ebook img

Development of MHC-Linked Microsatellite Markers in the Domestic Cat and Their Use to Evaluate ... PDF

13 Pages·2014·2.74 MB·English
by  
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Development of MHC-Linked Microsatellite Markers in the Domestic Cat and Their Use to Evaluate ...

Journal of Heredity 2014:105(4):493–505 © The American Genetic Association 2014. All rights reserved. doi:10.1093/jhered/esu017 For permissions, please e-mail: [email protected] Advance Access publication March 11, 2014 Development of MHC-Linked Microsatellite Markers in the Domestic Cat and Their Use to Evaluate MHC Diversity in Domestic Cats, Cheetahs, and Gir Lions D o w n lo Katrina M. Morris, Katherine Kirby, Julia a. beatty, Vanessa r. barrs, sonia Cattley, ad e d ViCtor DaViD, stephen J. o’brien, Marilyn Menotti-rayMonD, anD Katherine beloV fro m h From the Faculty of Veterinary Science, University of Sydney, Sydney, NSW 2006, Australia (Morris, Kirby, Beatty, Barrs, and ttp Belov); the ANGIS, University of Sydney, Sydney, NSW 2006, Australia (Cattley); the Laboratory of Genomic Diversity, s://a National Cancer Institute, Frederick, MD 21702-1201 (David and Menotti-Raymond); the Theodosius Dobzhansky Center c a d for Genome Bioinformatics, St. Petersburg State University, St. Petersburg, Russia (O’Brien); and the Oceanographic Center, e m Nova Southeastern University, Ft Lauderdale, FL 33314-7796 (O’Brien). ic .o u p Address correspondence to K. Belov at the address above, or e-mail: [email protected]. .c o m /jh Data deposited at Dryad: http://dx.doi.org/doi:10.5061/dryad.7mt1t e re d /a Abstract rticle -a b Diversity within the major histocompatibility complex (MHC) reflects the immunological fitness of a population. MHC- s linked microsatellite markers provide a simple and an inexpensive method for studying MHC diversity in large-scale studies. trac We have developed 6 MHC-linked microsatellite markers in the domestic cat and used these, in conjunction with 5 neutral t/1 0 microsatellites, to assess MHC diversity in domestic mixed breed (n = 129) and purebred Burmese (n = 61) cat populations in 5/4 Australia. The MHC of outbred Australian cats is polymorphic (average allelic richness = 8.52), whereas the Burmese popula- /4 9 3 tion has significantly lower MHC diversity (average allelic richness = 6.81; P < 0.01). The MHC-linked microsatellites along /2 9 with MHC cloning and sequencing demonstrated moderate MHC diversity in cheetahs (n = 13) and extremely low diversity in 6 1 Gir lions (n = 13). Our MHC-linked microsatellite markers have potential future use in diversity and disease studies in other 89 1 populations and breeds of cats as well as in wild felid species. b y Subject area: Population structure and phylogeography gu e s Key words: Acinonyx jubatus, Felis catus, major histocompatibility complex, Panthera leo t o n 0 5 A p ril 2 The major histocompatibility complex (MHC) is a genomic proteins present endogenous peptides to CD8+ T cells and 01 9 region found in all jawed vertebrates that encodes proteins serve as recognition elements for natural killer cells. These important for disease resistance (Klein 1986). These MHC proteins play a key role in the recognition of virally infected proteins bind foreign peptides and present them to T cells, cells and neoplastic cells (Williams et al. 2002). The expres- allowing for self/non-self recognition (Brown et al. 1988). sion of class II MHC proteins is restricted to lymphocytes MHC genes are the most polymorphic genes in the vertebrate (Hunt et al. 1995; Delves et al. 2006). These molecules pre- genome (Krausa and Browning 1996) with more than 1500 sent peptides generated in the vesicles of antigen-presenting allele variants identified for a single Class II locus in humans cells, which are recognized by CD4+ T cells, activating B cells (Marsh et al. 2010). The diversity of MHC genes is likely to to produce antibodies (Villadangos 2001). have arisen through pathogen-driven selection and is main- The feline MHC, also known as the feline leukocyte anti- tained by balancing selection (Klein et al. 1993). Class I MHC gen (FLA) region, has been recently sequenced and assembled 493 Journal of Heredity using bacterial artificial chromosomes (Yuhki et al. 2003, 2007, diversity in different wild cat species including the puma, tiger, 2008). The class I region of the FLA region encodes 12 func- and lion (Menotti-Raymond and O’Brien 1995). Two felid tional class I genes (Yuhki et al. 2007). Based on promoter populations that are believed to have restricted MHC diversity structure, sequence polymorphism, and tissue expression, 3 are the cheetah (Acinonyx jubatus) and the Gir lion (Panthera leo class I genes (FLAI-E, FLAI-H, and FLAI-K) are proposed persica). The cheetah is listed as a vulnerable species with only to be classical class I genes (Yuhki et al. 2008; Holmes et al. 15 000 individuals left in the wild (Freeman et al. 2001). For 2013). Although many eutherian mammals have 3 families of decades, cheetahs have been considered to be a model of a wild classical class II genes within the class II region (DP, DQ, and population with low MHC diversity. Low MHC