Fecal microbiota of a dugong (Dugong dugong) in captivity at Toba Aquarium

14 Pages·2008·0.89 MB·English

J. Gen. Appl. Microbiol., 54, 25–38 (2008)
Full Paper
Fecal microbiota of a dugong (Dugong dugong) in captivity
at Toba Aquarium
Eiko Tsukinowa,1Shuichi Karita,1Shiro Asano,2Yoshihiro Wakai,2Yukari Oka,2
Masami Furuta,2and Masakazu Goto1,*
1Graduate School of Bioresources, Mie University, Tsu 514–8507, Japan
2Toba Aquarium, Toba 517–8517, Japan
(Received June 11, 2007; Accepted November 2, 2007)
A captive female dugong at Toba Aquarium (Japan) was examined to describe the microbiota of
its lower digestive tracts using the molecular-biological technique, a culture-independent
method. The phylogenetic analysis of bacterial 16S rRNA genes was conducted for fecal sam-
ples, which were taken at 3 different periods. Based on phylogenetic analysis of these se-
quences, the representatives of six bacterial phyla could be identified: Actinobacteria (0.7%),
Bacteroidetes(15%), Firmicutes(83.1%), Lentisphaerae(0.1%), Proteobacteria(0.1%), and Verru-
comicrobia (1.0%), suggesting the existence of bacterial species newly found not only in the di-
gestive tract but also in natural field.
Key Words—dugong; eelgrass; fecal microbiota; marine herbivore
and cellulose-utilizing bacteria, sulfate-reducing bacte-
Introduction
ria and methane-producing bacteria was previously
Dugong (Dugong dugong) is a species of herbivore detected in the fecal samples of a captive dugong at
in the sea, possessing a long colon, 8.6–11.5 times Toba Aquarium, showing extensive microbial degrada-
longer than its body size (Kamiya et al., 1979). Like tion of cellulolytic and non-cellulolytic components of
other hindgut mammals the dugongs evolved their eelgrass (Goto et al., 2004b). The total SCFA concen-
body requirement for growth and maintenance by tration was produced by 10.5mmoldl(cid:1)1 of 55.7mol%
grazing sea grasses (Cork et al., 1998; Erftemeijer et acetate, 18.0mol% n-butyrate and 15.1mol% propi-
al., 1993; Preen, 1995). Dugongs digest plant cell onate after 36h incubation. However, the analysis of
walls in the cecum and proximal colon (Murray et al., the microbiota of the digestive tracts is limited in cul-
1977), and a high concentration of short-chain fatty ture-based approaches, especially due to environmen-
acids (SCFA) such as acetate, propionate, and bu- tal differences between inherent and artificial growth
tyrate, was reported in the cecum and large intestine conditions.
of a dead dugong. 109–1010 colony forming units g(cid:1)1 The first attempt to keep a dugong (Dugong dugong)
each of starch-, lactate-, cellobiose-, pectin-, xylan-, in captivity was in the United States of America in
1955, when a male dugong was transported from
Palau Island, Micronesia, to San Francisco. It survived
*Address reprint requests to: Dr. Masakazu Goto, Graduate
for only 45 days at the Steinhart Aquarium. Many sub-
School of Bioresources, Mie University, 1577 Kurimamachiya,
sequent attempts have been made by many countries
Tsu 514–8507, Japan.
Tel: (cid:2)81–59–231–9494 Fax: (cid:2)81–59–231–9494 and institutions to keep dugongs. Examples include
E-mail: [email protected] the Central Marine Fisheries Institute (India), Puket
26 TSUKINOWAet al. Vol. 54
Marine Biological Center (Thailand), Yongon Zoo terial was transferred to a 2-ml screw-cap polypropyl-
(Myammar), Jaya Ancol Oceanarium (Indonesia) and ene microtube, which contained 500ml of 5% N-lauroyl
Cairns Oceanarium (Australia). Most of these attempts sarcosine-0.1M phosphate buffer (pH 8.0) and 0.38g
to keep dugongs in captivity were short-lived and of 0.1mm diameter silica beads previously sterilized.
many difficulties were encountered. From four This tube was then incubated at 70°C for 1h and
dugongs brought from the Philippines to Toba Aquar- shaken 2 times at maximum speed for 45s each,
ium (Japan) from 1979 to 1987, a 28-year-old male using a Fast Prep FP100A Instrument (Qbiogene).
