Evidence for Widespread Associations between Neotropical Hymenopteran Insects and ...

17 Pages·2017·7.63 MB·English

fmicb-08-02016 October16,2017 Time:17:44 #1
ORIGINALRESEARCH
published:17October2017
doi:10.3389/fmicb.2017.02016
Evidence for Widespread
Associations between Neotropical
Hymenopteran Insects and
Actinobacteria
BernalMatarrita-Carranza1,2,RolandoD.Moreira-Soto2,3,CatalinaMurillo-Cruz2,
MarielosMora4,CameronR.Currie5andAdriánA.Pinto-Tomas2,4,6*
1LaSelvaBiologicalStation,OrganizationforTropicalStudies,Heredia,CostaRica,2CentrodeInvestigaciónenEstructuras
Microscópicas,UniversidaddeCostaRica,SanJosé,CostaRica,3CentrodeInvestigaciónenEnfermedadesTropicales,
UniversidaddeCostaRica,SanJosé,CostaRica,4CentrodeInvestigaciónenBiologíaCelularyMolecular,Universidadde
CostaRica,SanJosé,CostaRica,5DepartmentofBacteriology,UniversityofWisconsin-Madison,Madison,WI,
UnitedStates,6DepartamentodeBioquímica,FacultaddeMedicina,UniversidaddeCostaRica,SanJosé,CostaRica
The evolutionary success of hymenopteran insects has been associated with complex
physiological and behavioral defense mechanisms against pathogens and parasites.
Editedby:
Among these strategies are symbiotic associations between Hymenoptera and
RobertBrucker,
RowlandInstituteatHarvard, antibiotic-producing Actinobacteria, which provide protection to insect hosts. Herein,
UnitedStates
we examine associations between culturable Actinobacteria and 29 species of tropical
Reviewedby:
hymenopteraninsectsthatspanfivefamilies,includingApidae(bees),Vespidae(wasps),
AmparoLatorre,
UniversitatdeValència,Spain and Formicidae (ants). In total, 197 Actinobacteria isolates were obtained from 22
ReginaLamendella, of the 29 different insect species sampled. Through 16S rRNA gene sequences of
JuniataCollege,UnitedStates
161 isolates, we show that 91% of the symbionts correspond to members of the
*Correspondence:
genus Streptomyces with less common isolates belonging to Pseudonocardia and
AdriánA.Pinto-Tomas
[email protected] Amycolatopsis. Electron microscopy revealed the presence of filamentous bacteria
with Streptomyces morphology in brood chambers of two different species of the
Specialtysection:
eusocial wasps. Four fungal strains in the family Ophiocordycipitacea (Hypocreales)
Thisarticlewassubmittedto
MicrobialSymbioses, known to be specialized insect parasites were also isolated. Bioassay challenges
asectionofthejournal
between the Actinobacteria and their possible targeted pathogenic antagonist (both
FrontiersinMicrobiology
obtained from the same insect at the genus or species level) provide evidence that
Received:05July2017
Accepted:29September2017 different Actinobacteria isolates produced antifungal activity, supporting the hypothesis
Published:17October2017 of a defensive association between the insects and these microbe species. Finally,
Citation: phylogenetic analysis of 16S rRNA and gyrB demonstrate the presence of five
Matarrita-Carranza B,
Streptomyces lineages associated with a broad range of insect species. Particularly
Moreira-Soto RD,Murillo-Cruz C,
Mora M,Currie CRand ourCladeIisofmuchinterestasitiscomposedofone16SrRNAphylotyperepeatedly
Pinto-Tomas AA(2017)Evidence
isolated from different insect groups in our sample. This phylotype corresponds to a
forWidespreadAssociationsbetween
NeotropicalHymenopteranInsects previously described lineage of host-associated Streptomyces. These results suggest
andActinobacteria. StreptomycesCladeIisaHymenopterahost-associatedlineagespanningseveralnew
Front.Microbiol.8:2016.
insect taxa and ranging from the American temperate to the Neotropical region. Our
doi:10.3389/fmicb.2017.02016
FrontiersinMicrobiology|www.frontiersin.org 1 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #2
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
workthusprovidesimportantinsightsintothewidespreaddistributionofActinobacteria
and hymenopteran insects associations, while also pointing at novel resources that
could be targeted for the discovery of active natural products with great potential in
medicalandbiotechnologicalapplications.
