ebook img

Dystrophin insufficiency causes selective muscle histopathology and loss of dystrophin ... PDF

12 Pages·2014·0.5 MB·English
by  
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Dystrophin insufficiency causes selective muscle histopathology and loss of dystrophin ...

UUnniivveerrssiittyy ooff NNeebbrraasskkaa -- LLiinnccoollnn DDiiggiittaallCCoommmmoonnss@@UUnniivveerrssiittyy ooff NNeebbrraasskkaa -- LLiinnccoollnn Roman L. Hruska U.S. Meat Animal Research U.S. Department of Agriculture: Agricultural Center Research Service, Lincoln, Nebraska 4-2014 DDyyssttrroopphhiinn iinnssuuffifficciieennccyy ccaauusseess sseelleeccttiivvee mmuussccllee hhiissttooppaatthhoollooggyy aanndd lloossss ooff ddyyssttrroopphhiinn--ggllyyccoopprrootteeiinn ccoommpplleexx aasssseemmbbllyy iinn ppiigg sskkeelleettaall mmuussccllee Katrin Hollinger Iowa State University, [email protected] Cai X. Yang Iowa State University Robyn E. Montz Iowa State University Dan Nonneman U.S. Department of Agriculture, [email protected] Jason W. Ross Iowa State University See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/hruskareports Hollinger, Katrin; Yang, Cai X.; Montz, Robyn E.; Nonneman, Dan; Ross, Jason W.; and Selsby, Joshua T., "Dystrophin insufficiency causes selective muscle histopathology and loss of dystrophin-glycoprotein complex assembly in pig skeletal muscle" (2014). Roman L. Hruska U.S. Meat Animal Research Center. 262. https://digitalcommons.unl.edu/hruskareports/262 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Roman L. Hruska U.S. Meat Animal Research Center by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. AAuutthhoorrss Katrin Hollinger, Cai X. Yang, Robyn E. Montz, Dan Nonneman, Jason W. Ross, and Joshua T. Selsby This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ hruskareports/262 The FASEB Journal article fj.13-241141. Published online December 17, 2013. The FASEB Journal (cid:127) Research Communication Dystrophin insufficiency causes selective muscle histopathology and loss of dystrophin-glycoprotein complex assembly in pig skeletal muscle Katrin Hollinger,* Cai X. Yang,* Robyn E. Montz,* Dan Nonneman,† Jason W. Ross,* and Joshua T. Selsby*,1 *Department of Animal Science, Iowa State University, Ames, Iowa, USA; and †U.S. Department of Agriculture, Agricultural Research Services, U.S. Meat Animal Research Center, Clay Center, Nebraska, USA ABSTRACT The purpose of this investigation was to Dystrophinmutationscanresultinsubstantialphys- determine the extent to which dystrophin insufficiency ical and locomotion deficits, leading to wheelchair caused histomorphological changes in a novel pig confinementandearlydeathduetorespiratoryand/or model of Becker muscular dystrophy. In our proce- cardiac failure. The most severe form, Duchenne mus- dures, we used a combination of biochemical ap- cular dystrophy (DMD), is caused by a lack of dystro- proaches, including quantitative PCR and Western phin protein. The generally less severe form, Becker blots, along with a histological analysis using standard muscular dystrophy (BMD), is caused by insufficient andimmunohistologicalmeasures.Wefoundthat8-wk- dystrophinabundanceand/orexpressionofapartially old male affected pigs had a 70% reduction in dystro- functional gene product. phinproteinabundanceinthediaphragm,psoasmajor, Several existing dystrophin-deficient animal models and longissimus lumborum and a 5-fold increase in are currently used in the study of dystrophinopathies. serum creatine kinase activity compared with healthy However, despite the many useful features of the dif- male littermates. Dystrophin insufficiency in the dia- ferent mouse and dog models a few significant draw- phragm and the longissimus resulted in muscle histo- backsexist.Forexample,thediseasephenotypeexhib- pathologywithdisorganizedfibrosisthatoftencolocal- ited by mdx mice is much milder than that of human ized with fatty infiltration but not the psoas. Affected patients with DMD (1, 2) in part due to increased animalsalsohadan80–85%reductionin(cid:1)-sarcoglycan abundance of utrophin, a dystrophin-like protein (3– localization in these muscles, indicating compromised 5). To mitigate this potential confounding variable, assemblyofthedystrophinglycoproteincomplex.Con- mdx/utrophin(cid:1)/(cid:1)miceweredeveloped(5).Whilethe trolsusedinthisstudywere4healthymalelittermates, disease phenotype is more severe in these mice, the astheyaremostcloselyrelatedtotheaffectedanimals. double-knockout approach allows for the possibility We concluded that pigs with insufficient dystrophin that muscle function and metabolism are affected protein expression have a phenotype consistent with independent of the dystrophin mutation. Additional humandystrophinopathypatients.Giventhatandtheir dystrophin-deficientmodelswithasecondarymutation similarity in body size and physiology to humans, we havesincebeendeveloped(5–7).Regardlessofmouse further conclude that this pig line is an appropriate model, there is a poor correlation between effective- translational model for dystrophinopathies.