polymorphism DR), only the DR family contains functional genes in the FLA has been inferred through skin graft studies, where it was dem- region (Yuhki et al. 2003). This family has been expanded in onstrated that cheetahs would not reject skin grafts from unre- the FLA region to contain 4 or 5 DRB and 3 DRA genes. lated individuals (O’Brien et al. 1985). A lack of MHC diversity MHC gene diversity is often determined by sequence- was supported by other studies (Yuhki and O’Brien 1990, 1994; based typing. However, as this method is labor intensive Drake et al. 2004), but these studies were limited by the use of and expensive, it can be impractical for large diversity stud- low-resolution methods or small sample sizes. A recent study D o w ies. A technique for inferring MHC polymorphism, which using cloning and sequencing of MHC along with single-strand n lo is becoming increasingly popular, is the use of MHC-linked conformation polymorphism in a large wild cheetah popula- a d microsatellites. Microsatellites closely linked to a gene under tion (Castro-Prieto et al. 2011) contradicted previous studies of ed selection may be selected through genetic hitchhiking. This MHC class I, showing a higher level of MHC class I diversity in fro m principle has been extensively evaluated in the Rhesus wild cheetahs then was previously recognized. h macaque (Macaca mulatta), where MHC-linked microsatellites The Gir lion is a subspecies of lion restricted to the Gir ttp s were shown to have strong linkage disequilibrium (Penedo sanctuary in India. Gir lions are the only remaining popula- ://a et al. 2005; Doxiadis et al. 2007; de Groot et al. 2008). tion of the once widespread Asiatic lion, which had a range ca d Similarly, research has confirmed hitchhiking of microsatel- across southwestern Asia (Joslin 1984). This population has e m lites within the MHC region of mice (Mus musculus; Meagher been isolated since the 1880s and has undergone genetic ic .o and Potts 1997) and humans (Doxiadis et al. 2009). bottlenecking with numbers reduced to as low as 20 indi- u p MHC-linked microsatellites have been successfully corre- viduals in the 1930s (Caldwell 1938). Today the population .c o lated to MHC polymorphism in several studies. Aguilar et al. consists of approximately 300 individuals (Johnsingh et al. m /jh (2004) demonstrated that while the critically endangered San 2007). Studies in allozyme (Yuhki and O’Brien 1990) and e re Nicolas Island fox (Urocyon littoralis dickeyi) had monomorphic minisatellite DNA fingerprints (Gilbert et al. 1991) have sug- d /a neutral markers, the MHC-linked microsatellite markers were gested genetic monomorphism in Gir lions outside the MHC rtic highly polymorphic. This suggests that intense selection at the region. Screening of class I MHC loci using restriction frag- le -a MHC loci has selected for diverse MHC alleles and, by proxy, ment length polymorphism (RFLP) revealed extreme genetic b s diverse microsatellite alleles. In a number of sheep popula- uniformity with no polymorphism across 15 individuals tra c tions, diversity in MHC-linked microsatellites was more varied (Yuhki and O’Brien 1990). However, a recent study that stud- t/1 than in neutral markers (Santucci et al. 2007). MHC-linked ied sequence polymorphism of class I loci has suggested that 05 microsatellites have been used in conjunction with sequenc- there are substantial levels of MHC class I diversity in the /4/4 9 ing in MHC diversity studies (Lillie et al. 2012). MHC-linked Gir lion (Sachdev et al. 2005). As these studies are in conflict, 3 /2 microsatellites can be used with neutral microsatellites for the further research is required to accurately determine the level 9 6 inference of population genetic structure and detection of sig- of polymorphism of MHC loci in the Gir lion. 18 9 natures of selection (Hansen et al. 2007; Santucci et al. 2007). The domestic cat in Australia was founded by an unknown 1 b Studies have also used MHC-linked microsatellites to investi- number of individuals around 200 years ago (Abbott 2002, y g gate the correlation between disease and MHC homozygosity 2008). In this study, we have developed MHC-linked micros- u e s in horses (Andersson et al. 2012) and plague resistance in rats atellite markers to be used as a proxy measure for MHC diver- t o (Tollenaere et al. 2012). Microsatellites may be used in species sity in cats. Using these markers, we have investigated levels n 0 that do not have a well-characterized MHC. of class I and class II MHC polymorphism in the Australian 5 A domTeos tdica tcea, tso n(Ylyu h4k si taunddie Os ’hBarviee nl o1o9k9e7d; Katu wMaHhaCra d eitv aelr.s 2it0y0 i0n; dgeonmeetisct imc acrakt earns.d W hea vhea vceo mthpenar ecdo mthpiasr etod dthivee drsiviteyr saitt yn ienu ttrhael pril 2 0 1 Kennedy et al. 2002; Yuhki et al. 2008). These have shown outbred population to purebred Burmese cats. Finally, the 9 that the FLA region demonstrates comparable allelic variation markers were used along with MHC sequencing to investi- to the HLA complex. Currently, for the FLA-DRB locus, 75 gate MHC diversity in the cheetah and Gir lion. feline DRB alleles have been characterized in 