Cyclic arginine-glycine-aspartate attenuates acute lung injury in mice after intestinal ischemia/reperfusion.

1.5 MB·English

by  Matsuo, Shingo

Matsuoetal.CriticalCare2013,17:R19
http://ccforum.com/content/17/1/R19
RESEARCH Open Access
Cyclic arginine-glycine-aspartate attenuates acute
lung injury in mice after intestinal ischemia/
reperfusion
Shingo Matsuo, Weng-Lang Yang, Monowar Aziz, Asha Jacob and Ping Wang*
Abstract
Introduction: Intestinal ischemia is a critical problem resulting in multiple organ failure and high mortality of 60 to
80%. Acute lung injury (ALI) is a common complication after intestinal ischemia/reperfusion (I/R) injuries and
contributes to the high mortality rate. Moreover, activated neutrophil infiltration into the lungs is known to play a
significant role in the progression of ALI. Integrin-mediated interaction is involved in neutrophil transmigration.
Synthetic peptides containing an arginine-glycine-aspartate sequence compete with adhesive proteins and inhibit
integrin-mediated interaction and signaling. Thus, we hypothesized that the administration of a cyclic arginine-
glycine-aspartate peptide (cRGD) inhibited neutrophil infiltration and provided protection against ALI induced by
intestinal I/R.
Methods: Ischemia in adult male C57BL/6 mice was induced by fastening the superior mesenteric artery with 4-0
suture. Forty-five minutes later, the vascular suture was released to allow reperfusion. cRGD (5 mg/kg body weight)
or normal saline (vehicle) was administered by intraperitoneal injection 1 hour prior to ischemia. Blood, gut, and
lung tissues were collected 4 hours after reperfusion for various measurements.
Results: Intestinal I/R caused severe widespread injury to the gut and lungs. Treatment with cRGD improved the
integrity of microscopic structures in the gut and lungs, as judged by histological examination. Intestinal I/R
induced the expression of b , b and b integrins, intercellular adhesion molecule-1, and fibronectin. cRGD
1 2 3
significantly inhibited myeloperoxidase activity in the gut and lungs, as well as neutrophils and macrophages
infiltrating the lungs. cRGD reduced the levels of TNF-a and IL-6 in serum, in addition to IL-6 and macrophage
inflammatory protein-2 in the gut and lungs. Furthermore, the number of TUNEL-staining cells and levels of
cleaved caspase-3 in the lungs were significantly lowered in the cRGD-treated mice in comparison with the vehicle
mice.
Conclusions: Treatment with cRGD effectively protected ALI and gut injury, lowered neutrophil infiltration,
suppressed inflammation, and inhibited lung apoptosis after intestinal I/R. Thus, there is potential for developing
cRGD as a treatment for patients suffering from ALI caused by intestinal I/R.
Introduction thatoccursafterintestinalI/Randisamajorcontributor
Intestinal ischemia/reperfusion (I/R) injury is a critical tothe highmortalityrate[7-11].Limitedpharmacologi-
problem resulting in high mortality rates of up to 60 to cal treatment options exist for ALI, with most targeting
80% [1-3]. I/R causes gut barrier disruption and endo- inflammatory mediators and oxidative stress pathways
toxin entry into the circulation, leading to severe sys- [12]. There is an urgent need for an effective approach
temicinflammationandeventuallymultipleorganfailure forALItreatment.
[4-7].Acutelunginjury(ALI)isacommoncomplication ALI induced by intestinal I/R is caused by an excessive
systemic inflammatory response, triggered by the release
*Correspondence:[email protected] of proinflammatory cytokines and bacteria-derived
DepartmentofSurgery,HofstraNorthShore-LIJSchoolofMedicineand endotoxins from the reperfused ischemic gut tissue
LaboratoryofSurgicalResearch,TheFeinsteinInstituteforMedicalResearch,
[13-15]. Pathophysiologically, ALI is associated with the
350CommunityDrive,Manhasset,NY11030,USA
©2013Matsuoetal.;licenseeBioMedCentralLtd.ThisisanopenaccessarticledistributedunderthetermsoftheCreativeCommons
AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin
anymedium,providedtheoriginalworkisproperlycited.
Matsuoetal.CriticalCare2013,17:R19 Page2of12
http://ccforum.com/content/17/1/R19
influx and activation of immune cells. With the release Another study demonstrated the effectiveness of cyclic
of abundant cytokines and chemokines, ALI can be RGDpeptidesinamelioratingischemicacuterenalfailure
further complicated by infection and ventilation-induced inrats[31].