—Hol- ness of therapies in mouse models to that observed in linger, K., Yang, C. X., Montz, R. E., Nonneman, D., human patients (8), as scaling from a mouse to a Ross,J.W.,Selsby,J.T.Dystrophininsufficiencycauses humanischallengingforavarietyofreasons,including selectivemusclehistopathologyandlossofdystrophin- expense, safety, and differences in body size. glycoprotein complex assembly in pig skeletal muscle. In addition to mouse models, a golden retriever FASEB J. 28, 000–000 (2014). www.fasebj.org muscular dystrophy (GRMD) model has also been discovered and is the best characterized of identified dog models (9). GRMD dogs have a phenotype that is Key Words: Duchenne muscular dystrophy (cid:1) DMD (cid:1) Becker more similar in severity and in selective muscle injury muscular dystrophy (cid:1) BMD (cid:1) animal model compared with human patients than mdx mice (10, Abbreviations: BMD, Becker muscular dystrophy; DGC, 1Correspondence: Iowa State University, Department of dystrophinglycoproteincomplex;DMD,Duchennemuscular Animal Science, 2356 Kildee Hall, Ames, IA 50011, USA. dystrophy; DTNA, (cid:2)-dystrobrevin; GRMD, golden retriever E-mail:[email protected] muscular dystrophy; H&E, hematoxylin and eosin; IHC, im- doi:10.1096/fj.13-241141 munohistochemistry;MHC,myosinheavychain;NOS1,(neu- This article includes supplemental data. Please visit http:// ronal)nitricoxidesynthase1;SGCA,(cid:2)-sarcoglycan www.fasebj.orgtoobtainthisinformation. 0892-6638/14/0028-0001©FASEB 1 11). However, GRMD dogs have a high degree of longissimus is generally used more frequently and is com- phenotypic variability (12, 13), and, as in mdx mice, prisedprimarilyoftypeIIfibers. limited adiposity is observed. Finally, dystrophic dogs treated with corticosteroids exhibited a greater fre- Plasmacreatinekinaseactivity quency of calcified necrotic fibers and impairment of some measures of muscle function (14), which is con- Plasma creatine phosphokinase was measured using a 2-part reagent system (Pointe Scientific, Canton, MI, USA), follow- trary to the beneficial effects of steroid use in human ing the manufacturer’s instructions, in a SpectraMax M5 patients (15). The objective of this project was to microplate plate reader (Molecular Devices, Sunnyvale, CA, characterize the skeletal muscle phenotype of a re- USA).Samples(25(cid:5)l)weremeasuredinduplicate,andthe cently discovered pig line with a spontaneously occur- rate of NADH formation was monitored at 340 nm at 37°C. ring substitution in exon 41 of the dystrophin gene Sampleshaving(cid:6)2500U/LweredilutedinPBSandassayed causing an arginine to tryptophan amino acid change. again. This substitution leads to decreased dystrophin abun- dance in skeletal and cardiac muscle (16). To develop mRNAquantification novel therapeutic strategies to treat dystrophinopa- thies, there must be animal models that accurately Muscle samples were powdered with a dry-ice-chilled mor- recapitulate the disease. Currently available models tar and pestle. Total RNA was extracted from (cid:4)50 mg of powdered muscle using Trizol (Invitrogen, Carlsbad, CA, have been useful; however, their inherent limitations USA), following the manufacturer’s instructions with mi- have hindered drug development and approval. The nor modifications. The RNA was then column purified anatomy, physiology, and genetics of pigs are more (RNeasyMiniKit,Qiagen,Valencia,CA,USA)tominimize similar to those of humans than are those of mice or organic carryover. On the column, and before RNA elu- dogs. These similarities increase the likelihood of a tion, DNase digestion (RNase free DNase set; Qiagen) was moreaccuraterecapitulationofthehumandiseaseand used to prevent DNA contamination of the sample. After alsomitigatechallengesindrugscale-up,aspigsareof quantification using a Nanodrop (Thermo Scientific, Waltham, MA, USA), 1 (cid:5)g of RNA was reverse-transcribed human size. Pigs are currently being used widely for (QuantiTect Reverse Transcription Kit; Qiagen) following advancements in human health research (reviewed in the manufacturer’s instructions, with the addition of re- ref.17),sothissuggestionisnotunprecedented.Inthis verse transcription primers for 18S ribosomal RNA. The report, we detail the early muscle response to dystro- 18S rRNA does not contain a poly-A tail, and the addition phin insufficiency in the diaphragm, psoas major, and of the 18S reverse-transcription primers ensures that the longissimus lumborum. Our hope is that dystrophin- 18S rRNA can be converted into cDNA. For quantitative insufficient pigs will