Keywords:symbiosis,ants,bees,wasps,Streptomyces,Cordyceps,Ophiocordyceps,Hirsutella
INTRODUCTION The first is comprised of leaf-cutter ants and bacteria in the
genus Pseudonocardia. These bacteria are found on the cuticle
Hymenoptera is the third largest species-rich insect order, oftheantsandcanoccurincryptsintheirexoskeleton(Currie
containing more than 150000 extant species described to et al., 2006), and they produce secondary metabolites that can
date (Aguiar et al., 2013), only surpassed by Coleoptera and inhibitthegrowthofparasiticfungi(Escovopsis)thatcancolonize
Lepidoptera. All ants, bees, and wasps belong to this order the ant’s fungal cultivar (Currie et al., 1999; Oh et al., 2009;
and, together with termites (Blattodea), represent the best- Marshetal.,2013;Sitetal.,2015).Thesecondgroupconsistsof
known groups of insects where eusociality, the highest-level solitary wasps belonging to the genera Philanthus, Trachyphus,
of social organization, is present. Eusociality is characterized and Philanthinus (Kaltenpoth et al., 2005, 2010, 2012) in
by the presence of reproductive division of labor, brood whichfemalesharborStreptomycesbacteriainspecializedgland
care and overlapping of generation of individuals of the reservoirs inside the antenna. Before laying their eggs, female
same colony (Wilson, 1971). These complex social systems wasps secrete their Streptomyces symbiont inside the brood
and their associated adaptations are what have allowed some chambers.Duringlarvaldevelopment,theStreptomycesproduce
hymenopteran groups to achieve ecological dominance playing amixtureofatleastninedifferentantimicrobialcompoundsthat
prominent roles in ecosystem function as pollinators (stingless willcoverimmaturewaspsandprotectthemfromfungalattack
bees and the honey-bee), herbivores (leaf-cutter ants) and duringhibernationperiods(Kaltenpothetal.,2005;Kroissetal.,
predators(e.g.,armyantsandpaperwasps;HansonandNishida, 2010). Actinobacteria have been characterized in several other
2016).Thesuccessofeusocialinsectsisreflectedforexamplein social Hymenoptera, including within three ant-plant systems
tropical forests where they can represent more than 50% of all (Hanshew et al., 2015) and in bees (Promnuan et al., 2009),
animalbiomass(HölldoblerandWilson,2009). suggestingtheseassociationsmaybemorewidespread.
However, social lifestyles also represent an opportunity NeotropicalHymenopteraareanextremelydiversegroupof
for pathogens and parasites to exploit means of dispersion insects (Hanson and Gauld, 1995) with largely unexplored
betweencolonymembersinordertoinfecthealthyindividuals. Actinobacteria associations. Here we examine possible
Moreover,environmentalconditionssuchashumidityandstable associations between Actinobacteria and tropical eusocial
temperatures inside the nest are factors that predispose these and subsocial Hymenoptera, including species of bees, wasps,
insectstopathogenicinfestations(OiandPereira,1993). and ants, in a tropical rain forest at La Selva Biological Station
As defensive responses against pathogenic microorganisms, in Costa Rica (Bawa et al., 1994). Culture-dependent targeted
many social Hymenoptera have developed collective hygienic isolationsforActinobacteriafrom29hymenopteranspecieswere
strategies and altruistic behaviors in order to evade, control conducted. Patterns of associations between insect species and
or eliminate parasitic infections (Wilson-Rich et al., 2009). Actinobacteria isolates were characterized through 16S rRNA
Beneficialmicrobialassociationsmayaugmentintegralimmune and gyrB DNA sequencing and Bayesian phylogenetic analyses.
defenses and help provide protection against pathogens via Moreover, different strains of entomopathogenic fungi known
microbial competition, by stimulating immune responses, or to infect some of the insects under study, including strains
throughsecretionofanti-microbialcompounds(Berg,1996;Bot in the genus Ophiocordyceps (Hirsutella) were isolated. These
etal.,2002;DillonandDillon,2004;EvansandLopez,2004;de fungi are known as highly specialized pathogens capable of
Souzaetal.,2009;KaltenpothandEngl,2013). manipulatingthebehavioroftheirhost(deBekkeretal.,2014).
As suggested by Kaltenpoth (2009), the factors that may Finally,theresultsfrominvitrobioassaysshowthatsomestrains
have predisposed Actinobacteria to engaging in defensive ofActinobacteriaassociatedwithdifferentspeciesofinsectswere
symbioticassociationswithinsectsaretheirubiquityinterrestrial capable of inhibiting the growth of these entomopathogenic
environments (Mayfield et al., 1972; van der Meij et al., 2017), fungi.
thecapabilitytodegraderecalcitrantcarbonandnitrogensources
(e.g., lignin, chitin and cellulose; Bhattacharya et al., 2007;
MATERIALS AND METHODS
Veˇtrovský et al., 2014), and the potential to produce many
bioactive secondary metabolites (Barka et al., 2016). The genus
Insect Sampling for Actinobacteria
Streptomycesaloneproducesmorethan80%ofallantibioticswith
pharmaceuticalapplicationsthatareusedtoday,eitherdirectlyas Screening
naturalproductsortheirsemisyntheticderivatives(Bérdy,2005). Insect colonies were collected at La Selva Biological Station
There are two well-studied hymenopteran groups that have (OrganizationforTropicalStudies)from2010to2014(Table1).
