ebook img

Cross-Talk between Staphylococcus aureus and Other Staphylococcal Species via the agr Quorum ... PDF

13 Pages·2017·2.5 MB·English
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Cross-Talk between Staphylococcus aureus and Other Staphylococcal Species via the agr Quorum ...

fmicb-07-01733 October5,2017 Time:15:56 #1 ORIGINALRESEARCH published:08November2016 doi:10.3389/fmicb.2016.01733 Cross-Talk between Staphylococcus aureus and Other Staphylococcal Species via the agr Quorum Sensing System JaimeCanovas1†,MaraBaldry1†,MartinS.Bojer1†,PaalS.Andersen1,2,BengtH.Gless3, PiotrK.Grzeskowiak3,MarcStegger2,PeterDamborg1,ChristianA.Olsen3and HanneIngmer1* 1DepartmentofVeterinaryDiseaseBiology,FacultyofHealthandMedicalSciences,UniversityofCopenhagen, Frederiksberg,Denmark,2DepartmentofMicrobiologyandInfectionControl,StatensSerumInstitut,Copenhagen, Denmark,3CenterforBiopharmaceuticalsandDepartmentofDrugDesignandPharmacology,FacultyofHealthand MedicalSciences,UniversityofCopenhagen,Copenhagen,Denmark Staphylococci are associated with both humans and animals. While most are non- pathogeniccolonizers,Staphylococcusaureusisanopportunisticpathogencapableof causing severe infections. S. aureus virulence is controlled by the agr quorum sensing Editedby: system responding to secreted auto-inducing peptides (AIPs) sensed by AgrC, a two SusanneFetzner, componenthistidinekinase.agr lociarefoundalsoinotherstaphylococcalspeciesand UniversityofMünster,Germany forStaphylococcusepidermidis,theencodedAIPrepressesexpressionofagrregulated Reviewedby: MattiasCollin, virulencegenesinS.aureus.Inthisstudyweaimedtobetterunderstandtheinteraction LundUniversity,Sweden betweenstaphylococciandS.aureus,andshowthatthisinteractionmayeventuallylead ShinyaWatanabe, JichiMedicalUniversity,Japan totheidentificationofnewanti-virulencecandidatestotargetS.aureusinfections.Here *Correspondence: weshowthatculturesupernatantsof37outof52staphylococcalisolatesrepresenting HanneIngmer 17differentspeciesinhibitS.aureusagr.Thedogpathogen,Staphylococcusschleiferi, [email protected] expressedthemostpotentinhibitoryactivityandwasactiveagainstallfouragr classes †Theseauthorshavecontributed equallytothiswork. found in S. aureus. By employing a S. aureus strain encoding a constitutively active AIP receptor we show that the activity is mediated via agr. Subsequent cloning and Specialtysection: heterologous expression of the S. schleiferi AIP in S. aureus demonstrated that this Thisarticlewassubmittedto InfectiousDiseases, moleculewaslikelyresponsiblefortheinhibitoryactivity,andfurtherproofwasprovided asectionofthejournal when pure synthetic S. schleiferi AIP was able to completely abolish agr induction FrontiersinMicrobiology of an S. aureus reporter strain. To assess impact on S. aureus virulence, we co- Received:01August2016 inoculated S. aureus and S. schleiferi in vivo in the Galleria mellonella wax moth larva, Accepted:17October2016 Published:08November2016 and found that expression of key S. aureus virulence factors was abrogated. Our data Citation: show that the S. aureus agr locus is highly responsive to other staphylococcal species Canovas J,Baldry M,Bojer MS, suggesting that agr is an inter-species communication system. Based on these results Andersen PS,GlessBH, Grzeskowiak PK,Stegger M, we speculate that interactions between S. aureus and other colonizing staphylococci Damborg P,Olsen CAandIngmer H will significantly influence the ability of S. aureus to cause infection, and we propose (2016)Cross-Talkbetween that other staphylococci are potential sources of compounds that can be applied as StaphylococcusaureusandOther StaphylococcalSpeciesviatheagr