aid in the development of thera- PCR, equal amounts of cDNA, corresponding to 10 ng of reverse-transcribed mRNA, were loaded into each well. To peutic strategies by supplementing currently available measure gene expression, primer pairs (Table 1) were animal models. mixed together with a QuantiFast SYBR Green PCR kit (Qiagen) in a reaction volume of 12.5 (cid:5)l, and gene expression was measured with a Mastercycler EP Realplex (Eppendorf,Hauppauge,NY,USA).AttheendofthePCR MATERIALS AND METHODS program, melting curves for all amplicons were inspected to verify that a single product was amplified with each primer pair. The pig genome has been sequenced and is Animaluse well annotated (18), allowing construction of appropriate primerpairs.Allsamplesweremeasuredintriplicatewells. All animal procedures were reviewed and approved by the U.S. Meat Animal Research Center Animal Care and Use Proteinextraction Committee,andproceduresforhandlingpigscompliedwith those specified in the Guide for the Care and Use of About 500 mg of powdered muscle was added into a glass AgriculturalAnimalsinAgriculturalResearchandTeaching. TeflonDouncehomogenizerwith0.7mlextractionbuffer Animals were housed in 6.5- (cid:3) 8-foot nursery pens by litter (2% SDS and 10 mM phosphate buffer, pH 7). Following until8wkofage.Affectedpigswereidentifiedbygenotyping (cid:4)20 strokes of the homogenizer, the homogenizer was with a Sequenome MassArray system (Sequenome, Inc., San rinsedwith0.3mlofextractionbuffer,whichwascollected Diego,CA,USA;ref.16).At8wkofage,4maleaffectedpigs into the homogenized sample for a total dilution of 2:1. and 4 male healthy littermates were euthanized by electrical Samples were centrifuged at 1500 g for 15 min at room stunning, followed by exsanguination, and (cid:4)5-g portions of temperaturetoremoveinsolublematerial.Proteinconcen- themedialdiaphragm,psoasmajor,andlongissimuslumbo- tration was measured with the BCA kit (Pierce, Rockford, rumatthelastribwerecollectedwithin15minofstunning. IL, USA) at a 1:10 dilution in triplicate. All samples were Musclesweresnap-frozeninliquidnitrogenforbiochemical dilutedtoaproteinconcentrationof3.5(cid:5)g/(cid:5)linloading analyses or frozen in isopentane or fixed in 10% buffered buffer(62.5mMTris,pH6.8;2%SDS;10%glycerol;2.5% formalinforhistologicalanalyses.Frozensampleswerestored (cid:7)-mercaptoethanol; and 0.002% bromophenole blue) and at(cid:1)80°Cuntilanalyzed.Thediaphragmwaschosenbecause heated to 95°C for 5 min. itisusedinrespirationandisaprimarycauseofmortalityin patients with dystrophinopathy and therefore of importance for disease progression. The psoas and longissimus were Westernblotanalysis chosen because of their differing uses and composition of differentfibertypes.Specifically,thepsoasisgenerallylightly Protein (35 (cid:5)g; 10 (cid:5)l) was separated at 60 V for 15 min, used and is comprised largely of type I fibers, while the followed by 1 h at 120 V in a 4–20% gradient polyacryl- 2 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL. TABLE 1. Primer sequences used for quantitative PCR Primer Sequence Accessionnumber Ampliconlength DMD5=pigFor(exon9) CCTCGGTTCAAGAGCTATGC NM_001012408 128 DMD5=pigRev(exon10) TCCAACAATGAACTGCCAAA DMD5=ofSNPpigFor(exon37)a AGCAAACTTGATGGCAAACC NM_001012408 121 DMD5=ofSNPpigRev(exon38) AATGGAGGCCTTTCCAGTCT DMDacrossSNPpigFor(exon40) TCAGTACAAGAGGCAGGCTG NM_001012408 330 DMDacrossSNPpigRev(exon42) GGCATGTCTTCAGTCATCAC DMD3=ofSNPpigFor(exon41) AATTTGCTCACTTTCGAAGA NM_001012408 185 DMD3=ofSNPpigRev(exon42) GAGGTCAGGAGCATTGAGAA DMD3=pigFor(exon62/63) CCACGAGACCCAAACAACTT NM_001012408 153 DMD3=pigRev(exon65) AGGCTCAAGAGATCCAAGCA TNFpigFor GCCCTTCCACCAACGTTTTC NM_214022 158 TNFpigRev TCCCAGGTAGATGGGTTCGT IL1BpigFor AAGATAACACGCCCACCCTG NM_214055 293 IL1BpigRev TGTCAGCTTCGGGGTTCTTC IL6pigFor AGATGCCAAAGGTGATGCCA NM_001252429 363 IL6pigRev CTCAGGGTCTGGATCAGTGC MYOD1pigFor CTACAGCGGTGACTCAGACG NM_001002824 121 MYOD1pigRev GCTGTAATAGGTGCCGTCGT DTNApigFor ACTACCCACGGCAGTTTTTG XM_003356399 110 DTNApigRev GCGTGTCCAAGAAACCATTT SGCApigFor AGGTCGAAAGGAAGGCGTAT NM_001144122 131 SGCApigRev CATAGCAGGACAGCAGTGGA NOS1pigFor GGAAAACAGTCTCCCACCAA XM_003132898 127 NOS1pigRev ATCCTGTTCCCAATGTGCTC UTRNpigFor GAACGGATCATTGCTGACCT XM_003121163 177 UTRNpigRev CCTGAGGAGTTTGGCTTCTG 18SRTprimer GAGCTGGAATTACCGCGGCT 18SpigFor AAACGGCTACCACATCCAAG NR_046261 141 18SpigRev TCGCGGAAGGATTTAAAGTG DTNA,(cid:2)-dystrobrevin;For,forward;IL1B,interleukin1(cid:7);IL6,interleukin6;MYOD1,myogenicdifferentiation1;NOS1,(neuronal)nitric oxidesynthase1;Rev,reverse;SGCA,(cid:2)-sarcoglycan;TNF,tumornecrosisfactor;UTRN,utrophin.aGeneBankdbSNPss410758971. amide gel (Lonza, Rockland, ME, USA). Following separa- the film was scanned and digitized, and band density was tion, the protein was transferred to a nitrocellulose mem- measured