injury [13,16]. Neutrophils are the earliest immune cells We have previously shown that treatment with milk
to be recruited to the site of injury or infection. More- fat globule-epidermal growth factor-factor 8, a protein
over, recruitment of neutrophils to the lungs is known containing an RGD motif, attenuates inflammation and
to play a key role in the progression of ALI [17]. How- ALI after intestinal I/R [6]. Based on our observations
ever, neutrophil migration into the lungs is not suffi- and other studies, we reasoned that RGD peptides have
cient to cause ALI, but rather activation of neutrophils the capability of alleviating the injury caused by I/R. In
is necessary to trigger the injury [17]. Under normal this study, we treated mice with a cyclic RGD peptide
conditions, neutrophils roll along microvascular walls. (cRGD; RGDFV) that selectively interacts with b and b
3 5
After activation by proinflammatory cytokines and che- integrins [32]. We then evaluated its effectiveness on
motactic factors, neutrophils are then able to penetrate alleviating the ALI induced by intestinal I/R.
the vasculature and transmigrate through the intersti-
tium into the alveolar space [18,19]. In addition, alveolar Materials and methods
macrophages are also essential players in the initiation Experimental model
of ALI [11,20]. Male C57BL/6 mice (20 to 25 g; Taconic, Albany, NY,
Integrins expressing on the cell surface mediate the USA) were used in all experiments. Animals were pre-
interactions of neutrophils with endothelial cells and medicatedviaintraperitonealinjectionwitheither0.2ml
extracellularmatrix(ECM)proteinstostrengthen adhe- of5mg/kgbodyweight(BW)cRGD(cycloRGDfV;Enzo
sion and migration for complete infiltration [21,22]. Life Sciences, Farmingdale, NY, USA) or normal saline
Twenty-fourdifferentintegrinsareexpressedinhumans, (vehicle)1hourpriortosurgery.Miceunderwentinduc-
each composed of noncovalently associated a and b tion ofanesthesiawithinhalationalisoflurane.Anupper
chains[23].Neutrophil adhesion iscommonly mediated midline laparotomy was performed to expose the abdo-
throughb integrinstointeractwithadhesionmolecules menandthesuperiormesentericarterywasoccludedby
2
(forexample,intercellularadhesion molecule(ICAM)-1, fasteningwith4-0silksutureandaPE10catheter(5mm
ICAM-2, and vascular cell adhesion molecule-1) on the length). Cessation of blood flow to the intestines was
endothelialsurface[17].Inhibitionofb integrinsattenu- judgedbycolorchangestopalenessofperipheralmesen-
2
atesneutrophilmigrationintothelungs[24].Inaddition teric vesselsoftheduodenum,jejunumandileum.After
tob integrins,a b anda b integrinsalsocontributeto 45 minutes of ischemia, the superior mesenteric artery
2 4 1 5 1
neutrophil migration by interacting with vascular cell suture was removed and mice were administered 0.5 ml
adhesion molecule-1 during pulmonary inflammation sterile saline intothe peritonealcavity toimprove dehy-
[25]. b and b integrins mediate the interaction with dration after intestinal I/R. Sham animals underwent
1 3
ECMproteins,suchascollagen,laminin,vitronectinand only midline laparatomy incision and closure, without
fibronectin[26].Inaddition,integrinsarealsoassociated intestinalischemia ortreatment.At4hours,blood,lung
with phagocytosis, reactive oxygen species and cytokine and gut tissues were collected. A section of each tissue
productions[27,28]. sample was preserved in formalin for histopathology.
Throughsequenceanalysisofligandsboundtointegrins, Blood and the remainder of tissue samples were frozen
a minimal recognition sequence in ligands containing immediately with liquid nitrogen, and stored at -80°C
aminoacidsequencearginine-glycine-aspartate(RGD)has untilmeasurements.
been well identified [26]. The RGD motif enables ligand All experiments were performed in accordance with
binding to integrins and regulates cell growth, migration the guidelines for the use of experimental animals by
andsurvival[26].Incontrast,syntheticpeptidescontaining the National Institutes of Health (Bethesda, MD, USA)
the RGD sequence can compete withadhesive molecules and were approved by the Institutional Animal Care and
for binding to integrins and disrupt the cellular activity Use Committee of The Feinstein Institute of Medical
mediatedbyintegrininteraction.Forexample,asynthetic Research (Manhasset, NY, USA).
RGDSpeptidehasshowntoattenuatelipopolysaccharide-
inducedpulmonaryinflammationandtoreducethenum- Histopathological examination
ber of neutrophils infiltrating the lungs by inhibiting Gutandlungtissueswerefixedin10%formalinandthen
integrin-mediatedmitogen-activatedproteinkinaseactiva- embedded in paraffin. Tissue blocks were sectioned at a
tion[29].AdministrationofcyclicRGDpeptidesinhibited thicknessof5μm,transferredtoglassslides,andstained
therecruitmentofmacrophagesandneutrophils,aswellas with H & E. Morphologic examination of these tissues
depressingtheexpressionofproinflammatorymediatorsin was evaluated under a light microscope in a blinded
steatotic liver cold ischemia and reperfusion injury [30]. manner. The severity ofgut injury wasscored from 0to
Matsuoetal.CriticalCare2013,17:R19 Page3of12
http://ccforum.com/content/17/1/R19
4 by assessing villus-to-crypt ratio (normal ratio, 5:1), conjugatedwithbiotin(BioLegend,SanDiego,CA,USA),
lymphocytic infiltrates, epithelial degeneration/necrosis, followed by streptavidin-FITC (BD Biosciences, Franklin
erosions, glandular dilatation, and transmural changes Lakes,NJ,USA),oranti-CD11bantibodyconjugatedwith
[33]. The severity of lung injury was scored from 0 to 4, PE(BDBiosciences)for1hour.Slideswerecounterstained
based on the presence of exudates, hyperemia/conges- with4’,6-diamidino-2-phenylindoleandexaminedundera
tion, neutrophilic infiltrates, intra-alveolar hemorrhage/ fluorescence microscope. Cells stained with anti-Gr-1or
debris,andcellularhyperplasia[34]. CD11b antibodies were counted per 10 visual fields at
200×magnification.