establisheddefensivesymbioticassociationswithActinobacteria. ThisstationislocatedintheprovinceofHeredia,CostaRica(10◦
FrontiersinMicrobiology|www.frontiersin.org 2 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #3
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
25(cid:48)53.14(cid:48)(cid:48)N,84◦0(cid:48)10.51(cid:48)(cid:48)W)andiscomposedof1500hectares leaves of different plants, and Pheidole bicornis (Myrmicinae)
oflowlandtropicalrainforest.Afewothersampleswerecollected thatobligatorilylivesincavitiesofthepetiolesandstemsshrubs
in Las Brisas Nature Reserve, Limón Province, Costa Rica (10◦ from the genus Piper. Four different ant species in the genus
04(cid:48) 09.7(cid:48)(cid:48) N, 83◦37(cid:48) 57.5(cid:48)(cid:48) W). Samples from each colony were Odontomachus (Ponerinae) which live under rocks or trunks,
aseptically collected using flame sterilized forceps and placed werealsosampled.Finally,Paraponeraclavata(Paraponerinae),
directly into a capped sterile container for transport to the an omnivorous large ant that constructs nests in the soil next
laboratory. Each colony was divided into different sub-samples to the base of trees and is a member of a recent paraphyletic
for further Actinobacteria isolation. Colony components when ancestor group to the formicoid ants lineage was also studied
presentincludedlarvae,adults,nestmaterialandhoneyorpollen (Ward,2014).
inthecaseofbees.Oursamplingapproachencompassedeusocial In the case of eusocial wasps, Actinobacteria associations
insects(allants,paperwasps,andstinglessbees)andnon-eusocial with colonies of Agelaia cajennensis, Polybia plebeja, Polybia
insects(beesfromthetribeEuglossini,andwaspsfromthefamily occidentalis, and Metapolybia docilis were studied. Subsocial
PompilidaeandCrabronidae). wasps in the families Pompilidae and Crabronidae were also
Ten different species of ants representing four sub-families sampled (Table 1). The Crabronidae family is related to the
and spanning different lifestyles and habitats were collected. Apidaelineage(Debevecetal.,2012)andknownasmuddaubers
The ant species sampled comprised, Tapinoma ramulorum togetherwithSphecidae.
(Dolichoderinae), Paratrechina caeciliae (Formicinae), and From the eusocial stingless bees, Tetragonisca angustula
Pheidole fiorii (Myrmicinae), which build carton nests on the and Trigona sp. 1 were investigated. Adults, larvae, comb,
TABLE1|InsectspeciesandcolonycomponentssampledandActinobacteriaisolatesobtained.
Numberofisolatesobtainedfrom:
Insectfamily Species Coloniessampled Adult Larvae Nest Others Total
Apidae Euglossaallosticta‡ 1 0 — — — 0
Euglossahansoni‡ 1 0 — — — 0
Euglossaheterosticta‡ 6 2 — — — 2
Euglossaignita‡ 1 0 — — — 0
Euglossaimperilais‡ 2 2 — — — 2
Euglossacybelia‡ 1 0 0 0 — 0
Eulaemaspeciosa‡ 2 0 0 0 0 0
Tetragoniscaangustula† 16 7 2 0 10∗ 19
Trigonasp.1† 4 0 — 0 — 0
Formicidae† Crematogasterlongispina 10 5 4 1 — 10
Odontomachusbauri 3 0 1 0 — 1
Odontomachuserythrocephalus 18 11 7 3 — 21
Odontomachushastatus 1 0 1 0 — 1
Odontomachusopaciventris 5 0 2 0 — 2
Paraponeraclavata 16 18 — — — 18
Paratrechinacaeciliae 10 7 4 1 — 12
Pheidolebicornis 13 0 2 5 — 7
Pheidolefiorii 8 4 1 0 — 5
Tapinomaramuloruminrectum 8 4 1 3 — 8
Pompilidae‡ Pompilidaesp.A 3 1 2 0 — 3
Crabronidae‡ Trypoxylonsp.A 4 3 8 4 — 15
Trypoxylonsp.B 1 1 1 0 — 2
Vespidae† Agelaiacajennensis 11 3 16 3 — 22
Metapolybiadocilis 10 3 6 15 — 24
Polybiaplebeja 13 1 6 5 — 12
Polybiaoccidentalisbohemani 7 2 2 4 — 8
Vespidaesp.A 1 0 0 0 — 0
Vespidaesp.B 1 0 1 0 — 1
Vespidaesp.C 1 0 1 1 — 2
Total 178 74 68 45 10 197
†Eusocialinsectsstudied(allants,paperwasps,andstinglessbees).‡Non-eusocialinsects(muddauberwaspsandEuglossinibees).∗Isolatesobtainedasfollows:three
fromhoney,onecomb,onepollen,andfivepropolis.