anti-virulencetherapyforcombatingS.aureusinfections. QuorumSensingSystem. Front.Microbiol.7:1733. Keywords:Staphylococcusaureus,Staphylococcusschleiferi,quorumsensing,agr,quorumsensinginhibition, doi:10.3389/fmicb.2016.01733 auto-inducingpeptide,cross-talk,anti-virulencetherapy FrontiersinMicrobiology|www.frontiersin.org 1 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #2 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr INTRODUCTION MATERIALS AND METHODS Atleast40differentStaphylococcusspecieshavebeendescribed Bacterial Strains and Growth Conditions to date (Harris et al., 2002). While a large number of these are Staphylococcus aureus strains used in this study include: foundtocolonizehumans,manyalsocolonizeanimals(Nagase Strain 8325-4 (Novick, 1967) was used as a source of AIP-I etal.,2002).Staphylococcusaureusisbyfarthebestcharacterized containing supernatant. For the β-galactosidase plate assays staphylococcal species. This opportunistic pathogen resides on PC203 (S. aureus 8325-4, spa::lacZ), PC322 (S. aureus 8325-4, skin and mucosal membranes in humans and animals, and it hla::lacZ), SH101F7 (S. aureus 8325-4, rnaIII::lacZ) (Chan can cause a variety of infections ranging from mild skin and and Foster, 1998) and strain MOZ53 S. aureus agr type III soft tissue infections to severe conditions such as septicemia (Horsburgh et al., 2002) were used. For the β-lactamase liquid (Lowy, 1998). Expression of the majority of S. aureus virulence assay strain RN10829 WT and RN10829 Const (Geisinger factors is controlled by the accessory gene regulator (agr) et al., 2009) a β-lactamase reporter strain substituting the quorum sensing system. agr is composed of two divergent native agr locus with a chromosomal integration of P2-agrA transcripts:one(P2)encodingtheAgrACtwocomponentsignal and P3-blaZ and a plasmid from which a constitutive active transduction system that responds to autoinducing peptides variant of AgrC (agrC-I-R238H) is expressed, was used to (AIPs) encoded and secreted by the products of agrBD; and assess AgrC-dependent effects of staphylococcal supernatants. theother(P3)encodingaregulatoryRNA,RNAIII,theeffector Fluorescent reporters AH1677, AH430, AH1747, and AH1872 moleculeofagr.AIPsbindtotheagrC-encodedhistidinekinase (Halletal.,2013)wereusedtoevaluateagrinductionofthefour (AgrC),andviaphosphorylationoftheAgrAresponse-regulator, different S. aureus agr groups. We cloned the Staphylococcus stimulate the expression of RNAIII (Wang et al., 2014). At schleiferi agrBD genes into the BglII/EcoRI sites of expression highcelldensities,AIPaccumulationresultsinup-regulationof vector pRAB12-lacZ (Helle et al., 2011) using primers 5(cid:48)- exoproteinexpressionincludingthehla-encodedvirulencefactor GATACAAGATCTGTTAAGGAGGAGGGCTATTTG-3(cid:48) and α-hemolysin,anddown-regulationofsurface-associatedproteins 5(cid:48)-GATACAGAATTCCGCTCTCTAAACATTATTTTATTATTC- such as spa-encoded protein A (Queck et al., 2008; Shoham, 3(cid:48) and chromosomal DNA from S. schleiferi strain 2898 as 2011). template generating plasmid pRAB12-agrBD . This construct Ss Staphylococcusaureusstrainscanbedividedintoatleastfour or the vector itself was expressed in the S. aureus agr deletion agr classes(groupsI–IV),withdistinctAIPsinducingvirulence strain 8325-4(cid:49)agr [constructed by transduction (ϕ11) from gene expression within each group, but repressing expression strain RN6911 (Novick et al., 1993) into strain 8325-4] by in strains of other groups by acting as competitive inhibitors growing the strains overnight under induction (0.2 µg/ml to AgrC binding (Ji, 1997; Otto et al., 2001; Geisinger et al., anhydrotetracycline) generating AIP containing or AIP Ss 2012). The agr specificity is determined by AgrB, AgrC, and negative supernatants respectively. All other