Myeloperoxidase activity assay
TissuesofgutandlungswerehomogenizedinKPO buf- Measurements of cytokines and chemokines
4
fer containing 0.5% hexa-decyl-trimethyl-ammonium IL-6 and TNF-a were quantified by using a specific
bromide.Aftercentrifugationthesupernatantwasdiluted mouse ELISA kit (BD Biosciences) in serum, gut and
in reaction solution, and the rate of change in optimal lung tissues. Macrophage inflammatory protein (MIP)-2
densityfor2minuteswasmeasuredat460nmtocalculate was measured using a mouse ELISA kit (R&D Systems,
myeloperoxidase(MPO)activity[6]. Minneapolis, MN, USA) in gut and lung tissues.
RT-PCR analysis Terminal deoxynucleotidyl transferase dUTP nick end-
TotalRNAwasextractedfromgutandlungtissuesusing labeling assay
aTrizolreagent(Invitrogen,Carlsbad,CA,USA)andwas Lunghistopathologicalslidesweredewaxedandincubated
reverse-transcribed into cDNA using murine leukemia with proteinase K. Slides were stained using a terminal
virus reverse transcriptase (Applied Biosystems, Foster deoxynucleotidyl transferase dUTP nick end-labeling
City,CA,USA).APCRreactionwascarried out in25μl (TUNEL)kit(RocheDiagnostics,Indianapolis,IN),coun-
of a final volume containing 0.08 μmol of each forward terstained with propidium iodide and examined under a
andreverseprimer,cDNA,and12.5μlSYBRGreenPCR fluorescence microscope. Apoptoticcellsappeared green
Master Mix (Applied Biosystems). Amplification was fluorescentandwerecountedper10visualfieldsat200×
conductedinanAppliedBiosystems7300real-timePCR magnification.
machineunderthethermalprofileof50°Cfor2minutes,
95°C for 10 minutes followed by 45 cycles of 95°C for Western blotting
15 seconds and 60°C for 1 minute. The level of mouse Lung tissue was homogenized in lysis buffer (10 mM
b-actin mRNA was used for normalization. Relative Tris-HCl, pH 7.5, 120 mM NaCl, 1% NP-40, 1% sodium
expressionofmRNAwasexpressedasthefoldchangein deoxycholate, and 0.1% sodium dodecyl sulfate) contain-
comparisonwiththeshamtissues.The primersusedfor ing a protease inhibitor cocktail (Roche Diagnostics) by
thisstudyarelistedinTable1. sonication. Total lung lysate was fractionated on Bis-
Tris gels (4-12%) and transferred to polyvinylidene
Immunofluorescence staining difluoride membranes. The membranes were blocked by
Paraffin-embedded sections of gut and lung tissues were PBS (0.2×) with 0.1% casein and then incubated with
dewaxed in xylene and rehydrated in a graded series of anti-cleaved caspase-3 (Cell Signaling Technology, Bev-
ethanol.Slides were incubated in 0.92% citric acid buffer erly, MA, USA) or anti-b-actin (Sigma, St Louis, MO,
(Vector Laboratories, Burlingame, CA, USA) at 95°C for USA) antibodies diluted in PBS (0.2×) with 0.1% casein
15minutes.Aftercoolingtoroomtemperature,theslides and 0.1% Tween 20. After the wash, the membranes
were incubated with 2% H O in 60% methanol and were incubated with fluorescence-labeled secondary
2 2
blocked in 2% normal rabbit serum/Tris-buffered saline, antibodies and scanned by the Odyssey imaging system
afterwhichtheywereincubatedwithananti-Gr-1antibody (LI-COR Biosciences, Lincoln, NE, USA). The band
Table 1Primer sequences used in this study
Gene GenBank Forward Reverse
b integrin NM_010578 AACTGCACCAGCCCATTTAG ACATTCCTCCAGCCAATCAG
1
b integrin NM_008404 GTGGTGCAGCTCATCAAGAA TCGGAAGCCATGACCTTTAC
2
b integrin NM_016780 GCTCATTGGCCTTGCTACTC CCCGGTAGGTGATATTGGTG
3
ICAM-1 NM_010493 GGGCTGGCATTGTTCTCTAA CTTCAGAGGCAGGAAACAGG
Fibronectin NM_010233 GAGGAGGGAGATGAACCACA GGGTCTACTCCACCGAACAA
b-actin NM_031144 CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG
ICAM-1,intercellularadhesionmolecule-1.