FrontiersinMicrobiology|www.frontiersin.org 3 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #4
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
honey,andpollenfromcoloniesofT.angustulawerecollected; containers and brought to the laboratory for processing and
antimicrobial activity has been reported for this species’ honey identification.
(DeMera and Angert, 2004). Adults and beehive entrance Insectcadaverswithfruitingbodiesdevelopedorwithactive
materialweretheonlycolonycomponentsoftheTrigonasp.1 conidiophoresonstromatawereattachedwithdouble-sidedtape
collected. totheinnersideofaPetriplatelid.Thenthelidwasplacedona
Fivespeciesoftheweaklysocialorchidbees(Cardinaletal., platecontainingPDAmediaforcollectingdischargedascospores
2011) were studied using essential oils as bait to collect males orconidia(Lacey,2012).Piecesofstromataorsynnematawere
(Table1).Finally,adultsandlarvaespecimensfromtwocolonies also cut with sterile scissors and directly stroked against PDA
ofthesolitary-nestingorchidbeeEulaemaspeciosawereincluded mediawithflame-sterilizedforceps,inalaminarflowhood.Agar
inthestudy. plates were examined under a microscope and pure cultures
wereobtainedaftercuttingpiecesofagarwithsingleascospores
Actinobacteria Isolation or hyphal tips and transferred into new PDA plates that were
later incubated at 27◦C for 4 weeks. Agar slants with sterile
A culture-dependent approach for isolating Actinobacteria was
mineraloiland20%glycerolstockswerepreparedtopreservethe
performed, using chitin agar as a selective media (Cafaro and
isolates.
Currie,2005).Forsmallinsects(e.g.,C.longispina,T.ramulorum,
P. bicornis, P. fiorii, and P. caeciliae) five adults, five immature
DNA Extractions and PCR
forms (larvae and pupae) and five nest fragments from each
From each colony component sampled, unique isolate
colonywereplacedseparatelyinto0.5mLof0.1%steriletween-
morphotypes were chosen for DNA extraction and 16S
20 PBS buffer solution in an autoclaved 1.5 mL Eppendorf
rRNA sequencing. Standard cetyltrimethylammonium bromide
tube. For medium sized insects (T. angustula, Odontomachus
(CTAB) DNA extractions were performed for Actinobacteria
ants, and all wasps), pools of three adult insects or larvae were
isolates(Cafaroetal.,2011).PCRamplificationswereemployed
used. For P. clavata ants, only adult insects were collected for
on the genomic DNA using the eubacterial universal primers,
Actinobacteriaisolation.Eachsamplewasvortexedfor15–20s.
27F and 1492R (Lane, 1991) for 16S rRNA. As 16S rRNA gene
Tween-20PBSsolutionwaspipettedoff,discardedandreplaced
sequenceanalysiscannotdistinguishbetweencloselyrelatedtaxa
with 0.5 mL of PBS solution. The sample was macerated with
(Han et al., 2012) the gyrB coding gene for 71 representative
a sterile pestle and 0.5 mL of PBS was added. Then the
microcentrifugetubewasvortexedfor15s.Analiquotof100µL Streptomycesisolatesfromourcollectionweresequenced,using
was plated onto chitin agar plates and incubated at 27◦C for the primers gyrB-F1 (GAGGTCGTGCTGACCGTGCTGCA)
and gyrB-R1 (GTTGATGTGCTGGCCGTCGACGT) (Hatano
threeto4weeks.IsolatedActinobacteriaweresubculturedonto
et al., 2003). The PCR amplification reactions were performed
yeast-malt extract agar (YMEA) with antifungals (nystatin and
in a Veriti (Applied Biosystems) Thermal cycler. The reaction
cycloheximide) for macro and micromorphology examination.
conditions for 16S rRNA gene amplification consisted of
A Gram stain screening of the isolates was performed prior to
35 cycles at 94◦C for 1 min, 52◦C for 1 min, 72◦C for
DNAextractionsofthemostpromisingisolates.A20%glycerol
1 min. The amplification of gyrB consisted of 30 cycles of
stockofActinobacteriasporesandcellswerepreparedbyfreezing
denaturationat 95◦Cfor 1min, annealingfor 0.5min at65◦C,
a homogenized mixture in liquid nitrogen and storing them in
cryovialsat−80◦C. andextensionat72◦Cfor1.5min.Bacterial16SrRNAandgyrB
sequencesobtainedinthisstudyweredepositedintheGenBank
database under accession numbers KY067229-KY067322 and
Entomopathogenic Fungi Sampling and
KY082974-KY083044,respectively.