140 domestic cats (Yuhki and O’Brien 1997; Kuwahara et al. 2000; Kennedy et al. 2002; Yuhki et al. 2008). However, the FLA-DRA locus Methods appears to have very limited diversity with only 1 allele cur- Feline DNA Sampling rently characterized for exon 2 (Yuhki and O’Brien 1997). Microsatellites developed in 1 species are frequently suc- Blood samples were collected from 129 domestic mixed breed cessfully utilized in closely related species. Ten microsatellites and 61 purebred Burmese cats presented to the Valentine that were developed in the domestic cat were used to examine Charlton Cat Centre, University of Sydney. These cats were 494 Morris et al. • MHC-Linked Microsatellites in Cats presented to the centre with a variety of problems. The study chromosomes, variety in length, and compatibility with the was approved by the University of Sydney’s Animal Ethics CAG tag. These markers are assumed to be neutral and are Committee, N00/6-2009/1/4985. Cheetah (13) and Gir lion not known to be near a gene under selection. One primer (13) DNA samples were obtained from the National Cancer from each pair was 5ʹ-labeled with a CAG tag (Schable et al. Institute in Fredrick, Maryland, United States. Cheetah sam- 2002). PCR reactions, in a total volume of 25 µL, were per- ples were collected from various zoos and wildlife reserves formed containing 10–100 ng sample DNA, 1× PCR Buffer in the United States and Africa. Two subspecies were rep- (Invitrogen), 200 µM dNTP (Sigma-Aldrich), 0.66 mM resented in our sample: Acinonyx jubatus jubatus found in tagged primer, 44 µM untagged primer (Sigma-Aldrich), Namibia, Botswana, Zimbabwe and South Africa, and 0.66 mM fluorescent dye (Sigma-Aldrich), 1.5 units of Taq Acinonyx jubatus raineyi found in Kenya, Uganda, and Tanzania. (Invitrogen), and the optimum MgCl (Invitrogen) concen- 2 Gir lion samples were collected from lions at the Sakkarbaug tration determined by previous optimization tests. A touch- Zoo, Junagadh, India. These were captive-born animals, down PCR protocol was used where samples underwent a which originated from the Gir forest in India. Genomic DNA 3 min 95 °C denaturation, followed by 12 cycles of 95 °C was extracted using the MoBio UltraClean BloodSpin Kit denaturation for 30 s, 30 s of annealing starting at 60 °C D o w (California) according to the manufacturer’s protocol. decreasing by 2 °C every 2 cycles, with an extension of 72 °C n lo for 45 s. On completion of this touchdown phase, each sam- a d MHC-Linked Microsatellites ple went through 28 cycles of 95 °C denaturation for 30 s, ed The complete MHC sequence produced by Yuhki et al. 50 °C annealing for 30 s, and 72 °C extension for 45 s, with a from (2008) (GenBank EU153401, EU153402) was analyzed by terminal extension of 30 min at 72 °C. Fragment analyses of h PCR products were carried out as above and genotypes were ttp Repeat Masker (UCSC Genome Bioinformatics) in order to s identify simple repeats. About 557 simple repeats were iden- assigned using Peak Scanner. ://a c tified in the MHC region and unbroken dinucleotide repeats ad Statistical Analysis e with a repeat length of 15 or greater and a distance of less m ic than 10 kb from a classical MHC were selected. Positions of Arlequin 3.5 (Excoffier and Lischer 2010) was used to .o u the MHC genes within the sequence are described in Yuhki determine the expected and observed heterozygosities, con- p .c et al. (2008) and the exon/intron structure of the MHC genes formation to Hardy–Weinberg equilibrium and linkage dis- o m was identified using EMBOSS GenScan. Uninterrupted equilibrium between markers. GenePop 4 (Raymond and /jh e dinucleotide repeats within the intron of a MHC gene or Rousset 1995) established the significance of the heterozy- re d less than 10 kb from a MHC gene were selected. Primers gous changes. FSTAT 2.9.3 (Goudet 1995) determined the /a were designed using the Oligo 6 Primer Analysis Software number of alleles, allelic richness, and F statistics including rtic le (Molecular Biology Insights). One primer from each pair was FST and FIS. Allelic richness was used to correct for differences -a b 5ʹ-labeled with a CAG tag (Schable et al. 2002). Primers were in pooled sample sizes through a rarefaction method, thereby s analyzed with BLAST against the cat genome and cat MHC producing the number of alleles independent of sample size. trac sequence to ensure high specificity to the target sequence. STRUCTURE (Pritchard et al. 2000) was used to identify t/1 0 5 Four class I and two class II primer sets were ordered from subpopulations with the Evanno et al. (2005) calculation of /4 Sigma-Aldrich (New South Wales, Australia). K applied. Estimation of null allele frequency was performed /49 3 PCR was carried out in 25 µL PCR reactions containing in Micro-Checker (van Oosterhout et al. 2004). Linkage dis- /2 9 10–60 ng genomic DNA, 200 µM dNTP (Sigma-Aldrich), equilibrium between the MHC-linked microsatellite markers 6 1 1.5 units Taq polymerase (Invitrogen, CA), 1× PCR buffer was examined through the test of nonrandom association of 89 1 (Invitrogen), 0.6 mM unlabeled primer, 0.06 mM CAG alleles using Arlequin with 10 000 permutations and 10 