and a 21-year-old female were still alive in 2007 (Toba Polyvinyl polypyrrolidone (15mg) was added to the
Aquarium, 1995). Feeding data of these captive tube, which was vortexed and centrifuged for 3min
dugongs have been continuously recorded since the at 13,000(cid:3)g. After recovery of the supernatant, the
two dugongs were infants. pellet was washed with 500ml of TENP (50mM
In this study a captive female dugong at Toba Tris [pH 8], 20mM EDTA [pH 8], 100mM NaCl, 1%
Aquarium was examined to describe the microbiota of polyvinyl polypyrrolidone) and centrifuged for 3min at
its lower digestive tracts using the molecular- biologi- 13,000(cid:3)g, and the new supernatant was added to
cal technique, a culture-independent method. The phy- the first supernatant. The washing step was repeated
logenetic analysis of bacterial 16S rRNA genes was three times. The pooled supernatants (about 2ml)
conducted for fecal samples, which were taken at 3 were split between two 2-ml tubes. Nucleic acids were
different periods. precipitated by the addition of 1 volume of isopropanol
for 10min at room temperature and centrifuged for
3min at 13,000(cid:3)g. Pellets were resuspended and
Materials and Methods
pooled in 450ml of 100mM phosphate buffer (pH 8),
Animal and sampling. Fecal samples were col- and 50ml of 5M potassium acetate. The tube was
lected from a captive female dugong in Toba Aquarium placed on ice for 90min and centrifuged at 13,000(cid:3)g
(Age: 21 years old in 2007; body weight: 345kg), for 30min. The supernatant was transferred to a new
which was kept and fed eelgrass (Zostera marina) tube containing 20mg of RNase (1mg/ml) and incu-
under the control conditions (water temperature at bated at 37°C for 30min. Phenol-chloroform-isoamyl-
28°C and natural lighting) as described previously alcohol (25:24:1) was added, mixed for 5min, and
(Goto et al., 2004a). The samples were taken at 3 dif- centrifuged for 5min at 13,000(cid:3)g. Nucleic acids were
ferent periods, namely May 2000, October 2004, and precipitated by the addition of 50ml of 3M sodium ac-
August 2005, by applying fingertip pressure to the uro- etate and 1ml of absolute ethanol to the supernatant.
genital area of the female dugong floating on its back The tube was incubated for 5min at room temperature,
without pool water or any other contaminant. The sam- and the nucleic acids were recovered by centrifugation
ple in a 20ml polypropylene container was stored at at 15,000(cid:3)g for 5min. The DNA pellet was finally
(cid:1)80°C until further processing. washed with 70% ethanol, dried, and resuspended in
Extraction and purification of DNA. A 0.5g of sam- 100ml of TE buffer. Recovered DNA was purified using
ple was randomly collected from inner and outer por- AutoSepTM G-50 (Amersham Pharmacia Biotech).
tions of a couple pieces of fecal samples, and the DNA 16S rDNA amplification, cloning and restriction frag-
purification of the sample collected in the year 2000 ment length polymorphism. Two universal primers,
was performed according to a chemical procedure of 27F (5(cid:4) AGAGTTTGATCCTGGCTCAG 3(cid:4)) and 1492R
the QIAamp DNA Stool Mini Kit (Qiagen, Germany) (5(cid:4) GGTTACCTTGTTACGACTT 3(cid:4)) were used in PCR
(sample A in Table 1) and that of the samples collected to amplify the 16S rRNA coding region (rDNA). The
in 2000, 2004, and 2005 (sample B, C, D, respectively, amplification reaction was performed using the follow-
in Table 1) was by a physical procedure described by ing program: 20 cycles consisting of 96°C for 10s,
Godon et al. (1997). 53°C for 10s., 72°C for 4min, and a final extension
According to the method of Godon et al. (1997), a period of 72°C for 10min. PCR products were cloned
solid portion of the fecal sample was collected by cen- into the plasmid vector pCR2.1 and competent Esch-
trifugation and suspended in 500ml of 4M guanidine erichia coli INVa were transformed using a TA-cloning
thiocyanate-0.1MTris (pH 7.5) and 75ml of 10% N-lau- kit (Invitrogen), according to manufacturer’s instruc-
royl sarcosine. Two hundred fifty microliters of this ma- tions.