Isolation
In the case of fugal genomic DNA extractions, a simple
A total of 14 insect cadavers with conspicuous signs of thermolysismethodwasapplied(Zhangetal.,2010).Mycelium
Cordyceps-like fungal infection were collected and brought to from 3-day cultures from fast growing isolates was used to
the lab for processing. The majority (11) of specimens were extract DNA. In the case of Ophiocordyceps isolates PCFB and
collected in the same geographic area where insect colonies BA18 fresh stromata tip from old cultures were used. PCR
forActinobacteriascreeningweresampled.Twowasps(Agelaia amplification of ITS region was performed with primers ITS4
areata and Polybiasp.) and one Camponotus ant cadavers were and ITS5 (White et al., 1990). SSU was amplified using the
collectedinasecondaryforestinSanCarlos,CostaRica(10◦34(cid:48) primersNS1andNS4(Whiteetal.,1990).Amplificationofthe
26.2(cid:48)(cid:48) N,84◦30(cid:48) 08.2(cid:48)(cid:48) W).Insectcadaverscorrespondingtothe elongation factor 1-α (EF1-α) was performed with the primers
samespeciesorgenusasoneoftheActinobacteriahostsunder 983F and 2218R and cycling conditions used by Rehner and
study were chosen for fungal isolation, further characterization Buckley (2005). ITS amplification cycling conditions were of
andbioassayanalysis. 35 cycles of 0.5 min at 95◦C, 0.5 min at 52◦C and 1.5 min
Ophiocordyceps infected specimens were of much interest as at 72◦C. SSU amplification was performed with 35 cycles of
these fungi have been described as being a hymenopteran host 94◦C 1 min, 52◦C 0.5 min and 72◦C for 1 min. PCR products
specialist having a narrow host range (Boomsma et al., 2014). cleaning and sequencing was performed either at Macrogen
Specimens were carefully collected, including a portion of the or at the Biotechnology Center DNA Sequencing Facility at
substrate(leavesortwigs)atwhichtheywereattachedtoavoid the University of Wisconsin-Madison. The GenBank accession
damaging the specimen. Samples were placed in sterile plastic numbers for the entomopathogenic fungi isolates sequences
FrontiersinMicrobiology|www.frontiersin.org 4 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #5
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
areKY053448-KY053455(ITS),KY055528-KY055532(EF1-α)y by inoculation of 100 µl spore suspension (∼1 × 106 spore
KX579044-KX579053(18SrRNA). mL−1)onaPDAplateandincubationinthedarkat27◦Cand
countinggerminatedsporeswithin24h(Lacey,2012).
Analysis of Sequences
PDA media was prepared and inoculated with the spore
Sequences from this study were edited using Geneious version suspensiontoreachafinalapproximateconcentrationof1×104
9.1.2andhigh-qualitysequenceswereclusteredintooperational viable spore mL−1. As we determined that temperatures above
taxonomic units (OTUs) using mothur (Schloss et al., 2009) 40◦C compromised spore viability of at least one of our fungal
with the standard divergence cut-off of 98% similarity (Schloss strains, the suspension spores were carefully preheated to 38◦C
and Handelsman, 2004; Hong et al., 2006; Hulcr et al., 2011). and inoculated in PDA media at around 38–40◦C. This avoid
Interactionsbipartitenetworkanalysisweredevelopedusingthe theformationoflumpswheninoculatingagarmediawithlower
Rpackage-bipartitesoftware(Dormannetal.,2008). temperature spore suspension, keeping a homogenous mixture
Sequence alignments were performed using GUIDANCE with viable spores. 24 mL PDA inoculated media was poured
(Penn et al., 2010) with MAFFT algorithm and 100 bootstrap in Petri plate (8.5 cm in diameter). For each fungal strain, the
repeats. Final editing of alignments was done in MEGA v6.0 panel of Actinobacteria isolates that corresponded to the same
(Tamuraetal.,2013).Analysesforthebestmodelofnucleotide insecthostwereculturedinYMEAat27◦Cfor2weekstoreach
substitution were performed using jModelTest2 version 2.1.6 the stationary phase growth. Then YMEA with Actinobacteria
(Darribaetal.,2012).Thechosenmodelfor16SrRNAandgyrB lawn growth was cut into 5 mm diameter disks and carefully
sequences was GTR (General Time Reverse) and K80 (Kimura transferredtothePDAmediainoculatedwithentomopathogenic
two-parameter) for ITS sequences. Phylogenetic analyses were fungalsporesuspension.Bioassaysplateswereincubatedat27◦C
performed through Bayesian inference, using MrBayes 3.2 for 2–4 weeks and halos of inhibition were measured. Negative
(Ronquist and Huelsenbeck, 2003). All analyses employed one controlswererunwithYMEAagardisksmediaonly.