initial b y labeled primer, 0.6 mM 5ʹ-fluorescent CAG primer (Applied conditions for the Expectation–Maximization algorithm. g u Bdeiotesrymstienmeds) bayn dp reioitrh eorp 1ti.m6 mizaMti oonr .2 T.4h me fMol MlowgCinl2g (PInCvRit rcoognedni-) Class I Exon 2 MHC Cloning and Sequencing est o n tions were used: denaturation at 90 °C for 3 min, followed by 0 33 cycles of 94 °C for 30 s, annealing temperature between MHC class I alpha 1 domain alleles were amplified in 8 chee- 5 A 52.0 and 60.4 °C (determined by prior primer optimization) tmahu lstialomcpulse sp r(simubesrps edceiseisg njuebda tbuys) Saancdh d8e Gv iert laiol.n ( 2s0a0m5p) l(eas1 uFs:5inʹ–g pril 2 for 30 s and extension at 72 °C for 30 s, with a final extension CCACTCCCTGAGGTATTTCTACACC–3ʹ; a1R: 5ʹ–GGAC 019 step at 72 °C for 10 min. PCR products were submitted to TCGCTCTGGTTGTAGTAGCG–3ʹ). Additionally, MHC the Ramaciotti Centre for Gene Function Analysis, UNSW alleles from cheetah were amplified using the same reverse for fragment analysis. The software program, PeakScanner primer as previous but with an alternate forward primer (Applied Biosystems, Victoria, Australia) was used to assign designed by Castro-Prieto et al. (2011) (Acju_Ex2MhcI_CF: genotypes. 5ʹ–GCTCCCACTCCTGAGGTAT–3ʹ) in order to obtain missing alleles (AcjuIaI*01, *02, and *03). Although both Neutral Microsatellites exon 2 and exon 3 are polymorphic, exon 2 (alpha I domain) Five dinucleotide microsatellite primers (Fca045, Fca058, was selected for sequencing as it was the most polymor- Fca078, Fca247, and Fca294) were selected from Menotti- phic peptide-binding domain based on previous studies. Raymond et al. (1999) due to their location on different PCR reactions, in a total volume of 25 µL, were performed 495 Journal of Heredity containing 10–100 ng sample DNA, 1× High Fidelity PCR e r BoDMfuNg fSefAaeOcr 4hP( Iop(nIlrvyniimmvtrieetorrrgoa e(sgSneei )ng, H)m2. 0iaTg0-hAh µeldMF rfiiod cdlehlNlo)it,wT y1 iPn.(5 gI( nSuPvingiCtimtrRsoa g-ocAefonl nd)P,dr liaicatthinion)dn,u s1m 20w mTpeaMmrqe Optimum annealing temperatu(°C) 605855556051 used: denaturation at 94 °C for 2 min, followed by 33 cycles m µL) of 94 °C for 30 s, annealing of 60 °C for 30 s, and exten- mu (2 sion at 68 °C for 30 s, with a final extension step at 68 °C ptigCl 828828 OM 0.1.0.0.1.0. for 10 min. Samples were run on 2% agarose gel and bands were excised. Gel bands were purified using the QIAquick p) Gel Extraction kit (QIAGEN). The purified fragments were uct h (b ctelomn e(dP rionmtoe pglaa,s mMiaddsi suosnin, gW thI)e. pPGlaEsmMid®s- Tw eEraes ytr vanecstfoorr msyesd- Prodlengt 292236288243300207 ic3KANupinnl7sroutdiSei tonsniWs °vt ge(eCriQ, nsJad .SM A ltuIiPe waAiau1qnlnleasG0u, r tst9terewmGoEan olNciibEeidna hness)s)de eoc.. c i hrpwvmSo Teai4renedehirq.rcsa1u heeuit.adiR 4eealppe le n yPrul(scaceG CreoesdpialmfseRi ir i vncecwsiabkddeh,l eea i e dCrdcuDiFett soahe aNiaeldnreclndieergiAadlli s lieti t )tnesy.hwcdc. tSeueS ah( aellesAltQenq squ G sdusuIrea e(eAeRqqPmdnnpuuFr cceorea,eoe enlmso vipWat creyhle e irM edggadncsadni hifti)g nmamfe,te htico seretakp etn anhbenidatnddeestt, GTTCTCCTTTCCTAATCGCAACTCCTTAAATAACAATGGTACAAAAATACAATAGTACAAATCTGACATCAGTAGGGAAAGTGTATCCATATAAGGCACTC Downloaded from https://aca were produced in BioEdit using the ClustalW alignment tool GTGTCACAACTT dem (2T0h07o)m wpasos nu seetd a lt. o1 9c9o4n;s Htrualclt 1p9h9y9l)o. gMenEieGs.A I n4 (fTulafmillumrea nett oafl. CATCATCAGCACCAGCAG ic.ou TTTTTT p data archiving guidelines (Baker 2013), we have deposited AAAAAA .c CCCCCC o tDhrey apdri.mary data underlying the analyses of this study with uence GCGTGCGTGCGTGCGTGCGTGCGT m/jhere q GGGGGG d Results Reverse se CAGTCGCAGTCGCAGTCGCAGTCGCAGTCGCAGTCG /article-abs MSacgfTcmsMdranlleiihaaoxsHotHndsseeem re ssClq CplM s ipouIIh- tI7 wreLip-Hiagl ocCksiitnienb diCbt,lmdnhkr ou m-i ee tcMulciItsoizdauIthnm e rHasekmMwdkl ne eiwCe dniindidtcrcai(I h gs srtrTs-2 htotioD mnh aateswwsebn ,sa ia sda celcettetnrMeroreree aoeel mdllnf Hi ls1inii rtgatneb)eodtCe.tes er eme pctdoItPlsiFlwIlr cn oiir-iogtf tme Aischrenmuoeeoa e,earn ft mei prtp.r erast rTrto sdhnaohia1fmhs edxem7 se ieMoM4m tgpMrMch eslHHiitie ntaHfoHysiCtCew ee eCC t3Id- de(ol--0Is ri fAl aIneg0eilF- naek e, sBbL n kneidp.nFkAedM ee.gedi L vgmrldH cAeemuai ln ilnalrCpcoliFkesg croIps aLtoir- 1lnhegoByIsA)dgeeI---,. ces and characteristics Forward sequence GGTGATCTGAGTTTCCTTAGATCCCCTGAAAGAACTGTAGCCATCCACAGAATACACAAGAAGTAAACGATGGAGAGTGTCCTACTTCCAAAATCTTTATGAGGAGGGAAAATAATA tract/105/4/493/2961891 by guest on 0 atellite markers in the domestic mixed breed population. All uen d 2 5 A a(GMPseis c<onrce o0itas.ia0ctit 1oVe)nal.lrsiti aebtseiotwn einen t hme aMrkHerC p-Laiinrsk ewde arne dh Nigheulyt rsailg nificant osatellite primer seq Position in relation to gene Between exon 1 an<1 kb from DRB25 kb from FLAI-E7 kb from FLAI-K3 kb from FLAI-K3 kb from FLAI-O ʹe 5-CAG tag. pril 2019 O6M1nH eBC uhIr-umCn,ed sMree Hdc CaatnIs- dDw ,te wMreeH ngtCye-nInIoi-ntAyep, eaddno dmf oMers HtMicC HImIC-iBxIe- AdM , HbMrCeHe-dliCn Iak-neBdd, MHC micr Flanking Gene DRB4DRB2FLAI-EFLAI-KFLAI-KFLAI-O nces includ masmintiaydcr rkwoFesarcassat 2etel9hsli4rttoa