using Carestream 5.0 molecular imaging soft- brane (GE Water and Process Technologies, Feasterfille- ware (Carestream Health, New Haven, CT, USA). Trevose,PA,USA)at90Vfor90mininthecoldroom.For blots intended to detect dystrophin or utrophin, protein was separated using 6% gels coupled with a 4% stacking Histologicalstaining gel.Theseseparationswererunat30Vovernightandthen continued as described previously, with the exception that Fixed 5-(cid:5)m muscle sections were deparaffinized and rehy- PVDF membrane (Millipore, Billerica, MA, USA), rather drated by passing slides through 3 Citrisolv (Fisherbrand, than nitrocellulose membrane, was used. In our hands, King of Prussia, PA, USA) baths and 4 ethanol baths with PVDF performs better than nitrocellulose for detection of decreasingpercentagesofethanol(100,100,95,and80%). largeproteins.AllmembraneswerestainedwithPonceauS Hematoxylin and eosin (H&E) staining was performed to verify equal loading and transfer. Membranes were according to standard techniques. Briefly, sections were blocked for 30 min with 5% milk in Tris-buffered saline incubated in Mayer’s hematoxylin, rinsed with tap water, with 0.1% Tween 20 (TTBS). Membranes were subse- counterstained with 1% eosin, and dehydrated, and cover- quently incubated with primary antibody diluted in 1% slips were applied. To perform the trichrome stain, rehy- milk in TTBS at 4°C overnight as follows: dystrophin drated sections were incubated in Bouin’s solution over- [1:500; rabbit polyclonal (Abcam, Cambridge, MA, USA); ab15277; aa 3661–3677], (cid:2)-sarcoglycan (1:1000; NCL-L-a- night at room temperature. The next day, slides were thoroughly rinsed in tap water and stained with Weigert’s SARC; Novocastra, Newcastle, UK), and utrophin [1:250; hematoxylin. Slides were blued with tap water and stained Developmental Studies Hybridoma Bank (DSHB), Univer- with Biebrich scarlet. Excess stain was removed with dis- sityofIowa,IowaCity,IA,USA;MANCHO3(8A4)concen- tilled water before differentiating sections in a phospho- tratedevelopedbyG.E.Morris].Thenextday,membranes were washed 3 times for 10 min in TTBS and incubated in tungstic/phoshomolybdic acid solution. After differentia- secondary antibody: donkey anti-rabbit IgG horseradish tion slides were stained with aniline blue. Extra stain was peroxidase linked (1:200; GE Healthcare, Little Chalfont, washed off with distilled water, and sections were differen- UK) or sheep anti-mouse IgG horseradish peroxidase tiated in 1% acetic acid. Finally, acetic acid was rinsed off linked (1:2000; GE Healthcare) for 1 h atroom tempera- with distilled water, sections were dehydrated, and cover- ture, as appropriate. Membranes were again washed 3 slips were applied. To assess muscle damage, slides were times for10 min with TTBS. After the last wash, ECL coded, and identifying information was removed. In a (Millipore)wasaddedtothemembranes,andemittedlight blinded fashion, the same trained technician subjectively wascapturedwithfilm.Toanalyzetheproteinabundance, sorted the slides according to increasing damage. DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 3 Immunohistochemistry(IHC) using fluorescein conjugated goat anti-mouse IgG at 1:100 (Millipore), and laminin was detected as before. Slides were Dystrophinexpressionandlocalizationweremeasuredusing imaged at (cid:3)100, which resulted in (cid:4)200–750 cells/image. fixed sections. Muscle sections (5 (cid:5)m) were deparaffinized, Foranalyses,boththetotalnumberofcellsperimageandthe andantigenretrievalwasperformedbyheatingfor20minat number of positive staining cells per image were counted 95–100°CinTris-EDTAbuffer(10mMTrisbase,1mMEDTA using ImageJ (19). The cell counts from 2 images/section solution, and 0.05% Tween 20, pH 9.0). After cooling to werepooled,resultingin(cid:4)500–1300cells/section. roomtemperatureand2washesinPBS,slideswereblocked with 5% BSA in PBS for 15 min at room temperature. Statistics Following blocking, slides were incubated overnight at 4°C withmousemonoclonalanti-dystrophinantibody(D8168;aa Alldataareexpressedasmeans(cid:8)seunlessotherwisenoted. 