coldchainandthreeincrementallyheatedchains.Atemperature
parametersetto0.2forribosomalRNAgenesand0.1forgyrB. Scanning Electron Microscopy
FourseparateMarkovChainMonteCarlorunswereperformed,
The ultrastructure of adults and nest material for two vespid
with3milliongenerationseach(5milliongenerationsforgyrB),
wasps (M. docilis and P. plebeja) was examined. Two nest
discarding the initial 25% generations from each run as burn-
samples and adults per colony were fixed with glutaraldehyde
in and sampling one in every 100 generations to calculate and paraformaldehyde and were left at 4◦C overnight. Samples
posteriorprobabilitiesforeachbranch.jModelTestandMrBayes
were post-fixed in 1% osmium tetroxide for at least 1 h and
analysis were carried out using the Cipress Science Gateway
dehydrated with ethanol (SEM; 30–100%) SEM and then dried
bioinformaticsserviceplatform(Milleretal.,2010).Finalediting
by sublimation in a freeze dryer (VFD-20, VD Inc.). Due to
of each phylogenetic tree was done in FigTree v1.4 and Adobe
thefragilenatureofthesesamples,theprocessingwasrepeated
IllustratorCS5.1.
withamodifiedKarnovskyandOsmiumvaporsfixationprotocol
(Kim, 2008; Alves et al., 2013). In this case, samples were put
Bioassays
in a Petri plate containing a moistened cotton ball. In a fume
Duplicate bioassay challenges between Actinobacteria and
hood,1mLofKarnovsky’ssolution(Karnovsky,1965)wasplaced
entomopathogenicfungiwereconducted.Ineachbioassay,both
in a small opened container that was then transferred into the
thebacteriaandthefungiwereisolatedfromthesameinsecthost
Petriplatecontainingthesample.ThePetriplatewaskeptclosed
atthegenusorspecieslevel.Toobtainsporesuspensions,fungal
and the sample was fixed at room temperature for 2 h. For
fermentations were done with a modified methodology (Suay
a second fixation step, the container with Karnovsky solution
et al., 2000). In the case of Ophiocordyceps/Hirsutella isolates,
wasreplacedwithanothercontainerthatcontained1mLof2%
pieces of agar from pure cultures were transferred to 100 mL
osmiumtetraoxide.ThePetriplatewascoveredwithaluminum
sterileErlenmeyer’sflaskscontaining20mLofGraceInsectcell
foilinsidethefumehoodandthesamplewasfixedfor12–24h
medium (Gibco) supplemented with 10% fetal bovine serum
and then dried with silica gel in a hermetic container for 24 h.
(Gibco). The inoculated flasks were shaken at 250 rpm at 25◦C
The samples were then mounted on aluminum stubs, with a
for2–3weeks.Sporesuspensionswerepreparedbyfilteringthe
double-stickcarbon,coatedwithgoldinasputterEikoID2and
liquid culture through sterile cheesecloth placed in the tip of
examinedunderascanningelectronmicroscopeHitachiS-3700.
a sterile pipette while applying pressure with a pipette pump.
IsolatesclassifiedinthegeneraMetarhizium,Chlorocillium,and
EngyodontiumwerecultureddirectlyinPDAplatesfor3weeks
RESULTS
at 27◦C. Spore suspensions were obtained by scrapping the
myceliumdirectlyfromtheagarmediaandtransferringto100ml
Actinobacteria Isolation and
sterile Erlenmeyer flasks containing 20 mL of 0.1% tween-20
Phylogenetic Analysis
solution.Eightsterilecrystalballs(3mmdiameter)wereaddedto
theflasksandthenshakenat250rpmfor10min.Themycelium Inoursamplingof178coloniesoftropicalhymenopteraninsects,
was filtered through sterile cheesecloth and spore suspension 197isolatesofActinobacteriawereobtained.Ofthe29different
collectedinasterilebeaker.Suspensionsporeconcentrationwas speciesofinsectssampled,Actinobacteriawasobtainedfrom22
determined with a hemocytometer. Spore viability was assessed (Table 1). Isolation of Actinobacteria from a particular species
FrontiersinMicrobiology|www.frontiersin.org 5 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #6
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
FIGURE1|Insect-ActinobacteriainteractionnetworkusingOTUsclusteringwith2%cut-offsequencesimilarity.Upperlevelboxesrepresentinsectspeciesand
lowerlevelboxesdepictassociatedActinobacteriaOTUs.Boxesandlinksizeareproportionaltothetotalnumberofisolatesobtainedandtothefrequencyofthis
particularinteraction,respectively.Generaareabbreviatedasfollow:Streptomyces(Str),Pseudonocardia(Ps)Amycolatopsis(Amy)Nocardia(Noc)Saccharothrix
(Sac).
