates antiviral activity
shown). Previous reports show that signaling (Gibco BRL, Grand Island, NY, USA). Human T
through the IL-35 receptor requires STAT1 and cell lymphoblast-like cell (Jurkat) lines were
STAT4 (14). Here, IL-35 may have stimulated cultured in RPMI 1640 medium (Gibco BRL).
IFN expression via activating IL-35 receptors, Rhabdomyosarcoma cells (RD) were cultured in
thereby presumably stimulating the Jak-STAT MEM medium (Gibco BRL). Huh7 cells were
pathway, leading to phosphorylation of STAT1 cultured in Dulbecco’s modified Eagle’s medium
and STAT4 and subsequent up-regulation of IFN. (DMEM, Gibco BRL). All media were
In conclusion, we propose a hypothetical supplemented with 10% fetal bovine serum (FBS,
model of IAV-induced IL-35 production and its Gibco BRL). All cultures were maintained at 37°C
biological function (Fig. 8). IAV infection in a 5% CO2 incubator. The IAV/Hong
stimulates IL-35 expression via activation of its Kong/498/97 (H3N2) strain used in these studies
promoter by the transcription factor, NF-κB/p65, was provided by the China Center for Type
and through activation of COX-2 and iNOS Culture Collection. Recombinant vesicular
D
pathways. IL-35 then activates IFN and its stomatitis virus (VSV) carrying enhanced green ow
n
downstream effectors, leading to inhibition of fluorescent protein (VSV-eGFP) was a gift from loa
d
e
d
viral replication and production. Further studies Mingzhou Chen (Wuhan University). Human fro
m
are required to better understand the IL-35-related enterovirus 71 (EV71) was obtained from h
ttp
complex regulatory mechanisms of antiviral host Xiangyang (GenBank accession number ://w
w
response during virus infection. However, our JN230523.1). w
.jb
findings provide evidence of a distinct role for Isolation of PBMCs and primary AT II cells c.o
rg
IL-35 in this process and point to potential novel — Peripheral blood mononuclear cells (PBMCs) b/
y
g
clinical uses for IL-35 in antiviral therapy. were isolated using density centrifugation diluted u
e
s
1:1 in a solution of human lymphocytes t on
A
EXPERIMENTAL PROCEDURES (TBD-Science, Tianjin, China), as previously pril 5
Ethics statement — Peripheral blood described (67). PBMCs were washed twice with , 2
0
1
samples and throat swabs were obtained from PBS and cultured in RPMI 1640 medium at 37°C 9
IAV-infected patients and healthy individuals. in a 5% CO2 incubator. Human alveolar type II
Clinical samples were collected in accordance to (AT II) cells were purchased (Wuhan PriCells
the Declaration of Helsinki from patients admitted Biotechnology & Medicine Co., Ltd, Wuhan,
to the Hubei Provincial Center for Disease Control China), and cultured in RPMI 1640 medium
and Prevention, and were approved by the (37°C , 5% CO2).