1400–1505;Sigma,St.Louis,MO,USA)diluted1:300in5% Datawerecomparedusingttests,andsignificancewassetat BSA. After 3 washes with 0.05% Tween-20 in PBS, sections P(cid:1)0.05. wereincubatedwithAlexaFluor488-labeledgoatanti-mouse IgG(1:100;Invitrogen)for1hatroomtemperatureandthen washed again. Slides were mounted with Slowfade Gold Antifade Reagent with DAPI (Invitrogen). Notably, for all RESULTS IHCtargets,somesectionswereincubatedwithoutaprimary antibodyorwithoutsecondaryantibodyasnegativecontrols. For detection of desmin, 10-(cid:5)m frozen muscle sections Dystrophin deficiency in pigs with an arginine to werewashedinPBSfor10minbeforeblockingwith5%BSA tryptophan (R1958W) substitution in PBS at room temperature for 15 min. Sections were incubated overnight at 4°C with rabbit anti-desmin serum Skeletal muscles from 8-wk-old male pigs with a mis- (1:100; a gift from Dr. Ted Huiatt, Iowa State University, sensemutationinthedystrophingene werecompared Ames,IA,USA).Thenextday,sectionswerewashed3times with healthy male littermates. Dystrophin protein ex- with PBS and incubated with rhodamine-conjugated donkey pression was decreased by 70% in diaphragm, psoas, anti-rabbitIgG(1:100;Millipore)for1hatroomtemperature and longissimus collected from affected animals (tryp- in the dark. After the secondary incubation, slides were washed 3 times with PBS, and coverslips were mounted and tophan) compared with healthy littermates (arginine) sealed as above. To assess dystrophin-glycoprotein complex (Fig. 1A). This decrease was confirmed by 70–90% (DGC)stabilityinaffectedanimalsandhealthypigs,IHCfor reduction in expression by IHC in the diaphragm and (cid:2)-sarcoglycan (Novocastra, Newcastle, UK) expression and thelongissimusbutwasnotsignificantlydifferentinthe localizationwasmeasuredincombinationwithlaminin(Neo- psoas (Fig. 1B, C). Notably, full-length dystrophin pro- Markers, Fremont, CA, USA). Sections were treated as de- tein was present in all muscles, and it was evenly scribedpreviously,andbothprimaryantibodieswereusedat localized to the sarcolemma, suggesting that these aconcentrationof1:100.Secondarygoatanti-mousefluores- cein-conjugated(Millipore)andgoatanti-rabbitrhodamine- muscles are dystrophin insufficient as opposed to dys- conjugated IgG (Millipore) were used at a dilution of 1:100 trophin deficient. for1hatroomtemperatureinthedarktodetect (cid:2)-sarcogly- To better understand the mechanism leading to canandlaminin,respectively. decreased dystrophin protein accumulation, we mea- For analysis of protein abundance following IHC, 2 non- sureddystrophingeneexpression(Fig.1D–FandTable overlapping (cid:3)200 pictures were randomly taken from each 1). Gene expression was similar at the 5= end of the sectionwiththeappropriatefilters.Foreachprotein,images gene,immediatelyupstreamofthesubstitutioninexon were collected on the same day for each muscle under identical exposure conditions in random order and in a 41, across the substitution, and immediately down- blinded procedure by a technician. Digital images were streamofthesubstitutioninthediaphragmandpsoas. transferred to Openlab (Perkin Elmer, Waltham, MA, USA) In the longissimus, there was a 50% reduction in gene sothatfluorescenceintensitycouldbemeasured.Thedensity expression at all 4 locations. Transcript abundance slice function was used to transform the image into a binary amplifiedbyprimersdesigned3=ofthesubstitutionwas image such that pixels were identified as either above or significantlylowerinthediaphragm,psoas,andlongis- below threshold intensity. Threshold was determined by simus by 60, 45, and 70%, respectively, indicating measuring pixel intensity of intracellular and extracellular areas, as well as at several locations on the sarcolemma in decreased transcript stability. variousrandomsections.Allimagesweretakenandprocessed underthesameconditions.TomeasureminimalFeretdiam- Dystrophin insufficiency is associated with muscle eter,thelamininimageswereconvertedintobinaryimagesas histophatology describedabove.ImageswerethenexportedtotheImagePro software(MediaCybernetics,Rockville,MD,USA),wherethe Dystrophin insufficiency was associated with a 5-fold minimalFeretdiametertoolwasusedtoobtainthemeasure- ment.ThemeasurementswereexportedtoExcel(Microsoft, increase in serum creatine kinase activity (Fig. 2A), Redmond,WA,USA),wherethedatawerebinnedandmean whichisconsistentwithotherdystrophinopathymodels diameterandcoefficientofvariancewerecalculatedforeach and human patients with BMD or DMD patients. In muscle. addition, affected and healthy animals could be distin- For determination of fiber type differences in affected guished from one another during histological evalua- animals compared with healthy littermates, IHC for slow tion(evaluatorblindedtothegenotypeoftheanimal) myosin(A4.951)wasperformedinfrozensectionsincombi- of the diaphragm and longissimus but not the psoas. nationwithlaminin.TheA4.651serum(DSHB;developedby H.M.Blau,StanfordUniversity,Stanford,CA,USA)wasused Dystrophin insufficiency led to necrotic lesions in dia- undiluted. Type I myosin heavy chain (MHC) was detected phragm and longissimus muscle, apparent in both 4 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL. Figure 1. Dystrophin protein abundance and localization.Dystrophinwasassayedinthedia- phragm, psoas, and longissimus in muscles takenfromhealthypigsandpigscontainingan arginine to tryptophan (R1958W) polymor- phisminexon41ofthedystrophingene,DMD. A) By Western blot, dystrophin protein abun- dance was decreased by 70% in muscles from