Matsuoetal.CriticalCare2013,17:R19 Page4of12
http://ccforum.com/content/17/1/R19
intensity was analyzed by the Odyssey densitometric Expression of adhesion molecules for neutrophil
software. infiltration is upregulated after intestinal ischemia/
reperfusion
Statistical analysis Integrinsarethemajorsurfacereceptorsthatmediatethe
Data are expressed as mean ± standard error and com- interactionofneutrophilstoothercellsandECM.ICAM-
paredwithone-wayanalysisofvarianceandtheStudent- 1expressedonendothelialcellsandfibronectin,anECM
Newman-Keulstestformultiplegroupanalyses.Student’s protein, bind to integrins to regulate neutrophil infiltra-
t test was applied for a pair comparison. Differences in tion. The change of mRNA expression of b , b and b
1 2 3
valueswereconsideredsignificantifP<0.05. integrins, ICAM-1 and fibronectin in the tissues after
intestinalI/Rwasdeterminedbyreal-timeRT-PCRanaly-
Results sis. In the gut, expression levels of these three integrins
cRGD attenuates gut damage and microscopic andtwoligandsweresignificantlyincreasedafterI/R,ran-
deterioration of gut after intestinal ischemia/reperfusion ging from 1.7-fold to 25.7-fold in comparison with the
Thegutexhibitedremarkablysevereinflammation,necro- shamgroup(Figure3A).Similarly,inthelungs,expression
sis, and ischemic darkness with vascular congestion all levels of these five proteins had a 1.6-fold to 5.4-fold
over the tissue after intestinal I/R, compared with the increaseinthevehicleincomparisonwiththeshamgroup
shamgroup(Figure1A).FollowingtreatmentwithcRGD, (Figure3B).Theobservationoftheupregulationofinteg-
the severity of gut damage was improved to only have a rinsandtheirligandsindicatesanenhancedinteractionof
minorsignofnecrosisandischemiccongestion,although neutrophils with the endothelium and ECM, leading to
thegutstillremainedmoderatelyedematous(Figure1A). infiltrationafterintestinalI/R.
Onexaminationof the histopathological changes, severe
mucosal damage with denudationofvilli and collapse of cRGD inhibits neutrophils and macrophages infiltrating
smallvesselswasmicroscopicallyobservedintheguttis- the lungs after intestinal ischemia/reperfusion
sueafterI/Rincomparisonwiththeshamgroup (Figure ToverifytheeffectofcRGDtreatmentonneutrophilinfil-
1B). The integrity ofmorphological structure and height tration, the lung tissues were immunostained with anti-
ofthevilliwerewellpreservedinthegutofcRGD-treated Gr-1antibodies.AsshowninFigure4A,C,theI/Rresulted
animalswhencomparedwiththevehicleones(Figure1B). in an increase of the number of Gr-1-positive cells from
As quantified inFigure 1C, animals undergoing I/R with 27.7 ± 3.5 to 145.0 ± 16.1 cells/field, whereas with the
vehicle treatment exhibited a significant increase in the treatmentofcRGDthenumberofthesecellssignificantly
guthistologicinjuryscorewhencomparedwiththesham reducedto38.0±6.7cells/field.Thelungtissueswerealso
animals,whichwasreducedby70.6%withadministration immunostained withanti-CD11bantibodiestodetectthe
ofcRGD.MPOactivity,anindicatorofneutrophilcontent, infiltratedmacrophages.Similarly,thenumberofCD11b-
inguttissuerosefromnondetectableintheshamgroupto positive cells in the sham, vehicle, and cRGD treatment
0.36 ± 0.13 U/g tissue after I/R (Figure 1D). However, groups was 30.7 ±2.2, 180.3± 15.5,and46.7± 7.2cells/
administration ofcRGD resultedina 77.8% inhibitionof field, respectively (Figure 4B, D). cRGD treatment thus
MPOactivityintheguttissueafterI/R(Figure1D). effectivelypreventstheneutrophilsandmacrophagesinfil-
trating the lungs after intestinal I/R. We also stained the
cRGD improves microscopic deterioration of the lungs gut tissues with anti-Gr-1 and anti-CD11b antibodies.
after intestinal ischemia/reperfusion Althoughareductionofneutrophilsandmacrophageswas
Thelungisregardedasthemostvulnerableremoteorgan observedinthegutofthecRGD-treatedgroup,thenum-
injured after intestinal I/R. The lung tissues after I/R ber of stained cells was very low and sparse (data not
presented substantial morphological changes, including shown).