staphylococcal AgrD, which vary among the four groups. agr has also been strains used are listed in Table 1. Unless otherwise stated, identified in other staphylococcal species although with much bacteriaweregrowninTryptoneSoyaBroth(TSB),Oxoid(1:10 higher sequence divergence. Despite this diversity, functional volume/flaskratio),at37◦Cwithshakingat200rpm. agr loci have been demonstrated in Staphylococcus lugdunensis andStaphylococcusepidermidis(Vandeneschetal.,1993;Wamel β-Galactosidase Plate Assay et al., 1998). S. epidermidis is another clinically important ThereporterassaywasconductedasdescribedbyNielsenetal. opportunistic pathogen whose virulence is largely controlled (2010). Test supernatants, and control supernatants of strains via the agr system (Olson et al., 2014), and the S. epidermidis 8325-4(AIP-I)andM0Z53(AIP-III)wereused.Incubationuntil AIP is a potent inhibitor of the S. aureus agr system (Otto bluecolorappearedinplatesvariedfrom9to48h. et al., 2001). Although, the biological importance of this cross- inhibition of quorum sensing remains unknown, it has been In vitro Competition As Assessed Using suggested that it contributes to niche competition between S. epidermidis and S. aureus, resulting in the predominance the β-Galactosidase Liquid Assay of S. epidermidis on the skin and in indwelling device- Theassaywasbasedontheliquidβ-galactosidaseassay(Miller, associated chronic infections (Otto et al., 2001; Thoendel 1972)withsomemodifications.Briefly,Overnight(ON)cultures et al., 2011). The frequent isolation of other staphylococci of our SH101F7 S. aureus RNAIII reporter strain and our together with S. aureus also point to a possible interaction S. schleiferi strains (grown at 37◦C while shaking at 200 rpm) betweenstaphylococcalspecieswitharoleinnichecompetition werediluted100xin15mLTSBandallowedtoreachanOD 600 and colonization (Lina et al., 2003; Kozioł-Montewka et al., of0.5andafteradjustingeachstraintoanOD of0.1inTSB 600 2006). the competition was started at a ratio of 1:1 and followed over The aim of this study was to examine the extent to which time. From each culture, 1 mL was taken at each time interval agr cross-inhibitory activity occurs between S. aureus and and the samples were sonicated for 10 s to disrupt aggregates other staphylococcal species, and to elucidate the mechanism formed. The OD was measured and serial dilutions for each 600 behind this cross-talk. Understanding this interaction between sampleweremadeandplatedonTSAwithX-gal(150µg/mL). staphylococcimayhelpintheidentificationofnewanti-virulence Theremainingsampleswerecentrifugedfor3minat8000rpm strategiestargetingS.aureusinfections. and 4◦C. After centrifugation, the supernatants were removed FrontiersinMicrobiology|www.frontiersin.org 2 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #3 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr n o ati ul ownreg X + X + + + ++++ ++++ ++++ X X X + + + ++++ ++++ ++++ ++ ++ ++++ X X + +++ +++ d aIII rn ct. e eff e e stisolationsourc Horsenose Dogear Birdtrachea Birdtrachea Notreported Caturine Pigjoint Notreported Notreported Minkskin MinkSkin Minkskin Horsetrachea Horsewound Horsewound Minkskin Dogear Dogskin Cat Dogear Minkskin Notreported Notreported Notreported Dog Oxmilk ++++:verysever o d H n a ct e us us us eff equorum haemolytic haemolytic haemolytic hominis hominis hyicus hyicus hyicus lentus lentus lentus vitulinus vitulinus vitulinus schleiferi schleiferi schleiferi schleiferi schleiferi schleiferi sciuri sciuri sciuri simulans simulans ++:severe us us us us us us us us us us us us us us us us us us us us us us us us us us + Name Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc Staphylococc derateeffect; o m Id. 450 1312 2181 28993 9525 