diseased animals compared with muscles from healthy animals. B) Representative (cid:3)400 im- agesresultingfromIHCtargetedtodystrophin. C) Following fluorescence quantification, dys- trophin abundance by IHC was significantly decreased in the diaphragm and longissimus (P(cid:9)0.05),butfailedtoreachsignificanceinthe psoas,inpartbecausevariabilityinthecontrol animals was high and in part because the magnitude of change in the psoas was not as substantial as in the diaphragm and longissi- mus. D) Dystrophin transcript abundance at 5 locations along DMD in the diaphragm. SNP, single-nucleotidepolymorphism.E)Dystrophin transcriptabundanceat5locationsalongDMD in the psoas. F) Dystrophin transcript abun- dance at 5 locations along DMD in the longis- simus.*P(cid:1)0.05vs.correspondingcontrol. H&E and trichrome images (Fig. 2B). Evident in these coefficientoffiberdiameterswasincreasedby(cid:4)20%in lesions was disorganized fibrosis and fatty infiltration thediaphragmprovidinganobjectivemeasureofmus- thatgenerallycolocalized.Immunecellinfiltrationwas cle injury (Fig. 2C). Variance coefficient of fiber diam- onlyoccasionallypresentalongwithimmunecellattack eter in the psoas and longissimus was similar between of skeletal muscle cells. Gene expression indicating groups. inflammation, including tumor necrosis factor (TNF), interleukin 1(cid:7) (IL1B), and interleukin 6 (IL6) was Dystrophin insufficiency alters expression of DGC similarbetweengroupsinall3muscles(Supplemental members but not other membrane proteins Table S1). Notably rare in these muscles was the appearance of centralized nuclei. Related, myogenic In human patients and other animal models, a lack of differentiation 1 (MYOD1) expression was similar be- dystrophin or insufficient dystrophin expression leads tweengroups(SupplementalTableS1)forallmuscles, to a collapse of the DGC. Gene expression of (cid:2)-sar- suggesting that satellite cell activation is not wide- coglycan (SGCA), (cid:2)-dystrobrevin (DTNA), and (neuro- spread.Whiletherewerenecroticlesionsevidentinthe nal) nitric oxide synthase 1 (NOS1; also known as longissimus and diaphragm from affected animals, nNOS) was similar in healthy and affected animals for there were also areas that appeared similar to healthy all 3 muscles (Supplemental Table S1). Proteinexpres- animals (Supplemental Fig. S1). sion by Western blot, however, demonstrated a 50% Meanfiberdiameter(minimumFeretdiameter)was reductioninSGCAabundanceinall3muscles(Fig.3A). similar between healthy and affected pigs across the 3 Such discordant gene and protein expression for muscles (Supplemental Fig. S2); however, the variance DGC components is consistent with other animal DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 5 Figure 3. Dystrophin insufficiency leads to a reduction in (cid:2)-sarcoglycan abundance but not utrophin abundance. A) Representative Western blot of (cid:2)-sarcoglycan indicating an Figure 2. Dystrophin insufficiency leads to muscle injury. A) (cid:4)50%reduction.B)Representative(cid:3)400imagesforIHCof Serum creatine kinase activity was increased 4-fold in affected (cid:2)-sarcoglycan.C)Fluorescentintensitywasquantifiedandan pigscomparedwithhealthylittermates.B)Representative(cid:3)200 80–85% reduction was found in the diaphragm and the images of slides stained with H&E or trichrome. In a blinded longissimusfromaffectedanimalswhilethepsoaswassimilar fashion,diaphragmsectionsandlongissimussectionsweresuc- betweengroups.D)RepresentativeWesternblotofutrophin cessfullyidentifiedaseitherfromhealthyoraffectedpigsbythe and quantification. Utrophin was similar between groups. appearanceofnecroticlesions,whileaffectedandhealthypsoas *P(cid:1)0.05vs.correspondingcontrol. muscleswereindistinguishable.C)MinimumFeretdiameterwas determined on 500–1200 cells/muscle for the diaphragm, models as well as human patients with DMD (20). psoas,andlongissimustakenfromhealthyandaffectedpigs,and SGCA protein abundance was also measured by IHC thevariancecoefficientwascalculated.Variancecoefficientwas increased in the diaphragm taken from affected animals com- and found to be decreased by 80–85% in the dia- pared with healthy animals but was similar in the longissimus phragm and longissimus, while expression was simi- andpsoas.*P(cid:1)0.05vs.correspondingcontrol. lar in the psoas (Fig. 3B, C). 