wasonlyunsuccessfulforspecieswheresamplinginvolvedonly OTUs accounted for 75% of all sequences included in the
a single colony, except in the case of the bee Trigona sp. 1 analysis. Two Pseudonocardia strains associated with bees and
In comparing bees (34 colonies), ants (92 colonies), wasps (44 threeAmycolatopsisstrainsassociatedwithantswerealsofound.
colonies),23,82,and70strainsofActinobacteria,wereisolated Within the Actinobacteria genus Nocardia, one strain was
respectively. By grouping the isolates according to the colony isolated from a bullet ant (P. clavata) and wasp larvae (A.
component from which they were obtained, 74 corresponded cajennensis) and a different strain obtained from nest material
to adult insects (176 samples), 68 with immature insects (131 ofatrap-jawantcolony(O.erythrocephalus).Additionally,one
samples), and 45 with nest material (149 samples). In addition, Sacchrothrix strain was isolated from O. erythrocephalus larvae
from the stingless bee T. angustula other bee hive components (Figure1).
weresampledandisolatesobtainedasfollow:threefromhoney, Four main clades of Actinobacteria, each one composed
one from brood comb, one from pollen and five from propolis of sequences with 99% 16S rRNA identity were found to
(Table1). be associated with different groups of insects under study
Fromthe197Actinobacteria-likeisolatesobtained,wechoose (Figure 2). In general, phylogenetic analysis of gyrB, grouped
onlyuniquemorphotypespercolonycomponentsampled(174), representative sequences from the 16S rRNA tree in the same
for DNA extraction and 16S rRNA sequence analysis. From clades (Figures2,3). In the 16S rRNA phylogenetic tree, the
thoseisolates161successfullyamplified,23werereplicates,and paraphyletic group I represents a single 16S rRNA phylotype
138 Actinobacteria sequences were chosen for further analysis. isolatedrepeatedlyfrom29differentsamples,fromninedifferent
Asequencealignmentwasgeneratedandthen44shortsequences hymenopteran insect species (Figure 2). This group contained
were removed and the remaining 94 were clustered into 22 16Streptomycesisolatesassociatedwithvespidwaspcolonies,11
differentOTUswitha2%cutoffusedasanindicatorofbacterial fromantsand2fromthestinglessbeeT.angustula.Theclosest
species (Figure1, see Supplementary Table S1 for details about relativestothisgroupwereS.fulvissimusDSM43,S.flavogriseus
the distribution of isolates differentiating their origin) (Hong ATCC33331,S.globisporusKTC9026andS.cavourensisNRRL
etal.,2006;Hulcretal.,2011).Interactionnetworkanalysisusing 2740,basedon>99%sequencesimilarity.Moreover,sequences
OTUs clustering did not show evidence of specific associations from other studies corresponding to known host associated
between Actinobacteria isolates and the insect species from Streptomycesstrainswithantimicrobial(Poulsenetal.,2011)or
which they were obtained (Figure 1). Streptomyces isolates cellulolytic activity (Book et al., 2016) were clustered in clade
were grouped into 22 different OTUs with ten of them being I (Figure 2). In the gyrB phylogeny, representative sequences
representedbysingletons(Figure1).SixdominantStreptomyces within clade I were resolved into different taxonomic groups
FrontiersinMicrobiology|www.frontiersin.org 6 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #7
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
FIGURE2|Bayesian,phylogeneticanalysisof16SrRNAsequencesofActinobacteriaassociatedwithdifferenthymenopteraninsectspecies.Insecttaxonomic
identityisindicatednexttosamplecode.Posteriorprobabilities(PP)areindicatedatthecorrespondingnodes.NCBIreferencesequencesincludedintheanalysis
aredenotedbythecorrespondingtypeculturecollectionacronym.Cladeswithin99%sequencesimilaritycutoffarehighlightedexceptforcladeIIthatitis
composedofdifferentphylotypesandwashighlightedtoshowagroupofsequencescloselyrelatedtothewell-studiedsolitarywaspsymbiontCandidatus
Streptomycesphilanthi.Alignment950pb.
FrontiersinMicrobiology|www.frontiersin.org 7 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #8
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
FIGURE3|Bayesian,phylogeneticanalysisofpartialgyrBsequencesofStreptomycesassociatedwithdifferenthymenopteraninsectspecies.Insecttaxonomic
identityisindicatednexttosamplecode.Posteriorprobabilities(PP)areindicatedatthecorrespondingnodes.NCBIreferencesequencesincludedintheanalysis
aredenotedbythecorrespondingtypeculturecollectionacronym.Representativeisolateswith99%sequencesimilaritycutoffinthe16SrRNAphylogenyare
highlightedaswellascladeIIthatitiscomposedofdifferentphylotypes.CladeIIwashighlightedtoshowagroupofsequencescloselyrelatedtothewell-studied
solitarywaspsymbiontCandidatusStreptomycesphilanthi.Alignment780pb.