Institutional Review Board of the College of Life Transfection — Cells were plated at a
Sciences of Wuhan University in accordance to its density of 4×105/plate and grown to 80%
guidelines for protection of human subjects. confluency before transfection. Cells were
Written informed consent was obtained from all transfected with lipofectamine 2000 reagent
participants. (Invitrogen, Carlsbad, CA, USA) for 24 h, serum
Cell and virus — Human lung epithelial starved for another 24 h, then harvested for
cells (A549) were cultured in F12K medium analysis. PBMCs and Jurkat cells were transfected
9
IL-35 mediates antiviral activity
by electroporation. Solution I (20% ATP-disodium 5’-TTTAAGCTTCTGCTCTCAGGAGTGGGT-3’
salt, 12% MgCl ·6H 0) and Solution II (1.2% (anti-sense); for -450 IL-35/EBI3 promoter:
2 2
KH PO , 0.12% NaHCO , 0.04% glucose, pH 7.4) 5’-TTTGGTACCTGTCTTCCTTCTGTCTTCTC-
2 4 3
were freshly mixed on ice (1:4, v/v). Cells at a 3’ (sense); for -250 IL-35/EBI3 promoter:
density of 106 were lightly suspended in a 100 μl 5’-TTTGGTACCCCACCCTCGGGGCCTT-3’
blended solution with 4 μg of plasmids on ice. (sense); for -150 IL-35/EBI3 promoter:
The mixture was added into a cuvette (BTX, 5’-TTTGGTACCCCAGTGAGTCAGACCTGA-3’
Taiwan, China) and electroporated using (sense); for IL-35/p35 promoter:
Nucleofector (Amaxa, Lonza Group Ltd., 5’-GATGGTACCAGATGAGCCACCCAGAA-3’
Germany). Cells were washed into 6-well culture (sense),
plates and cultured in RPMI 1640. 5’-GCTAAGCTTCTTGCGGCGCTTTCGGAT-3’
Biological and chemical reagents — Coding (anti-sense); for -1110 IL-35/p35 promoter:
regions of IL-35 were amplified from templates, 5’-TTTGGTACCTCTTCCCTCTGCTCTACTCC
D
including IL-27/EBI3 (32) and p35 cDNA, a gift T-3’ (sense); for -710 IL-35/p35 promoter: ow
n
from the Jiahuai Han laboratory (Xiamen 5’-TTTGGTACCCTCTAGGTCTTTCCTCCCA-3’ loa
d
e
d
University), by PCR with the following primers: (sense); for -310 IL-35/p35 promoter: fro
m
IL-35/EBI3: 5’-TTTGGTACCGACACGGGGCGTCCGGCTA h
ttp
5’-TTAATAGCTAGCGCGGCCGCCACCATGG A-3’ (sense). Target sequence mutations were ://w
w
GGAGGAAAGGGCCCCCAGCA-3’(sense), generated by site-directed mutagenesis using w
.jb
5’-AGAACCACCACCACCAGAACCACCACC specific primers. The following primer pairs for c.o
rg
ACCAGAACCACCACCACCCTTGCCCAGGC the mutagenesis of luciferase reporters are used: b/
y
g
TCAT-3’(anti-sense); IL-35/p35: for IL-35/EBI3 promoter site 1 mutant: u
e
s
5’-GGTGGTGGTGGTTCTGGTGGTGGTGGTT 5’-TGCCTGGGGTTTTAGCCGCTTCAGGGC-3’ t on
A
CTGGTGGTGGTGGTTCTAGAAACCTCCCCG (sense), pril 5
TG-3’ (sense), 5’-GCCCTGAAGCGGCTAAAACCCCAGGCA- , 2
0
1
5’-CCGCTCGAGTCAGGAAGCATTCAGATAG 3’(anti-sense); for IL-35/EBI3 promoter site 2 9
CT-3’(anti-sense). The two fragments were linked, mutant:
generating the IL-35 fragment via the linker, 5’-CCCCACCCTCGTTGTTTTCCGAGCA-3’
3×GGGGS. The KOZAK sequence-containing (sense),
IL-35 fragment was inserted into Nhe I/Xho 5’-ACCCCTGCTCGGAAAACAACGAGGGT-3’
I-containing sites of pcDNA3.1 (-) to generate the (anti-sense); for IL-35/EBI3 promoter site 3
expression plasmid, pCMV-IL-35, using mutant:
previously described methods (11). IL-35/EBI3 5’-TGGGCTGGGCTTTTAGCTGGGCAGGTC-3’
and IL-35/p35 promoters, the truncates and (sense),
mutants were amplified using genomic PCR with 5’-GACCTGCCCAGCTAAAAGCCCAGCCCA-
the following primers: for IL-35/EBI3 promoter: 3’(anti-sense); for IL-35/p35 promoter site 4
5’-TTTGGTACCCTGTCTATCTCCGTGTCCTC- mutant:
3’ (sense), 5’-TGACTAATGCCTAGAGGATTAACAACTG
10