6 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL. In addition to SGCA, we also measured abundance and localization of several other membrane proteins. Abundance and localization of laminin (Fig. 3 and Supplemental Fig. S3) and desmin (Supplemental Fig. S4) were similar between healthy and affected animals forall3muscles.Notably,wefoundthatutrophingene expression(SupplementalTableS2),aswellasprotein expression, was similar between healthy and affected pigs for all 3 muscles (Fig. 3D). Hence, these muscles haveasimilarlossofexpressionandorganizationofthe DGC, as is observed in human patients and other animal models, without observing compensatory utro- phin expression, as in the mouse model. Becauseinotheranimalmodelsandhumanpatients dystrophinopathyisassociatedwithaprogressivetypeI shift, we measured type I fiber distribution in these muscles.Surprisingly,atthisearlytimepointtherewas a 20% increase in type I fibers in the affected dia- phragms compared with healthy muscle. Fiber type distribution in the longissimus and psoas was similar between groups (Fig. 4). DISCUSSION Because of inherent limitations in existing animal models of dystrophinopathy, there has been great interest in establishing a novel large animal model of the disease. A genetic line of pigs was recently discov- ered that was more susceptible to stress-mediated death.Agenome-wideassociationidentifiedadefectin thedystrophingene,whichwasassociatedwithareduc- tion in dystrophin protein accumulation in skeletal muscle (16). In this investigation, we evaluated the expression and abundance of dystrophin and DGC components in diaphragm, psoas major, and longissi- muslumborummusclefromhealthyandaffected8-wk- old male pigs. For pigs, the use of the muscles exam- ined in this study vary greatly in their function, such Figure 4. Dystrophin insufficiency alters fiber type distribu- tion.A)Representative(cid:3)200imageofIHCfortypeIMHC. that the diaphragm is used during respiration; the B)TypeIMHC-positivecellswereincreased20%inaffected longissimus is a heavily used antigravity muscle and is diaphragms compared with diaphragms from healthy ani- involved in transitioning from laying to standing, dur- mals, while the psoas and longissimus were similar between ing standing, in shifting weight from one leg to an- groups.*P(cid:1)0.05vs.correspondingcontrol. other,andinlyingdown;thepsoas,ahipflexor,isonly lightly used. We found that in these muscles, dystro- phin protein accumulation was decreased in affected of a Becker phenotype, not Duchenne. While the pigs, as was expression of SGCA, a DGC component, Leiden database does not yet have record of a compared with healthy male littermates. This was asso- BMD-causing missense mutation at this precise loca- ciated with muscle histopathology consisting of ne- tion, there are numerous documented instances of crotic lesions, fatty infiltration, fibrosis, and increased missense mutations leading to BMD (21–24). To fiber-size variability in a muscle specific fashion. Nota- better understand the molecular cause of decreased bly, expression of utrophin, a protein that can substi- dystrophin protein accumulation, dystrophin gene tute for the missing dystrophin protein, was similar DMD expression was measured using primers against between groups. multiple sites along the DMD gene. Gene expression At 8 wk of age, affected pigs had a 70% reduction inthelongissimuswassignificantlyreducedalongthe of DMD in the diaphragm, psoas, and longissimus entire gene, while the diaphragm and the psoas only comparedwithhealthylittermatesthatresultedfrom show a reduction at the 3= end of the gene, suggest- auniformreductionindystrophinlocalizationtothe ing that the point mutation in the dystrophin gene sarcolemma.Becauseeachmusclecontainedresidual makes the transcript less stable. This 5=–3= transcript full-length dystrophin, these pigs are representative imbalance also has been observed in patients with DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 7 BMD (25). How a substitution in the amino acid affectedanimals;however,localizationofDGCcompo- sequence alters susceptibility to proteolysis is un- nentswassimilar.Hence,thesedatasuggestthatinthe known.Togainadditionalinformationregardingthe psoas a greater proportion of these proteins are resi- probability of calpain degradation, using CaMPDB dent at the sarcolemma than in the diaphragm or (26), we performed in silico digests of aa 1867–2097, longissimus. It is reasonable to suggest then that the which is inclusive of the amino acid substitution. We similar DGC localization between the psoas from af- foundthattheaffectedsequencewaspredictedtobe fected and health pigs protects the psoas from injury. more susceptible to calpain degradation than se- Alternatively, the pattern of use of the psoas in pigs quence from control animals. Also, the vastly differ- relative to the diaphragm and longissimus may differ ent amino acid properties of arginine and trypto- resulting in less injury and subsequently allowing dys- phan likely contribute to aberrant protein folding or trophin accumulation at the sarcolemma. If this were a resultant conformational change causing reduced the case, it would suggest that increased use, such as protein stability (22). Alternatively, altered electro- during exercise, could hasten disease