FrontiersinMicrobiology|www.frontiersin.org 8 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #9
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
FIGURE4|SEMimageoftheinteriorofwaspbroodchambers.(A)TwobroodchambersofM.docilis,afterlarvaeremoval.Scale,1mm.(B)Filamentousbacteria
formingadenseclusteratthebaseofthechamber,hyphaediametersof1.3–2.4µm.Scale,20µm.(C)P.plebejalarvaeinbroodchambers.Scale,1mm.
(D)StreptomyceslikehyphaegrowingonP.plebejalarvae.Hyphaediameterof1.2–1.7µm.Scale,60µm.
FIGURE5|BayesianphylogeneticrelationshipsamongfungalisolatesinthisstudyasinferredfromITS-5.8Ssequences.Posteriorprobability(PP)atthe
correspondingnodes.ThetreewasrootedonCandidaalbicans.
FrontiersinMicrobiology|www.frontiersin.org 9 October2017|Volume8|Article2016
fmicb-08-02016 October16,2017 Time:17:44 #10
Matarrita-Carranzaetal. WidespreadNeotropicalInsect-ActinobacteriaAssociations
FIGURE6|OphiocordycepsfungiinfectingP.clavataants.(A)Ophiocordycepskniphofioides(H.stilbelliformis)PCFBinthesexualstate.Scale,1cm(B)
H.stilbelliformisPCFBisolatepurecultureonPDA,showingdensegrowthofsynnemata.(C)H.stilbelliformisPCFBovoidconidiaborneatcompactedterminal
phialides.Scale,20µm(D)SEMmicrographofPCFBverrucoseapicalphialidewithconidiasinsidemucousdroplet.Scale,4µm.(E)a-andb-phialidesand
conidiaofHirsutellastilbelliformisPCFB.Scale,20µm.(F)P.clavataant,infectedbyOphiocordycepssp.Scale,1cm.(G)IsolateBA18inPDApureculture.
(H)BA18,verrucosecompactandapicalphialideswithovoidconidia.Scale,20µm.
butwithinasinglecladewiththeStreptomycesstrainswithhigh the vespid wasp P. plebeja, six different colonies were studied
cellulolyticactivity(Figure3). from which were obtained 11 Streptomyces isolates associated
Clades III, IV, and V also represent different 16S rRNA withbroodornestsamples.Fouroftheseisolateswereisolated
phylotypes (99% cut off) with their closest relatives being from different colonies and grouped together as one 16S rRNA
S. prasinopilosus, S. sampsonii, and S. misionensis, respectively. StreptomycesphylotypeinCladeI(Figure2),suggestingbeinga
SequencescorrespondingtoStreptomycesisolatesassociatedwith commonstrainassociatedwiththiswasp.TheSEMultrastructure
subsocial Crabronidae or Pompilidae insects grouped together ofP.plebejabroodchamberswasalsostudiedandbacteriawith
in the monophyletic Clade II (Figure 3) with Candidatus Streptomyces morphology were found growing on the larvae
Streptomycesphilanthi,thesolitarywaspPhilanthustriangulum (Figures 4C,D). These hyphae have diameters between 1.2 and
symbiont(Kaltenpothetal.,2005,2014). 1.7 µm. The ultrastructure of adult M. docilis wasp cuticle was
also studied; however, evidence of microorganism growth was
not found. Similarly, no hyphae with morphology similar to
Electron Microscopy for Actinobacteria
Streptomyces were seen when samples from adults, immature
Localization in Brood Chambers and stages,andnestmaterialfromthevespidA.cajennensisandadult
Insect’s Cuticle ants within the species O. erythrocephalus and P. clavata were
From the 24 Actinobacteria isolates associated with the wasps seenunderSEM.
M. docilis, 62% were obtained from the nest substrate.
Isolation and Identification of
Scanningelectronicmicrographsfrombroodchambersfromtwo
Entomopathogenic Fungi
different M. docilis nests revealed the presence of filamentous
microorganisms(Figure4B).Vegetativehyphaewithdiameters The ITS region from seven fungal isolates that were
of1.3–2.4µmwasabundantatthebaseofthebroodchamber obtained from insect cadavers was successfully amplified
but was not observed externally (Figures 4A,B). In the case of and a phylogenetic tree was constructed (Figure 5). These
FrontiersinMicrobiology|www.frontiersin.org 10 October2017|Volume8|Article2016