alveolar collapse, edema, hemorrhage and infiltration of
inflammatory cells in comparison with the sham group cRGD lowers the inflammatory response after intestinal
(Figure2A).Incontrast,administrationofcRGDdramati- ischemia/reperfusion
cally reduced microscopic deterioration in comparison Excessive elevation of proinflammatory cytokines is
withthevehiclegroup(Figure2A).AsquantifiedinFigure amajorcontributorinremoteorganinjuryafterintestinal
2B,miceundergoingI/Rwithvehicletreatmentexhibited I/R.SerumlevelsofproinflammatorycytokinesTNF-aand
a significant increase in the lung histologic injury score IL-6 were increased to 102.0 ± 30.3 and 1,524.1 ± 493.0
when compared with the sham animals, which was pg/ml after I/R, respectively, while their levels are not
reduced by 60.0% with administration of cRGD. MPO detectableintheshamgroup(Figure5A).Serumlevelsof
activity in the lungs was increased after intestinal I/R, TNF-aandIL-6decreasedby71.0and67.9%withcRGD
whereasadministrationofcRGDsignificantly attenuated treatment, respectively, in comparison with the vehicle
lungMPOactivityby54.2%(Figure2C). group(Figure5A).AfterintestinalI/R,IL-6andchemokine
Matsuoetal.CriticalCare2013,17:R19 Page5of12
http://ccforum.com/content/17/1/R19
A
Sham Vehicle cRGD
B
Sham Vehicle cRGD
C D
5 0.6
e * e) *
or 4 su 0.5
c s
y s g ti 0.4
ur 3 U/
nj (
c i ty 0.3
ogi 2 * # ctivi 0.2 #
ol a
st 1 O 0.1
Hi P
M
ND ND
0 0.0
Sham Vehicle cRGD Sham Vehicle cRGD
Intestinal I/R Intestinal I/R
Figure1cRGDattenuatesgutdamageandmicroscopicdeteriorationofgutafterintestinalischemia/reperfusion.Micetreatedwith
normalsalineorcyclicarginine-glycine-aspartatepeptide(cRGD)weresubjectedtointestinalischemia/reperfusion(I/R).After4hours,micewere
euthanized.(A)Representativeimagesforthegrossmorphologicalappearanceofthegutfromsham,vehicle,andcRGDtreatmentgroups.
(B)Guttissuesharvested4hoursafterintestinalI/RwerestainedwithH&E,andexaminedunderlightmicroscopyat200×magnification.
Representativeimagesforsham,vehicle,andcRGDtreatmentgroups.(C)Histologicinjuryscoresofthegutindifferentgroupswerequantified
asdescribedinMaterialsandmethods.(D)Guttissuemyeloperoxidase(MPO)activitywasdeterminedspectrophotometrically.Dataexpressedas
mean±standarderror(n=5/group).*P<0.05versussham,#P<0.05versusvehicle.ND,nondetectable.
Matsuoetal.CriticalCare2013,17:R19 Page6of12
http://ccforum.com/content/17/1/R19
(cid:4)
(cid:94)(cid:346)(cid:258)(cid:373) (cid:115)(cid:286)(cid:346)(cid:349)(cid:272)(cid:367)(cid:286) (cid:272)(cid:90)(cid:39)(cid:24)
(cid:17) (cid:18)
5 8
*
)
e e *
r u
o 4 s
y sc g tis 6
ur 3 U/
c inj * # ty ( 4 #
gi 2 vi
o ti
c
olo aa 22
st 1 O
Hi P
M
ND
0 0
Sham Vehicle cRGD Sham Vehicle cRGD
Intestinal I/R Intestinal I/R
Figure2cRGDimprovesmicroscopicdeteriorationofthelungsafterintestinalischemia/reperfusion.(A)Lungtissuesharvested4hours
afterintestinalischemia/reperfusion(I/R)werestainedwithH&E,andexaminedunderlightmicroscopyat200×magnification.Representative
imagesforsham,vehicle,andcyclicarginine-glycine-aspartatepeptide(cRGD)treatmentgroups.(B)Histologicinjuryscoresofthelungsin
differentgroupswerequantifiedasdescribedinMaterialsandmethods.(C)Lungtissuemyeloperoxidase(MPO)activitywasdetermined
spectrophotometrically.Dataexpressedasmean±standarderror(n=5/group).*P<0.05versussham,#P<0.05versusvehicle.ND,
nondetectable.
MIP-2 were increased in the gut tissues, while IL-6 and 59.5% inthe lungsincomparison with the vehicle group
MIP-2levelsintheguttreatedwithcRGDwerereducedby (Figure6A,B).Inaddition,thelevelsofcleavedcaspase-3,
38.6and24.4%,respectively,incomparisonwiththevehicle anothermarkerofcellapoptosis,determinedbyWestern
group(Figure5B).Similarly,theelevationofIL-6andMIP- blotting,wereincreasedinthelungsofthevehiclegroup
2levelsinthe lungs after I/R was inhibitedby 60.8% and incomparisonwiththoseintheshamgroup(Figure6C).