1084 218 2808 4948 6948 6949 aC-30966-5 62 96 128 30689-20 30743 30219 2319 2862 2898 9468 9470 9505 1457 312 ++hteffect;: g sli n + o ati ct; ownregul ++ ++ ++ ++ + ++ ++ + + + X X ++ X X ++ +++ ++ ++ X X + X +++ +++ X X:noeffe d e: naIII wher ctivity. cer thewell RNAIII-regulationa Hostisolationsour Dogwound Dogskin Dogwound Dognose Dogurine Dogskin Dogwound Dogwound Dogurine Dogskin Cowear Horseabscess Notrecorded Dogear Dogtonsil Horseuterus Horseuterus Cowwound Cowmilk Dogurine Oxmilk Notrecorded Dogkindney Horsewound Minkskin Minkwound nhibitionhaloaround d ei n h hylococcalstrains,theirorigin,a Name Staphylococcusintermedius Staphylococcuspseudintermedius Staphylococcuspseudintermedius Staphylococcuspseudintermedius Staphylococcuspseudintermedius Staphylococcuspseudintermedius Staphylococcuspseudintermedius Staphylococcuswarneri Staphylococcuswarneri Staphylococcuswarneri Staphylococcusxylosus Staphylococcusxylosus Staphylococcuscapitis Staphylococcuscapitis Staphylococcuscapitis Staphylococcuscapitis Staphylococcuschromogenes Staphylococcuschromogenes Staphylococcuschromogenes Staphylococcusepidermidis Staphylococcusepidermidis Staphylococcusepidermidis Staphylococcusepidermidis Staphylococcusdelphini Staphylococcusdelphini Staphylococcusdelphini wasratedaccordingtothesizeoft TABLE1|Stap Id. 27472 30755 C-31106 C-31304 30510 30665 30703 30106 29927 30331 28351 L136 9529 2877 6994 52 53 2890 313 1069 352 389 30575 29886 aC-30966-8 C-31232-2 Down-regulation FrontiersinMicrobiology|www.frontiersin.org 3 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #4 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr andthepelletsresuspendedin1mLofTRIS50mM,pH8and TABLE2|RealtimePCRprimersusedinthisstudyfortheassessmentof 3µLoflysostaphin.Themixwasincubatedat37◦Cfor30min reference(ileS,pyk)andtargetgene(rnaIII)expression. toallowforcelllysis.Z-buffer(400µL)wasthenaddedtoeach Gene Sequenceforward Sequencereverse samplewhichwerefurtherincubatedfor5minat28◦C.Lastly, 100µLofONPG(ortho-Nitrophenyl-β-galactoside)(4mg/mL) rnaIII GCACTGAGTCCAAGGAAACTAAC AAGCCATCCCAACTTAATAACC wasaddedtothemixandthetimenecessaryforthesolutionto ileS ACATACAGCACCAGGTCACG CGCCTTCTTCAGTAAATACACC turnyellowwascontrolled.TheODat420and550nmforeach pyk AGGTTGAACTCCCCAAACAA GCAGCCCAAGATTACAAAAA samplewasmeasured.Theactivityofthesampleswascalculated inMillerunitsusingthefollowingformulaasdescribedbyMiller supernatant alone was added and the other with an additional (1972): 10% of S. schleiferi 2898 supernatant. Cultures were allowed to grow until sample withdrawal at 30 and 60 min. Samples were 1000∗(OD420−(1.75∗OD550)) centrifuged and the pellet was immediately frozen at −80◦C. MillerUnits: OD600∗T∗V The disruption of the cell membranes was performed with FastPrep and the the QIAGEN RNeasy kit was used to purify Where:T=timeofreactioninmin; theRNAaspermanufacturer’sinstructions.GenomicDNAwas V=mlcellsaddedtotheassaytubes. thenremovedfromthesamplesusingDNase-I,RNase-freefrom β-Lactamase Assay and Inhibitory Fermentas.Thesampleswerefirstincubatedfor60minat37◦C, followed by 10 min incubation with 50 mM of EDTA at 65◦C. Concentration (IC ) 50 To generate cDNA from the RNA samples, the High Capacity ThemethodusedisdescribedbyNielsenetal.(2014).Brieflythe cDNARTkitfromAppliedBiosystemswasused.10µLofRNA RN10829 (P2-agrA:P3-blaZ)/pagrC-I (WT) and RN10829(P2- and 10 µL of RT-master mix were added to each reaction. The agrA:P3-blaZ)/pagrC-I-R23H(AgrCconst.)reporterstrainswere master mix contained RT Buffer, RT random primers, dNTP grown to an OD600 of 0.4–0.5 where a 1/10 volume of AIP- mix,Nuclease-freewater,andreversetranscriptase.Thenegative I containing supernatant (obtained from strain 8325-4) and controlsconsistedofsampleswithnoreversetranscriptaseadded. 