2008 Fecal microbiota of a dugong 27
The inserted DNA region was amplified by the PCR to 4 show the phylogenetic deductions among one of
with the set of primers. PCR products were digested the taxonomic units affiliated with Clostridium, which
with HaeIII restriction endonuclease and grouped by was divided into 19 major clusters (Collins et al.,
the pattern of band on an acrylamide gel electrophore- 1994). The majority (386 clones) of our sequences
sis. was associated with these clusters, primarily with Sub-
Sequence analysis and nucleotide sequence acces- cluster XIVa (186 clones), which includes Clostridium
sion number. The representative of the groups was polysaccharolyticum and Eubacterium xylanophilum.
sequenced using a DYEnamic ET Terminator Cycle Similarly, large numbers of sequences were associ-
Sequencing Kit (Amersham Biosciences). The nu- ated with Cluster IV (85 clones) and Cluster I (68
cleotide products and their sequences were analyzed clones). Small numbers of the sequences were associ-
on a DNA analyzer system (ABI PRISM 3100, Applied ated with Cluster III (11 clones), Cluster IX (20 clones)
Biosystems) and with BLAST search (http://www.ncbi. and Cluster XI (16 clones).
nlm.nih.gov/BLAST/). All near-full-length sequences The similarity in the patterns of compositional per-
were tested for possible chimeric structures. Chimeras centage of the major three groups, Mollicutes (34–
were detected by the RDP analysis service Check_ 37%), and Clostridium rRNA clusters I (12–19%) and
Chimera (Larsen et al., 1993). IV (14–28%) was observed between the above-men-
Clone 16S rDNA sequences, their closest relatives tioned commercial kit and procedures described by
identified from database searches, and appropriate Godon et al. (1997) for bacterial DNA extraction, as
type strain sequences were aligned with Clustal W sampled in May 2000 (Sample A and B, Table 1).
(Thompson et al., 1994) and phylogenetic trees were Variations in patterns of the compositional percent-
constructed by the neighbor-joining method (Saitou age of clones detected were observed between fecal
and Nei, 1987) with Clustal W. The near-full-length samples of May 2000 and October 2004 or August
16S rDNA sequences have been deposited in the 2005, showing a drastic shift of major groups from
DDBJ database under accession numbers AB218288 Mollicutes and Clostridium rRNA Clusters I and IV in
to AB218350 and AB264058 to AB264084. the year 2000 to Clostridium rRNA Subclusters XIVa
and Cytophaga-Flexibacter-Bacteroides in the years
2004 and 2005.
Results
A total of 709 16S rRNA genes, nearly complete se-
Discussion
quences averaging 1,500bp, were obtained from the
dugong’s fecal sample. Only one of the sequences The first attempt to describe the bacterial biota in
was identical with Catabacter hongkongenesisHKU16, fecal contents of the dugong was carried out using
indicating that the study was far from defining the full 16S rDNA library analysis and suggested the exist-
extent of the taxonomic diversity contained within the ence of bacterial species newly found not only in the
libraries (Table 1). digestive tract but also in natural field.
Based on phylogenetic analysis of these sequences, The nearest species from BLAST search were gas-
the representatives of six bacterial phyla could be trointestinal bacteria from pigs (Leser et al., 2002), hu-
identified: Actinobacteria, Bacteroidetes, Firmicutes, mans (Derrien et al., 2004; Dewhirst et al., 2001), mice
Lentisphaerae, Proteobacteria (delta subclass) and (Dewhirst et al., 1999; Ley et al., 2005; Salzman et al.,
Verrucomicrobia. The vast majority (83.1%) of the se- 2002), and wild herbivores (Nelson et al., 2003). They
quences were affiliated with Firmicutes. Except for were also the bacteria in the rumen and intestinal di-
one, none of the sequences matched any 16S rRNA gestive tract of dairy cattle (Tajima et al., 1999), al-
gene sequence that was derived from a previously cul- though it was of low similarity.