56.7%withcRGDtreatment,respectively(Figure5C). Again, administration of cRGD significantly reduced the
levels of cleaved caspase-3 after intestinal I/R by 57.0%
cRGD inhibits apoptosis in the lungs after intestinal (Figure6C).
ischemia/reperfusion
TodeterminetheeffectofcRGDtreatmentonapoptosis, Discussion
a TUNEL assay, a common method for detecting DNA The lung is the most susceptible remote organ to be
fragmentation, wasconductedimmunohistochemicallyin injured after intestinal I/R, which makes ALI a major
thelungtissues.AsshowninFigure6A,B, theapoptotic causefordeath[8,9,11].Migrationofactivatedneutrophils
cells in the lungs were elevated from nondetectable to into the lungs is a hallmark for the progression of ALI
well observed after intestinal I/R. Treatment of cRGD [10], which is mainly mediated through the integrin-
significantly reduced the number of apoptotic cells by dependentpathway[17].Syntheticpeptidescontainingthe
Matsuoetal.CriticalCare2013,17:R19 Page7of12
http://ccforum.com/content/17/1/R19
A
Gut (cid:401)Sham (cid:374) Vehicle
integrin mRNA (fold)(cid:69)1 2468 * integrin mRNA (fold)(cid:69)2 0112....5050 * integrin mRNA (fold)(cid:69)3 102468 * ICAM-1 mRNA (fold) 112205055 * Fibronectin mRNA (fold) 12340000 *
0 0.0 0 0 0
B
Lung
integrin mRNA (fold)(cid:69)1 01122.....50505 * integrin mRNA (fold)(cid:69)2 123456 Plot 1 * integrin mRNA (fold)(cid:69)3 1234 * ICAM-1 mRNA (fold) 123 * Fibronectin mRNA (fold) 2468 Plot 1 *
0.0 0 0 0 0
Figure3Expressionofadhesionmoleculesforneutrophilinfiltrationisupregulatedafterischemia/reperfusion.Gutandlungtissueswere
harvested4hoursafterintestinalischemia/reperfusion(I/R).ThemRNAlevelsofb,b,andb integrins,intercellularadhesionmolecule-1(ICAM-1),
1 2 3
andfibronectininthe(A)gutand(B)lungsweredeterminedbyreal-timeRT-PCRanalysis.Theirexpressionlevelswerenormalizedtob-actin.The
valueoftheshamgroupisdesignated1forcomparison.Dataexpressedasmean±standarderror(n=5/group).*P<0.05versussham.
RGDsequencehavebeendemonstratedtobeabletodis- within the damaged liver was inhibited by the treatment
rupt thecell-cellandcell-matrix interactionmediatedby [30]. In a rat model of renal I/R, cyclic RGD peptides
integrins, as well as to inhibit the cellular activity stimu- (RGDDFV and RGDDFLG) effectively ameliorate acute
latedbyintegrinengagement. renalfailure[31].Bothpeptideswereeffectiveatlowering
In the current study, we showed that treatment with thetubularobstructionbypredominantlypreventingcell-
cRGD improved the integrity of tissue morphology not cell and cell-matrix adhesions [31]. Cyclic RGDFV had a
only locally on the gut but also remotely on the lungs higher potential than cyclic RGDFLG in inhibiting cell-
afterintestinalI/R.cRGDtreatmenteffectively inhibited matrixadhesion,butbothpeptideswereequipotentindis-
neutrophilinfiltrationtotheorgans,demonstratedbythe rupting cell-cell adhesion [31]. The relative affinity and
reduction of MPO activity in the gut and lungs, and the specificityoftheRGDpeptidestootherproteinshavebeen
number of Gr-1-positive cells in the lungs. cRGD treat- indicatedtobeaffectedbyotheraminoacidresiduesflank-
ment also attenuated the inflammatory response by ingtheRGDmotif[35].CyclicCRGDGWChashigheraffi-
decreasingthelevelsofTNF-aandIL-6inserum,aswell nity forthea b integrin[36],whilecyclicRGDFV more
5 1
asIL-6andMIP-2inthegutandlungs.Correspondingly, selectivelyinteractswitha b anda b integrins[32].