1/10S. schleiferisupernatantswereaddedtothereporterstrain Thesampleswererunfor10minat25◦C,120minat37◦C,5min culture. In assays using heterologously expressed AIPSs 1/20 at 85◦C in a standard PCR machine. Finally, 1.5 µL of cDNA volumeofAIP-Icontainingsupernatantwaschallengedwith1/5 wasassayedbyreal-timePCRonaLightCycler(cid:13)R 96Instrument volumesupernatantfromexpressioncultures.Samplesobtained using FastStart Essential DNA Green Master FastStart Essential at 30 min time intervals after addition of test solutions were DNA Green Master (Roche) and primers for the reference analyzed for β-lactamase activity by nitrocefin conversion. The genes (ileS, pyk) and the target gene (rnaIII) as presented in IC50 of the selected S. schleiferi supernatants was also tested Table2. using the β-lactamase assay, where a 1/10 volume (0.5 mL) of supernatant was added to the total volume of 5 mL of In vivo Competition Assay with Galleria the reporter strain culture (RN10829-WT) representing the mellonella undilutedsupernatant(100%).Then,80,60,40,20,10,5,2.5,and The Galleria mellonella infection was carried out as described 2%oftheinitialvolumeoftheselectedsupernatantwasaddedto by Pollitt et al. (2014) with minor modifications. Briefly, fifth- obtaintheIC curve. 50 instar G. mellonella larvae were inoculated (in a proleg) with a total of 2 × 107 CFU/mL of S. aureus (SH101F7 rnaIII::lacZ), Assessment of agr Inhibition Across agr S.schleiferi(2898erythromycinresistant)oraco-cultureofthe Groups twostrains(toacombinedfinalCFU/mLof2×107)andsplit FluorescentS.aureusreporterstrainsofagrtypesI-IV(P3-yfp) intogroupsforCFUcounting(35pergroup)andsurvivalbenefit were used to evaluate the inhibitory potential of staphylococcal observation(20pergroup).Twocontrolgroupswereincluded; supernatantsonrespectiveagrtypes.Individualreporterstrains oneinjectedwithphosphatebufferedsaline(PBS)andtheother were grown to early exponential phase (non-fluorescent, OD not handled at all. The larvae were then incubated at 37◦C. At approximately0.01),thenadded20%S.schleiferi2898stationary 24,48,and72hpost-inoculation,thehemolymphofthelarvae phase supernatant or TSB as a control and grown to late was collected for CFU determination. Colonies were counted stationary phase to allow for full agr induction. P3 promoter afterO/Nincubationat37◦ConTSAcontainingerythromycin activityofthebacterialpopulationwasmonitoredasaccumulated (5 µg/mL) and X-gal (150 µg/mL). Survival of the larvae was YFP by flow cytometry on a BD AccuriTM C6 flow cytometer monitoredatthesametimepointsashemolymphcollection.This usingtheFL1channel. experiment was repeated three times using different batches of larvapurchasedfromalocalpetstore(HPReptiles,Copenhagen) Reverse Transcriptase-Quantitiative PCR withsimilarresults. Overnight culture of the strain 8325-4 was diluted 100x in AIP Sequencing 15 mL of TSB in a 300 mL flask. Three replicate cultures were prepared and once the cultures reached an OD of 0.35 they SeveralStaphylococcusspp.weresequencedtolookfortheagrD 600 were split into two different conditions; one with 10% 8325-4 andtheaminoacidsequenceoftheAIP.DNAfromtheselected FrontiersinMicrobiology|www.frontiersin.org 4 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #5 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr staphylococciisolateswasextractedusingtheDNeasyBloodand Statistics Tissue kit as described by the manufacturer (Qiagen, Valencia, Where applicable for the β-lactamase assays (Figures 2B and CA, USA). For sequencing preparation fragment libraries were 4A) statistical analysis was performed using the multiple t-test constructedusingtheNexterakit(Illumina,SanDiego,CA,USA) allowing unequal variance. For the qPCR data (Figure 2A) followedby251-bppaired-endsequencingonaMiSeqsequencer an unpaired t-test was performed on normalized and log (Illumina) according to the manufacturer’s instructions. The transformeddata.Forsurvivalcurveanalysis,theKaplan–Meier sequencing reads were assembled using CLC Genomics Work- methodwasappliedandstatisticalanalysiswascarriedoutusing bench 8.0 (Qiagen, Aarhus, Denmark) with default parameters the Log Rank (Mantel–Cox) Chi square test. Any value above to include only contigs of 500 nucleotides and with over 30- P = 0.05 was considered as not significant. All statistical tests fold average coverage. The sequence of S. schleiferi 2898 has wereperformedwithGraphPadPrismv.7.0. beendepositedinGenBank(accessionnumberPRJEB15874).All othersequencecontigsareavailableuponrequest.ExtractedAIP sequenceswerealignedusingMuscleasimplementedinMEGAv RESULTS 6.06,wherethephylogenywasconstructedusingthemaximum parsimony approach with 100 bootstraps and represented with S. aureus Virulence Gene Expression is midpointrooting. Modulated by Staphylococcal Culture Supernatants Chemical Synthesis of AIP A total of 52 staphylococcal isolates representing 17 species obtainedfromavarietyofdifferentanimalhosts(Table1)were TheAIPwassynthesizedbyadoptingaprotocolbasedonlinear examined for their ability to interfere with the agr quorum peptide hydrazides, which was previously reported by Liu and sensingsystemofS.aureususingapreviouslyestablishedreporter coworkers(Zhengetal.,2013)Thelinearpeptidehydrazidewas assay (Nielsen et al., 2010). Staphylococcal strains to be tested synthesized by standard 9-fluorenylmethyloxycarbonyl (Fmoc) weregrownovernighttostationaryphaseintryptonesoybroth solid-phase peptide synthesis (SPPS) using HCTU/i-Pr EtN 2 (TSB), and cell-free supernatants were added to wells formed for amino acid activation on an automated peptide synthesizer in tryptone soy agar (TSA) plates containing reporter strains (SyroWave XP, Biotage). A hydrazide-2-chlorotrityl resin was carryinglacZfusionstoeitheroneoftheagrcontrolledvirulence applied to afford the desired C-terminal peptide hydrazide geneshla,spa,orrnaIII aswellastheβ-galactosidasesubstrate, [YPFCIAYF-NHNH ] after nine coupling/deprotection 2 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside(X-Gal).For cycles, followed by concomitant deprotection of side chain the majority (37 out of 52) of the staphylococcal supernatants functionalities and cleavage from the solid support with tested we observed a reduced expression of hla and rnaIII but CF COOH-i-Pr SiH-water (95:2.5:2.5, 5 mL, 3 h, room 3 3 increasedspaexpression(Figure1;Table1).The37supernatents temperature). The crude peptide was obtained by trituration exhibiting this expression pattern represents 14 of the 17 with cold ether and used without any further purification. staphylococcal species, indicating that these secrete substances ESI-MS m/z calcd for C H N O S 1037.5, found 1037.2 [M+H+]. 53 68 10 10 thatinterferewiththeagrsystemofS.aureus. Thecrudelinearpeptide(10mg,0.01mmol)inDMF(20µL) The Dog Pathogen Staphylococcus wasaddedtoasolutionofNaNO (6mg,0.09mmol)insodium 2 schleiferi is a Potent Inhibitor of the S. phosphate buffer (0.1 mM, pH 3.0) containing guanidinium chloride (6 M) at −20◦C. The reaction mixture was kept at aureus agr Quorum Sensing System −20◦C for 20 min and was then quenched by addition of The magnitude of agr-interference caused by staphylococcal DMF(0.2mL)andcyclizationbuffer[sodiumphosphatebuffer supernatants was monitored in S. aureus 8325-4 by RT-qPCR (0.6 mL, 0.1 mM, pH 6.5) containing thiophenol (44 mg, using previously described primers (Nielsen et al., 2012). Using 0.4 mmol)]. This reaction mixture was agitated on a rocking