tivated species, and therefore the majority of the se- In general, the bacterial biota in the digestive tracts
quences that were obtained in this study represented of terrestrial and marine herbivores can vary depend-
microbial species previously uncharacterized. In many ing the digestion mode and system, which is repre-
cases, there were nearest matched clones to the 16S sented by fore stomach fermentation and hindgut fer-
rRNA genes of uncultured bacteria from pig and mentation. As the library of fecal clones found in this
human digestive tracts detected previously. Figures 1 study was compared with that of the microbiota in di-
28 TSUKINOWAet al. Vol. 54
s
Total clone 3 2 1 1 4 20 3 1 3 3 2 2 1 1 1 12 41 1 1 4 3 1 20 2 3 1 12 16 2 17 1 13
8
D 05/ 2 2 1 2 1 2 3 2 1 1 19 1 1 4 1 1 12 5 2 5 1
0
2
0
1
es C 004/ 1 1 2 11 3 1 1 12 12 2 7 3 1 2 4 4
n 2
Clo B 000/5 8 1 6 1 6 14 4 9
2
5
A 00/ 1 1 4 2 1 4
0
2
y
g
es. molo (%) 93.3 90.3 99.7 99.5 98.4 99.7 96.5 99.0 98.0 93.1 99.9 99.6 90.9 98.4 93.0 93.2 96.1 96.0 95.8 90.8 99.2 95.1 92.2 99.8 95.1 95.0 94.8 98.5 92.8 98.6 97.3 97.1
c o
e H
s and frequencies of isolated clones from dugong f Nearest species (Accession No.) Atopobium parvulumATCC22793 (AF292372) Uncultured bacterium clone p-275-o5 (AF371713) Bacterium mpn-isolate group 5 (AF357553) Parabacteroides distasonisATCC8503 (M86695) Bacteroidessp. AR20 (AF139524) Bacteroidessp. ASF519 (AF157056) Bacteroidessp. CIP103040 (AF133539) Bacteroidessp. BV-1 (X89217) Bacteroides uniformismat-344 (AB215084) Uncultured bacterium clone C686 (AY985676) Uncultured bacterium clone C706 (AY916343) Uncultured bacterium clone FE1 (AY553946) Uncultured bacterium clone M516 (AY916163) Uncultured bacterium clone C5-79 (DQ113691) Uncultured bacterium clone MH03 (AY982206) Uncultured bacterium clone p-317-a3 (AF371895) Uncultured rumen bacterium clone S7 (DQ256287) Alistipes finegoldiiANH 2437 (AJ518874) Uncultured bacterium clone C272 (AY985351) Uncultured bacterium clone p-286-a3 (AF371705) Lactococcus lactissubsp. lactisIL1403 (NC 002662) Uncultured bacterium clone IIIA-3 (AJ488093) Clostridium butyricumNCIMB8082 (X68178) Clostridium cellulosiAS1.1777 (L09177) Clostridium longisporumDSM 8431 (X76164) Clostridium subterminaleDSM 6970 (AB294137)
e e e
u a a
Similarity val Family Coriobacteriace Bacteroidaceae Prevotellaceae Rikenellaceae Acidaminococ- caceae Streptococcace unknown Clostridiaceae
Table1. Class (Subclass) Actinobacteria Bacteroidetes unknown Bacilli Clostridia
Phylum Actinobacteria Bacteroidetes Firmicutes
n 9 3 0 5 1 3 8 4 2 9 6 3 9 4 0 8 1 4 4 2 5 9 6 0 6 1 5 7 1 2 8 9
o 2 8 3 7 3 1 8 1 3 7 7 3 8 3 7 5 0 7 6 6 3 6 1 9 3 9 1 1 6 9 7 1
essi No. 183 640 183 640 183 183 182 183 183 640 640 183 182 183 640 640 183 640 640 640 183 640 183 182 183 182 183 183 640 182 640 183
c 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
c B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B
A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A