progression (35, static interactions in the rod domain may also destabi- 36). Finally, the psoas is predominantly composed of lize the dystrophin protein (27). These data suggest typeIfibers,whicharegenerallymorediseaseresistant that dystrophin insufficiency results from decreased thantypeIIfibers,andmay,therefore,offerprotection transcriptstabilityand,speculatively,increasedprotein from disease. degradation. The absence or reduction of dystrophin protein Like in other animal models (11, 28, 29) and accumulationinhibitsassemblyoftheDGCindystro- humanpatients(30),failuretoaccumulatesufficient phic muscle (28–30). In the affected diaphragm, dystrophin protein leads to a systemic collapse of longissimus, and psoas, gene expression of SGCA, muscle stability, resulting in a 4-fold increase in NOS1, and DTNA was similar to healthy littermates, serum creatine phosphokinase. H&E and trichrome which is consistent with other animal models and staining revealed injury in both the diaphragm and human patients (20). Dysregulation becomes appar- longissimus of affected animals, including fatty infil- ent when evaluating protein accumulation and local- tration, fibrosis, and necrotic fibers. A progressive ization of these products. Protein expression and increase in adiposity is a hallmark of dystrophinopa- localizationofSGCAwasdecreasedinthediaphragm thyinhumanpatients(31),althoughitisnotpresent andlongissimus.Surprisingly,thereductioninSGCA inthemdxmouseortheGRMDdog(1).Atthisearly accumulation by Western blot measured in the psoas time point, and similar to muscle from patients, we was not well matched with expression measured by did not see accumulation of adipocytes and fibrosis IHC. This was consistent, however, with dystrophin throughout the entire muscle but rather colocalized measurement by IHC in this muscle. Collectively, withinfociofnecrosis.Withinthesefoci,fibrosisand these observations indicate that in the diaphragm infiltrating adiposity appeared disorganized, in con- andlongissimus,DGCcomponentproteinsarebeing trast to the high degree of organization found in translated(albeitlessthaninhealthymuscle)butare healthyregionsofmusclesfromaffectedanimalsand failing to integrate into the membrane. Conversely, muscles from healthy animals. in the psoas, translated DGC components appear to Fiber-size variation is another indicator of muscle integrate at an abundance that is similar to healthy injury, and degeneration/regeneration cycles where muscle. Apparent DGC fidelity is consistent with larger variance coefficients are indicative of disease muscleinjury,suchthat,at8wkofage,muscleinjury in other animal models and patients with dystrophi- in the diaphragm and longissimus was apparent; nopathy (32). Consistent with our subjective histo- however, the psoas was not distinguishable between logical evaluation, the objectively measured variance diseased and healthy animals. coefficients in fiber-size distribution were signifi- In addition, expression and localization of laminin cantly increased in diaphragm from affected pigs compared with healthy littermates. Finally, dystro- and desmin were similar between groups, indicating phic muscle undergoes a progressive type I shift as that there is not a wholesale collapse of membrane this fiber type is generally less susceptible to disease- structure. Also, utrophin expression was similar be- relatedinjury(33,34).Whileunexpectedatthisearly tween groups for all muscles, eliminating one of the time point, the frequency of type I fibers was in- compensatory mechanisms and, hence, limitations creased in diaphragms from affected animals com- noted in other animal models. pared with healthy animals. In total, these data indicate that these pigs have Despite being dystrophin insufficient like the dia- musclehistopathologyconsistentwithadystrophinopa- phragm and longissimus, the psoas did not show signs thy. That full-length dystrophin is present at the mem- of increased muscle histopathology, as assessed brane further implicates these pigs as a novel large through subjective histological evaluation or, more animal model of BMD. Given the genetic, anatomical, objectively,byfiberdiametervariance.Themechanism andphysiologicalsimilaritiesbetweenpigsandhumans leading to preservation of the psoas is of potential andthefactthatthesepigsrecapitulatemanyhallmarks therapeutic interest. Like in the other muscles investi- of disease, there is the promise that the BMD pig will gated, DGC abundance was decreased in psoas from resultinatranslationaldiseasemodelcapableoffilling 8 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL.

Description:
secondary antibody: donkey anti-rabbit IgG horseradish peroxidase linked .. longissimus is a heavily used antigravity muscle and is involved in
See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.