ebu nmlgeishuah trerkaadlell er sflmi ocari nc adrbno odFst achhta ee0tlthl4eite5re o, MzFmycHgaaor0Cks5-ei8ltriy,ns .Fk trecGadaie7 tsna0.n e8Atd,i c Flt nhcdeaoui2vut4erg7arh-l, Table 1 Marker ID MHCII-AMHCII-BMHCI-AMHCI-BMHCI-CMHCI-D Reverse seque 496 Morris et al. • MHC-Linked Microsatellites in Cats D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /jh e re d /a rtic le -a Figure 1. Diagram of domestic cat MHC class II and class I classical regions showing position of MHC genes and bs microsatellite markers. tra c t/1 0 5 the allelic richness was similar between the MHC and neu- equilibrium, with 4 of the 8 markers that deviated from /4/4 tral microsatellites, there were a greater number of private Hardy–Weinberg equilibrium in both the domestic mixed 93 alleles within the neutral, compared to the MHC, markers breed and Burmese cats showing evidence of null alleles /29 6 (Table 2). Greater diversity was seen in the domestic mixed (Table 2). This accounts for some, but not all, of the markers 1 8 9 breed than in the Burmese group, with the domestic mixed that had a heterozygote deficiency in both the neutral and 1 b breed displaying a significantly higher allelic richness than the MHC-linked markers. To confirm that the finding that these y g Burmese (P < 0.01). The domestic mixed breed cats also had markers showed heterozygote deficiency was not the result u e significantly higher expected heterozygosity (P < 0.01) and of a technical artifact, our results were replicated with a sub- st o observed heterozygosity (P = 0.02) than the Burmese. set of our samples in a separate laboratory. This replication n 0 The overall expected heterozygosity for both marker confirmed a heterozygote deficiency. 5 A types was very similar. However, there was a deviation from Inbreeding, estimated by the inbreeding coefficient and p Hardy–Weinberg equilibrium across many of the markers, determined using the neutral markers, was demonstrated to ril 2 0 both MHC linked and neutral. The deviation from Hardy– be low among domestic mixed breed (FIS = 0.089), whereas 19 Weinberg equilibrium was more prominent in the MHC than the inbreeding in the Burmese group was much higher in the neutral markers. All 6 and 4 out of 6 MHC microsat- (F = 0.14). This was very similar to the value calculated from IS ellites, for the domestic mixed breed and Burmese groups, microsatellite typing in American Burmese cats (F = 0.16) IS respectively, did not conform to Hardy–Weinberg equilib- in the recent study by Kurushima et al. (2012). rium (Table 2). Two out of 5 domestic mixed breed and 4 out of 5 Burmese neutral markers displayed significant deviation Genetic Differentiation Between the Domestic Mixed from expectations (Table 2). A heterozygote deficiency was Breed and Burmese Groups demonstrated in all the markers that deviated from Hardy– Weinberg equilibrium. Null alleles were likely present in some Significant genetic differentiation, estimated by fixation index, of the markers that showed deviation from Hardy–Weinberg was observed between the domestic mixed breed and Burmese 497 Journal of Heredity Table 2 Genetic variation for each microsatellite marker for the domestic mixed breed and Burmese groups Locus N A P A H H HWE Null A R E O Domestic MHCII-A 128 8 1 7.79 0.69 0.46 0.000 Yes mixed bred MHCII-B 128 6 1 5.99 0.75 0.59 0.000 Yes MHCI-A 126 9 4 7.31 0.81 0.78 0.000 No MHCI-B 129 8 2 7.84 0.80 0.71 0.000 No MHCI-C 129 12 4 11.02 0.80 0.75 0.000 No MHCI-D 127 12 4 11.18 0.76 0.36 0.000 Yes Average MHC 128 9.00 2.67 8.52 0.77 0.61 Fca045 129 11 4 10.10 0.85 0.80 0.204 No Fca058 129 7 3 6.39 0.71 0.73 0.534 No Fca078 129 8 3 7.42 0.79 0.67 0.000 No Fca294 129 12 6 10.35 0.85 0.81 0.468 No Fca247 129 10 5 7.25 0.64 0.49 0.000 Yes D o Average neutral 129 9.60 4.20 8.30 0.77 0.70 w n Overall average 128 9.38 3.43 8.41 0.77 0.65 lo a Burmese MHCII-A 61 7 0 6.94 0.32 0.13 0.000 Yes d e MHCII-B 59 5 0 4.98 0.43 0.29 0.000 Yes d MHCI-A 61 6 1 6.00 0.78 0.70 0.847 No fro m MHCI-B 58 7 1 7.00 0.63 0.60 0.608 No h MHCI-C 59 8 0 7.97 0.56 0.56 0.033 No ttp s A vMeraHgCe IM-DHC 6600 68.83 00.33 67..8917 00..5784 00..4345 0.000 Yes ://ac a Fca045 59 7 0 6.97 0.29 0.20 0.000 Yes d e Fca058 61 4 0 4.00 0.50 0.49 0.928 No m ic Fca078 61 7 2 5.90 0.57 0.49 0.028 No .o u Fca294 60 7 1 6.97 0.73 0.63 0.036 No p .c Fca247 59 6 1 5.98 0.73 0.61 0.043 No o m Average neutral 60 6.00 0.80 5.96 0.56 0.49 /jh Overall average 60 6.55 0.55 6.42 0.57 0.46 e re d /a N, sample size; A, number alleles; PA, number of private alleles; AR, allelic richness; HE, expected heterozygosity; HO, observed heterozygosity; HWE, P rtic value for conformation to Hardy–Weinberg equilibrium; Null, significant null allele frequency. P < 0.05 are considered to deviate from Hardy–Weinberg le -a equilibrium (these values are shaded). b s tra c for both the MHC and neutral microsatellites. The neutral the primers. Therefore, all the primer sets amplified mono- t/1 0 markers (FST = 0.156, P = 0.01) showed slightly more differ- morphic loci in the Gir lion. 5/4 entiation than the MHC-linked microsatellites (F = 0.129, In the cheetah, primer MHCI-C amplified multiple loci /4 ST 9 P = 0.01), although this difference was not significant of similar length so the results could not be interpreted. 