Represent No. dgC-118 dgD-191 dgC-30 dgD-135 dgC-78 dgB-5 dgA-180 dgB-89 dgC-101 dgD-156 dgD-138 dgC-28 dgA-11 dgC-176 dgD-75 dgC-158 dgA-52 dgD-128 dgD-23 dgD-17 dgC-96 dgD-59 dgB-66 dgA-92 dgC-135 dgA-6 dgB-82 dgB-113 dgD-10 dgA-143 dgD-151 dgB-84
2008 Fecal microbiota of a dugong 29
s
Total clone 5 6 7 1 2 2 1 1 2 1 1 3 8 1 1 2 1 135 1 1 4 3 2 1 12 2 2 1 4 3 25
8
D 05/ 2 2 2 2 1 2 63 2 1 1 1 4
0
2
0
1
es C 004/ 1 2 1 1 1 62 3 1 5 3
n 2
Clo B 000/5 1 1 1 2 9 1 1 2 2 19
2
5
A 00/ 5 6 7 3 1 1 1 1 1 1 4 2 6
0
2
y
g
molo (%) 96.8 96.6 96.2 95.8 98.2 92.0 92.8 92.6 94.3 95.6 95.4 99.8 99.4 99.0 93.1 95.2 95.6 95.4 95.3 99.9 99.7 94.5 93.0 96.5 93.7 91.4 94.7 94.7 95.5 95.4 91.3
o
Table1.Continued. Nearest species (Accession No.)H Clostridium symbiosumATCC14940 (M59112) Faecalibacterium prausnitziiclone 1-84 (AY169429) Swine manure pit bacterium PPC78A (AY542483) Uncultured bacterium clone C288 (DQ326314) Uncultured bacterium clone C437 (AY985477) Uncultured bacterium clone ELAND_15 (AY858495) Uncultured bacterium clone ELAND_41 (AY858503) Uncultured bacterium clone HuAC05 (AY684393) Uncultured bacterium clone p-1894-s962-3 (AF371638) Uncultured bacterium clone p-211-o5 (AF371674) Uncultured bacterium clone p-30-a5 (AF371665) Uncultured bacterium clone p-4157-6Wa5 (AF371760) Uncultured bacterium clone p-5459-2Wb5 (AF371947) Uncultured bacterium clone p-594-a5 (AF371763) Unidentified eubacterium from anoxic bulk soil BSV34 (AJ229194) Eubacterium contortumATCC25540 (L34615) Eubacteriumsp. oral strain A35MT (AF287761) Mogibacterium neglectumATCC700924 (AB037875) Uncultured Eubacteriaceaebacterium Rs-E61 (AB088987) Lachnospira pectinoschiza clone 1-10 (AY169414) Uncultured bacterium clone p-2418-55G5 (AF371611) Uncultured bacterium clone p-4176-6Wa5 (AF371772)
e
e a
a e
amily eriace spirac
F ct no
a h
b c
u a
E L
s)
ass clas
Cl ub
S
(
m
u
yl
h
P
n 3 4 5 7 3 5 3 8 8 0 2 9 6 7 1 7 8 9 0 7 8 3 2 4 4 5 5 2 8 9 6
o 9 9 9 3 6 6 2 1 3 5 2 3 9 9 7 6 9 9 0 2 0 0 4 2 0 0 2 7 6 5 0
essi No. 182 182 182 183 640 640 183 183 183 183 183 183 182 182 640 640 182 182 183 183 183 183 183 183 183 183 183 640 640 640 183
c 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2
c B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B
A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A
nt 1 9 3 1 1 0 1 1 7 0
e 3 2 8 9 5 3 5 1 0 6 1 4 2 6 0 8 1 3 0 0 7 4 2 8 4 0 2 7 5
Repres No. dgA-1 dgA-1 dgA-7 dgC-5 dgD-1 dgD-2 dgB-3 dgB-1 dgC-1 dgC-2 dgB-9 dgC-6 dgA-5 dgA-4 dgD-9 dgD-5 dgA-1 dgA-7 dgA-7 dgB-7 dgA-1 dgA-6 dgC-1 dgB-1 dgA-3 dgA-3 dgB-1 dgD-1 dgD-5 dgC-1 dgA-3
30 TSUKINOWAet al. Vol. 54
s
Total clone 42 1 13 20 5 1 2 1 1 1 21 9 1 2 2 1 1 1 12 117 3 4 1 1 3 1 3 709
8
D 05/ 12 1 1 1 1 4 4 1 1 1 4 3 2 3 1 92
0 1
2
0
1
es C 004/ 8 5 17 2 1 1 1 1 1 1 1 186
n 2
Clo B 2000/5 1 2 3 4 49 4 1 152
5
A 00/ 42 13 2 4 64 2 79
0 1
2