v 3 v 5
the number of macrophages stained with CD11b in the RGD peptides can be synthesized in two different
lungswasreduced.Finally,thelungsofthecRGD-treated structure typesof linear and cyclic formats. Cyclic RGD
animals had less apoptotic cells, demonstrated by ismuchmore stable thanthatoflinearRGDundernor-
TUNELstaininganddetectionofcleavedcaspase-3. mal conditions [37]. Linear RGD, such as GRGDS and
Toourknowledge,thisisthefirststudyshowingapro- GRGDNP, are rapidly metabolized in vivo and have a
tective effect of cRGD on ALI induced by intestinal I/R, relativelylowaffinity forintegrins [37].Onthecontrary,
although itseffectiveness has also been demonstrated on linear RGD is more flexible in comparison with cyclic
amelioratingtheinjuryinotherorgansthathadundergone RGD. However, the cell permeability of linear RGD is
I/R [30,31]. In steatotic liver cold ischemia followed by concerning. Linear RGD induces apoptosis without any
transplantation, administration of a cyclic RGD peptide requirementforintegrin-mediatedcell clusteringor sig-
(CRGDGWC) inhibited the recruitment of macrophages nals. Instead, linear RGD enters cells to bind pro-cas-
and neutrophils, as well as depressed the expression of pase-3 containing a potential RGD-binding motif
proinflammatorymediators,induciblenitricoxidesynthase (aspartate-aspartate-methionine), resulting in activation
andIFN-g[30].Inaddition,theexpressionofmatrixmeta- of caspase-3 [38]. In contrast, our study with the treat-
loproteinase-9,agelatinaseinvolvedinleukocytemigration ment of cRGD showed a reduction of apoptotic cells in
Matsuoetal.CriticalCare2013,17:R19 Page8of12
http://ccforum.com/content/17/1/R19
(cid:4)
(cid:94)(cid:346)(cid:258)(cid:373) (cid:115)(cid:286)(cid:346)(cid:349)(cid:272)(cid:367)(cid:286) (cid:272)(cid:90)(cid:39)(cid:24)
(cid:1005)
(cid:882)
(cid:396)
(cid:39)
(cid:17)
(cid:271)
(cid:1005)
(cid:1005)
(cid:24)
(cid:18)
(cid:87)(cid:47)
(cid:4)
(cid:24)
(cid:18) (cid:24)
200 250
d
sitive cells/field 110500 * ositive cells/fiel 112050000 *
1 po 50 # 1b p 50 #
r- 1
G D
C
0 0
Sham Vehicle cRGD Sham Vehicle cRGD
Intestinal I/R Intestinal I/R
Figure4cRGDinhibitsneutrophilsandmacrophagesinfiltratingthelungsafterintestinalischemia/reperfusion.Lungtissuesharvested
4hoursafterintestinalischemia/reperfusion(I/R)weresectionedandimmunostainedwith(A)Gr-1(green)fordetectingneutrophilsand
(B)CD11b(red,upperpanel)fordetectingmacrophages.Lowerpanels:4’,6-diamidino-2-phenylindole(DAPI;blue)stainingfornucleus.
Representativeimagesforsham,vehicle,andcRGDtreatmentgroupsat200×magnification.Graphicalrepresentationof(C)Gr-1-positiveand
(D)CD11b-positivestainingcellsaveragedover10microscopicfieldsperanimal.Dataexpressedasmean±standarderror(n=5/group).*P<
0.05versussham,#P<0.05versusvehicle.cRGD,cyclicarginine-glycine-aspartatepeptide.
Matsuoetal.CriticalCare2013,17:R19 Page9of12
http://ccforum.com/content/17/1/R19
(cid:4) (cid:17) (cid:18)
2500 (cid:94)(cid:286)(cid:396)(cid:437)(cid:373) 300 (cid:39)(cid:437)(cid:410) * 160 (cid:62)(cid:437)(cid:374)(cid:336) *
2000 * ein) 250 ein) 120
pg/ml) 1500 mg prot 125000 *# mg prot 80
IL-6 ( 1000 *# 6 (pg/ 100 6 (pg/ 40 #
500 IL- 50 IL-
ND
0 0 0
200 600 2000 *
*
* n) 500 n)
ααααTNF- (pg/ml) 11505000 * # P-2 (pg/mg protei 234000000 * # P-2 (pg/mg protei 11505000000 * #
MI 100 MI
0 0 0
Sham Vehicle cRGD Sham Vehicle cRGD Sham Vehicle cRGD
Intestinal I/R Intestinal I/R Intestinal I/R
Figure5cRGDlowerstheinflammatoryresponseafterintestinalischemia/reperfusion.Bloodandtissueswereharvested4hoursafter
intestinalischemia/reperfusion(I/R).(A)SerumlevelsofIL-6andTNF-aweredeterminedbyELISA.(B)Gutand(C)lunglevelsofIL-6and
macrophageinflammatoryprotein-2(MIP-2)weredeterminedbyELISA.Dataexpressedasmean±standarderror(n=5/group).*P<0.05versus
sham,#P<0.05versusvehicle.ND,nondetectable.cRGD,cyclicarginine-glycine-aspartatepeptide.
thelungsafterintestinalI/R,suggestingthatverylimited analogofIL-8,isapotentchemoattractantforneutrophil
cRGD in the cells interacted with pro-caspasae-3. This recruitment and activation [42]. By depletion of alveolar
differencemaybeduetotherigidstructureofcyclicpep- macrophages, alveolar macrophages have been indicated
tidesincomparisonwiththelinearstructures. toplay an essential role in ALIinduced by intestinaland
The mechanism of the cRGD on alleviating ALI- acute lung I/R [11,20]. Furthermore, a recent study
inducedbyintestinalI/Risattributedtotheinhibitionof demonstratedthatcyclicRGDcouldattenuatetheTNF-a
neutrophils infiltrating the lungs. Over-recruitment of secretionfrom macrophagesby inhibiting the ligation of
activatedneutrophilscausesexcessivereleaseofproteoly- a b integrinforNF-(cid:1)Bactivation[43].