3/2 9 (P = 0.68). The variation in samples was accounted for with Microsatellite MHCI-D was monomorphic, whereas the 6 1 15.6% and 12.9% occurring between the domestic mixed breed remaining 3 microsatellites were polymorphic. The allelic and 8 9 1 and Burmese for neutral and MHC-linked markers, respec- heterozygosity statistics for the polymorphic alleles are sum- b y tively, whereas 84.4% and 87.0% was found within the popula- marized in Table 3. The statistics were similar for both the g u tions themselves. Genetic differentiation was also indicated by jubatus and raineye subspecies. There was an average of 3.66 e s division of the entire sample population into 2 distinct sub- alleles per locus in each of the 2 cheetah subspecies. t o n populations, domestic mixed breed and Burmese, when ana- 0 5 lyzed with STRUCTURE using combined neutral and MHC MHC Class I Sequencing in Cheetahs and Gir Lions A p markers. When analyzed with the MHC-linked microsatellites, In cheetahs, 16 unique alleles were amplified. Amino acid ril 2 but not the neutral microsatellites, the domestic mixed breed 0 alignment of these alleles is shown in Figure 2 with the 19 population was further divided into 2 subpopulations with an previously characterized MHC alleles AJUMHCAJUI1, F of 0.27. ST AJUMHCAJUI3 (Yuhki and O’Brien 1994), and Acju- MHCI*02-12 (Castro-Prieto et al. 2011). Three of the alleles MHC-Linked Microsatellites in Cheetahs and Gir Lions identified in this study were pseudogenes with frameshift MHCII-A did not amplify in either the cheetah or lion sam- mutations. An additional allele AcjuIαI*13 is likely to be ples. In the Gir lion, primers MHCII-B and MHCI-D were a pseudogene as Castro-Prieto et al. (2011) identified a monomorphic. Marker MHCI-C amplified 2 fragments, frameshift mutation downstream of the alpha I domain whereas MHCI-A and MHCI-B amplified 3 fragments. These sequenced in this study. Seven of the alleles are believed fragments were identical in every sample, so we conclude that to be functional, expressed classical class I alleles based these are duplicated, monomorphic loci being amplified by on homology to classical alleles identified by Castro-Prieto 498 Morris et al. • MHC-Linked Microsatellites in Cats Table 3 Genetic variation for each microsatellite marker in the cheetah Locus N A A H H HWE R E O Jubatus MHCII-B 8 4 3.92 0.74 0.38 0.721 MHCI-B 8 3 2.93 0.62 0.29 0.461 MHCI-A 8 4 3.63 0.60 0.63 0.529 Average 8 3.66 3.49 0.65 0.43 Raineye MHCII-B 5 5 5 0.80 0.60 0.725 MHCI-B 5 4 4 0.78 0.60 0.321 MHCI-A 5 2 2 0.47 0.20 0.531 Average 5 3.66 3.66 0.68 0.47 Pooled Average 13 4.33 4.33 0.66 0.45 N, sample size; A, number alleles; PA, number of private alleles; A , allelic richness; H , expected heterozygosity; H , observed heterozygosity; HWE, P R E O D value for conformation to Hardy–Weinberg equilibrium. o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /jh e re d /a rtic le -a b s tra c t/1 0 5 /4 /4 9 3 /2 9 6 1 8 9 1 Figure 2. Amino acid alignment of MHC class I alpha domain alleles in the cheetah. Dots indicate identity to the top sequence. by Included are previously characterized MHC alleles AJUMHCAJUI1, AJUMHCAJUI3 (Yuhki and O’Brien 1994), and Acju- gu e MHCI*02,04,05, 07,12 (Castro-Prieto et al. 2011) (only those unique at the alpha 1 domain are shown). Predicted classical alleles, s t o nonclassical alleles, and pseudogenes are indicated by red, blue, and green dots, respectively. Asterisks above the sequence indicate n 0 putative peptide-binding sites based on alignment with human MHC I. 5 A p et al. (2011). Five remaining alleles appear to be nonclas- not be assigned to a cluster. Between 1 and 4 classical alleles ril 2 0 sical alleles based on phylogenetic analyses (Figure 3). were found in each cheetah. 19 Of the 6 functional alleles identified by Castro-Prieto et al. Nine unique alleles were identified in the Gir lion (Figure 4). (2011), which were unique in the alpha I domain, 3 were Three of these alleles are pseudogenes with frameshift muta- present in our sample set, whereas 4 novel classical alpha tions (PaleIαI*07-09). Two alleles appear to be nonclassical I domain sequences were identified. Four clusters of classi- alleles based on phylogenetic analysis (PaleIαI*05-06). The cal class I alleles corresponding to putative class I loci in the remaining 4 alleles (PaleIαI*01-04) are believed to be classi- cheetah were identified by Castro-Prieto et al. (2011) based cal class I alleles. Of these alleles, PaleIαI*01 and PaleIαI*02 on phylogenetic analyses. Alleles from each of these clusters differ by only 2 nucleotide substitutions, whereas PaleIαI*03 were identified in the present study; these alleles have been and PaleIαI*04 differ by only a single-nucleotide substitu- assigned to the clusters identified by Castro-Prieto et al. tion. Allele Pa6leIαI*01 was present in all individuals, whereas (2011) in Table 4. Only one classical allele (AcjuIαI*07) could PaleIαI*03 was present in 7 of the 8 individuals. PaleIαI*02 499 Journal of Heredity D o w n lo a d e d fro m h ttp s ://a c