Table1.Continued. Nearest species (Accession No.)Homology (%) 91.2 91.0 Uncultured bacterium clone p-956-s962-5 (AF371797)96.8 96.1 Uncultured bacterium clone Thompsons100 (AY854298)98.1 Catabacter hongkongensisHKU16 (AY574991)100.0 Clostridium aminophilumF (L04165)89.7 Clostridium lentocellumDSM 5427 (X76162)92.5 Uncultured bacterium clone D-74 (DQ116011)92.2 Uncultured bacterium clone M3_e02 (DQ015386)89.0 Uncultured bacterium clone p-1321-a5 (AF371673)94.3 Uncultured bacterium clone p-1977-s962-5 (AF371543)95.0 94.6 Uncultured bacterium clone p-2001-s959-5 (AF371658)95.0 Uncultured bacterium clone p-5291-2Wa3 (AF371940)94.7 Uncultured eubacterium WCHB1-54 (AF050582)92.8 Uncultured rumen bacterium clone U29-A06 (AB185744)93.4 Unidentified rumen bacterium RC5 (AF001698)91.8 Sedimentibacter hongkongensisKI (AY571338)93.7 Bulleidia mooreiAHP 13983 (AY044915)91.8 Allobaculum stercoricanisDSM 13632T (AJ417075)93.5 Unidentified eubacterium clone vadinHA31 (U81729)89.5 Unidentified eubacterium clone vadinHB65 (U81755)96.9 Uncultured bacterium clone ELAND_96 (AY858543)99.6 Akkermansia muciniphilaMuc (AY271254)99.7 Uncultured bacterium clone HuCA18 (AJ408970)95.0 Uncultured bacterium clone L10-6 (AJ400275)99.2 ere prepared with a method described by Godon et al. (1997).
w
ae D
ce d
Family unknown Erysipelotricha unknown Desulfovibri- onaceae Verrucomi- crobiaceae ni Kit; B, C, an
a Mi
Class (Subclass) Mollicutes unknown Deltapro- teobacteri Verrucomi- crobiae p DNA Stool
a m
e a bi a
Phylum Lentisphaera Proteobacteri Verrucomicro ared with QIA
p
on 07 28 09 46 44 80 20 84 66 60 40 26 45 43 02 41 82 73 10 11 47 21 48 49 77 81 12 pre
ccessi No. B2183 B2183 B2183 B2183 B2183 B2640 B2183 B2640 B2640 B2640 B2183 B2183 B2183 B2183 B2183 B2183 B2640 B2640 B2183 B2183 B2183 B2183 B2183 B2183 B2640 B2640 B2183 A was
A A A A A A A A A A A A A A A A A A A A A A A A A A A A s N
e D
Represent No. dgA-72 dgB-138 dgA-83 dgC-130 dgC-85 dgD-165 dgB-20 dgD-197 dgD-32 dgD-7 dgC-100 dgB-67 dgC-129 dgC-172 dgA-80 dgC-42 dgD-185 dgD-113 dgA-44 dgA-88 dgC-125 dgB-10 dgC-74 dgC-139 dgD-149 dgD-170 dgA-65 Total clon A: Total
2008 Fecal microbiota of a dugong 31
Fig. 1. Phylogenetic tree of cloned 16S rRNA genes and their closest relatives-1.
The tree was created using the neighbor-joining method with Clustal W. The numbers on the tree indicate bootstrap
values for the branching points. The sequence data for closest relatives were obtained from the DNA databases (Gen-
bank/EMBL/DDBJ). Clone names, dgA, dgB, dgC, and dgD were sequenced in this study (See in Table 1).
32 TSUKINOWAet al. Vol. 54
Fig. 2. Phylogenetic tree of cloned 16S rRNA genes and their closest relatives-2.
See the legend to Fig. 1 for explanation.
2008 Fecal microbiota of a dugong 33
Fig. 3. Phylogenetic tree of cloned 16S rRNA genes and their closest relatives-3.
See the legend to Fig. 1 for explanation.
34 TSUKINOWAet al. Vol. 54
Fig. 4. Phylogenetic tree of cloned 16S rRNA genes and their closest relatives-4.
See the legend to Fig. 1 for explanation.