v 3
ticenzymes,suchaselastaseandMPO,andreactiveoxy- In this study, administration of cRGD at 5 mg/kg BW
genspeciesincludinghydrogenperoxideandsuperoxide. was based on a recent report showing that the linear
Excessive production of these molecules causes disrup- RGDS peptide at 5 mg/kg BW significantly inhibited
tionofendothelialbarrierfunctionsandpromotesextra- neutrophilsinfiltratingthelungsinalipopolysaccharide-
vascular host tissue damage [19,39]. Furthermore, induced ALI model [29]. In addition, cyclic RGD at 4
neutrophils can produce cytokines and chemokinesthat mg/kgBWhadbeenappliedinthestudyofsteatoticliver
enhance the acute inflammatory response [40]. Using cold ischemia and reperfusion injury [30]. We also per-
real-time RT-PCR analysis, we detected an increased formedapilotstudyatadoseof10mg/kgBWcRGD,but
expression of several adhesive molecules, including b , didnotobserveanoticeabledifferenceincomparisonwith
1
b , andb integrins, ICAM-1and fibronectin,which are the5mg/kgBWdose.Whileexcessiveneutrophilinfiltra-
2 3
all involved in neutrophil transmigration after intestinal tion causes organ damage, neutrophils are necessary for
I/R. This observation further supports the rationale of the killing of invaded pathogens [19,39]. We therefore
targetingintegrin-mediatedinteractiontocontrolneutro- speculatethatadministrationofcRGDatincreasinglyhigh
philinfiltrationintotheorgans. dosesmaylessenitsprotectiveeffectonALI.Toevaluate
Inadditionto neutrophils, areductionof macrophages theoveralleffectofcRGDonattenuatingorganinjuryand
in the lungs was also observed in the cRGD-treated ani- inhibiting the inflammatory response, administration of
mals. Macrophages are the key cell typesinvolved in the normalsaline(vehicle)wasusedasabaselineforthecom-
productionofproinflammatorycytokinessuchasTNF-a parison. Any random peptide sequence used as control
andIL-6,aswellaschemokinesincludingmonocyteche- couldincurpotentialunidentifiedoff-targeteffects.More-
moattractantprotein-1,andMIP-2[41].MIP-2,amurine over, the surgical procedure of intestinal I/R described
Matsuoetal.CriticalCare2013,17:R19 Page10of12
http://ccforum.com/content/17/1/R19
(cid:4)
(cid:94)(cid:346)(cid:258)(cid:373) (cid:115)(cid:286)(cid:346)(cid:349)(cid:272)(cid:367)(cid:286) (cid:272)(cid:90)(cid:39)(cid:24)
(cid:62)
(cid:28)
(cid:69)
(cid:104)
(cid:100)
(cid:87)(cid:47)
(cid:17) (cid:18)
(cid:18)(cid:258)(cid:400)(cid:393)(cid:258)(cid:400)(cid:286)(cid:882)(cid:1007)
ββ(cid:882)(cid:882)(cid:258)(cid:258)(cid:272)(cid:272)(cid:410)(cid:410)(cid:349)(cid:349)(cid:374)(cid:374)
50 10
eld * ctin *
s/fi 40 ββββ-a 8
e cell 30 se-3/ 6 * #
v a
siti 20 * # asp 4
o c
L p ed
E 10 v 2
N a
U e
T Cl
0 0
Sham Vehicle cRGD Sham Vehicle cRGD
Intestinal I/R Intestinal I/R
Figure6cRGDinhibitsapoptosisinthelungsafterintestinalischemia/reperfusion.Lungtissueswereharvested4hoursafterintestinal
ischemia/reperfusion(I/R).(A)LungsectionsweresubjectedtoterminaldeoxynucleotidyltransferasedUTPnickend-labeling(TUNEL)staining.
Representativeimagesforsham,vehicle,andcRGDtreatmentgroupsat200×magnification.Upperpanel:TUNEL-positive(green);lowerpanel:
propidiumiodide(PI;red)stainingfornucleus.(B)GraphicalrepresentationofTUNEL-positivestainingcellsaveragedover10microscopicfieldsper
animal.(C)Levelsofcleavedcaspase-3inthelungtissuesdeterminedbywesternblotting.Representativeblotsagainstcleavedcaspase-3andb-actin.
Blotswerescannedandquantifiedwithdensitometry.Thelevelsofproteinexpressionintheshamgrouparedesignated1forcomparison.Dataare
expressedasmean±standarderror(n=5/group).*P<0.05versussham,#P<0.05versusvehicle.cRGD,cyclicarginine-glycine-aspartatepeptide.
here is a severe model. Most mice died within 20 hours Conclusions
afterI/Rinourpilotstudy,whichmakesitverydifficultto ALI is a common complication that occurs after intest-
study the effect ofcRGD at later time points.Inessence, inal I/R and contributes to its high mortality rate. Exces-
therefore,thefocusofthisstudywastoexaminetheonset sive neutrophil infiltration into the lungs is a hallmark
ofALIandmonitortheunderlyingimmunologicmechan- of ALI. Integrin-mediated interaction plays an important
ismsattheearlytimepoints. role in regulating neutrophil transmigration as well as