a d e m ic .o u p .c o m /jh e re d /a rtic le -a b s tra c t/1 0 5 /4 /4 9 3 /2 9 6 1 8 9 1 b y g u e s t o n 0 5 A p ril 2 0 1 9 Figure 3. Phylogenetic analysis of 43 MHC class I alpha I domain nucleotide sequences, including cheetah and Gir lion alleles from this study, previously characterized cheetah alleles (Yuhki and O’Brien 1994; Castro-Prieto et al. 2011), and domestic cat MHC class I alleles (Yuhki et al. 2008). FLAI-E, FLAI-H, and FLAI-K are domestic cat classical class I alleles, whereas FLAI-C, FLAI-F FLAI-J, FLAI-M, FLAI-O, and FLAI-Q are nonclassical alleles. The phylogenetic relationship was inferred using the neighbor-joining method (Saitou and Nei 1987). The percentage of replicate trees in which the associated sequences clustered together in the bootstrap test (1000 replicates) are displayed next to the branches, indicating the level of reliability of the phylogeny (Felsenstein 1985). Predicted classical alleles, nonclassical alleles, and pseudogenes are indicated by red, blue, and green dots, respectively. Domestic cat, cheetah, and lion alleles are indicated by black squares, stars, and diamonds, respectively. 500 Morris et al. • MHC-Linked Microsatellites in Cats Table 4 Class I exon 2 genotypes in 8 cheetahs Cheetah Classical Nonclassical Pseudogenes 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 D D D B A A C Acju1 x x x x x x x Acju2 x x x x x x x x Acju3 x x x x x x x Acju4 x x x x x x x x x Acju5 x x x x x x x Acju6 x x x x x Acju7 x x x x x x x Acju8 x x x x x x x x D o w Abbreviated allele names are shown in row 2 followed by cluster in row 3 (see Castro-Prieto et al. 2011). Of the classical alleles only AcjuIαI*07 could not n be confidently assigned to a cluster due to its divergence from the other alleles. Labels in column 1 (Acju1-8) are animal ID numbers. An x indicates the loa d presence of the allele in the sample. e d fro m h ttp s ://a c a d e m ic .o u p .c o m /jh e re d Figure 4. Amino acid alignment of partial MHC class I alpha domain alleles in the Gir lion. Dots indicate identity to the top /a sequence. Predicted classical alleles, nonclassical alleles, and pseudogenes are indicated by red, blue, and green dots, respectively. rtic le Asterisks above the sequence indicate putative peptide-binding sites based on alignment with human MHC I. -a b s tra and PaleIαI*04 were only present in 1 individual each. As the diversity (Aguilar et al. 2004). Our finding that the average ct/1 lion MHC has not been extensively characterized, we cannot allelic richness was greater in the MHC microsatellites than 0 5 rule out that the primers used are not missing some alleles, in the neutral microsatellites for both the domestic mixed /4/4 however, 6 of the 8 Gir lions sequenced were identical in breeds (8.52 and 8.30, respectively) and the Burmese (6.81 93 their MHC class I classical alpha I domain complement sug- and 5.96, respectively) supports this hypothesis, although this /29 6 gesting extremely low MHC diversity. Individual lions had difference was not significantly different. 1 8 9 either 2 or 3 classical class I alleles (Table 5). This along with There was a significantly greater allelic richness (P < 0.01) 1 b phylogenetic clustering of the alleles into 2 clades (Figure 3) and expected heterozygosity (P < 0.01) in the domestic mixed y g suggest that 2 classical class I loci have been amplified. breed than that in the Burmese cats. The lower genetic diver- u e sity in the Australian Burmese is likely a result of a smaller st o gene pool and controlled breeding, resulting in inbreeding n 0 Discussion in the population. This hypothesis is supported by the high 5 A inbreeding coefficient for the Burmese neutral microsatellites p MHC Diversity in Domestic Cat (F = 0.14). The inbreeding coefficient was higher in the ril 2 IS 0 Microsatellite markers linked to both classical class I and Burmese than in the domestic mixed breed. This reflected 19 class II domestic cat MHC genes were designed and opti- the trend identified in Lipinski et al. (2008), where American mized and used to investigate MHC diversity in the Australian purebred cats were more inbred than feral felines. domestic cat. The 6 MHC-linked and 5 neutral microsatel- The average expected heterozygosity for the neutral lites were used to genotype 129 domestic mixed breed and microsatellites used in this study was previously deter- 61 Burmese cats. The microsatellite markers were polymor- mined to be 0.772 in a population of unrelated, outbred cats phic in domestic cats with an average of 9 alleles and aver- (Menotti-Raymond et al. 1999). In this current study, the aver- age expected heterozygosity of 0.77 in the domestic mixed age expected heterozygosities for the domestic mixed breed breeds. It has been suggested that MHC-linked microsatellites and Burmese were H = 0.767 and H = 0.564, respectively. E E should be more diverse than neutral microsatellites as they Although the domestic mixed breed heterozygosity was very are impacted by the balancing selection that maintains MHC similar to that measured previously, that of the Burmese 501 Journal of Heredity Table 5 Class I exon 2 genotypes in 8 Gir lions Lion Classical Nonclassical Pseudogenes 01 02 03 04 05 06 07 08 09 Ple1 x x x x x x x Ple2 x x x x x Ple3 x x x x x x Ple4 x x x x Ple5 x x x x x x Ple6 x x Ple7 x x x x x x x x Ple8 x x x x x x Abbreviated allele names are shown in row 2. Labels in column 1 (Ple1-8) are animal ID numbers. An x indicates the presence of the allele in the sample. D o w n was much lower. Comparisons between our data and other of reasons why these markers may display a heterozygous loa d species of Felidae highlighted that the Burmese group had deficiency. e d a similar heterozygosity to mountain lions (Puma concolor) Firstly, as discussed above, the MHC-linked microsatel- fro and tigers (Panthera tigris; Ernest et al. 2003; Mondol et al. lites appear to be affected by population substructure. This m h 2009). This low heterozygosity in the Australian Burmese is can cause deviation from Hardy–Weinberg equilibrium due ttp s of concern. It may be beneficial to introduce new genetic to the Wahlund effect. Additionally, the MHC-linked micros- ://a diversity into the Burmese breed to prevent and decrease the atellites are likely to be under selection due to hitchhiking of c a d incidence of heritable diseases, which are significantly higher the microsatellite with the MHC genes. MHC loci are gener- e m in the Burmese than in the outbred cats, such as diabetes ally under positive balancing selection (Hughes and Yeager ic (Lederer et al. 2009). 1998), which leads to a heterozygote excess. However, we .ou p saw the opposite result in the cats tested. Therefore, selec- .c o Population Structure tion at the MHC alone is unlikely to explain the heterozygote m deficiency. /jhe Analysis of both the neutral and MHC-linked microsatel- Among Burmese cats, inbreeding, which was demon- red lpitoepsu wlaittiho nSsT: RBUurCmTeUseR aEn ds edpoamraetestdic t hmei xseadm bprleees di.n Htoo 2w esvuebr-, strated in this population, is likely to be contributing to /artic wmhixeend a bnraeleydzi ncagt tsh we eMreH fCur-tlhinekre ddi vmidicerdo isnattoel l2it seus,b tphoep duolamtieosntisc. tmhiex edde vbiarteieodn pfroopmu lHatiaornd yd–oWeesi nnboetr ga.p Wpehairle t toh eb ed oimnbersetdic, le-abs These domestic mixed breed subpopulations were moder- this population may have been affected by the founder tra ately divergent with an F of 0.27, and this divergence was effect early in their history. The Australian cat population ct/1 ST is likely to have been established by a small number of 0 stheeant taht isb optohp culalastsi oIn a nddiv cisliaosns IiIs mreilcartoesda tteoll idteifsf. eIrte inst pgoesnsiebtliec individuals, which may have lead to a heterozygote-defi- 5/4/4 cient population. Interestingly, there is a high prevalence 93 backgrounds at the MHC in response to selective pressures of blood type B among Australian cats (Malik et al. 2005). /29 from different diseases in the cat population. The samples 6 This finding has been documented in only a few areas of 1 used in this study were obtained from cats presenting a vari- 89 the world, including the south east of England (Forcada 1 ety of problems. No distinction could be made between the 2 b et al. 2007). This area was the origin of the First Fleet, y groups of cats based on clinical data, so further investigation g which likely brought the first domestic cats to Australia. u will be required to determine the cause of this population e structuring. The cause of the deviation from Hardy–Weinberg seen in st o these populations cannot be accurately determined at this n 0 Deviation from Hardy–Weinberg point, but it is likely that it is multifactorial with inbreed- 5 A ing, selection, and population structure all contributing p Many of the microsatellite markers used in this study to this effect. ril 2 0 deviated from Hardy–Weinberg equilibrium in both the 19 Burmese and domestic mixed breed populations. While the Population Differentiation presence of null alleles may account for some of these, for the MHC-linked microsatellites, 3 of the 6 in the domestic The domestic mixed breed and Burmese populations were mixed breed and 1 of the 6 in the Burmese markers did significantly differentiated. This was seen in both the MHC- not conform to equilibrium and did not show evidence for linked (F = 0.129, P < 0.01) and neutral (F = 0.156, ST ST null alleles. Out of the neutral markers, 1 domestic mixed P < 0.01) markers. The genetic differentiation between the breed and 3 Burmese markers also displayed a significant Burmese and domestic mixed breed (F = 0.156) is com- ST deviation from Hardy–Weinberg equilibrium without evi- parable to the F value for Burmese and outbred domestic ST dence of null alleles being present. This deviation was the cats in the United States (F = 0.16; Menotti-Raymond et al. ST result of a heterozygote deficiency. There are a number 2008). 502

Description:
proteins bind foreign peptides and present them to T cells, allowing for self/non-self . are the cheetah (Acinonyx jubatus) and the Gir lion (Panthera leo persica) satellites markers were designated MHCI-A, MHCI-B,. MHCI-C, MHCI-D A microsatellite-based MHC genotyping system for house mice
See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.