thesupernatantofthenotablyactiveS.schleiferistrain2898we table for 16 h at room temperature. The desired AIP was observedthattherelativeRNAIIIexpressioninS.aureus8325-4 then purified by preparative reversed-phase HPLC on a C18 decreased by 300 and 3000-fold at 30 and 60 min respectively, Phenomenex Luna column (250 mm × 20 mm, 5 µm, 100 Å) when compared to unexposed cells (Figure 2A). Furthermore, using an Agilent 1260 LC system equipped with a diode array the 50% inhibitory concentration (IC ) was reached with 50 UV detector, applying a gradient of eluent I (water-MeCN- S.schleiferisupernatantconstitutingonly6%ofthetotalS.aureus TFA, 95:5:0.1) and eluent II (0.1% TFA in acetonitrile) with culturevolume. a flow rate of 20 mL/min. Lyophilization of the fractions To address if the observed effect of staphylococcal containingproduct,providedawhitefluffysolid(∼0.5mg,5%) supernatants on virulence gene expression in S. aureus is at >98% homogeneity as determined by UPLC–MS analysis mediatedviadirectinterferencewiththeS.aureusagrregulatory at 254 nm. The compound was reconstituted in DMSO and system, we examined if the effect could be mitigated in a accurate concentration was determined by UV spectroscopy S. aureus strain encoding a constitutively active AgrC sensor (5 mM) before use. ESI-MS m/z calcd for C H N O S histidinekinase(Geisingeretal.,2009).Usingthereporterstrains 53 64 8 10 1005.5, found 1005.2 [M+H+]. MALDI-TOF MS found 1005.6 RN10829 WT (expressing the WT AgrC) and RN10829 Const. [M+H+]. (isogenic mutant expressing the constitutively active AgrC) FrontiersinMicrobiology|www.frontiersin.org 5 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #6 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr FIGURE1|ModulationofStaphylococcusaureusvirulencegeneexpressionbystaphylococcalculturesupernatants.TSAagarplates(with erythromycinandX-gal)containing(A)thehla-lacZ(PC322;Eryr),(B)thernaIII-lacZ(SH101F7;Eryr),or(C)thespa-lacZ(PC203;Eryr)reporterstrainofS.aureus wereexposedto20µL(inpre-drilledwells)ofsupernatantsfromcentrifugation(8000rpmfor60s)ofovernightculturesofstrains27472(Staphylococcus intermedius),28993(Staphylococcushaemolyticus),30755(Staphylococcuspseudintermedius),30743(Staphylococcusschleiferi),29886(Staphylococcus delphini),30106(Staphylococcuswarneri)and2898(Staphylococcusschleiferi).H2Owasusedasacontrol.Zonesappearedbetween9and36hofincubationat 37◦C.Thisfigureisrepresentativeofonesetofscreeningplates. containing a blaZ gene fused to the P3 promoter as previously hypothesis that the inhibition was due to the presence of non- described by Nielsen et al. (2014), we examined the culture nativeAIPinthesupernatantofS.schleiferi.S.aureusAIPwas supernatantsobtainedfromS.schleiferistrains2898and30743. previouslybiosynthesizedinS.aureusbycloningtheagrBDgenes As predicted, in the presence of the WT AgrC in the reporter inanotherwiseagrnegativebackground(ThoendelandHorswill, strain,supernatantsofbothoftheS.schleiferistrainssignificantly 2009). Here, after genome sequencing of the S. schleiferi strain down-regulated RNAIII expression (Figure 2B) but when the 2898,weclonedthe2898agrBDgenesintotheexpressionvector S. schleiferi supernatants were added to the strain expressing pRAB12-lacZ (Helle et al., 2011) generating plasmid pRAB12- the constitutively active AgrC (RN10829 Const.) we observed agrBD and expressed it in the S. aureus agr deletion strain Ss no difference in RNAIII expression (Figure 2C). These results 8325-4(cid:49)agr. In contrast to the inactive vector control strain suggestthattheeffectisAgrCmediated. thesupernatantoftheS.schleiferi-AIP(AIP )producingstrain Ss Under the presumption that S. schleiferi produces AIPs, clearlyinhibitedRNAIIIexpressionasmeasuredbyβ-lactamase which cross-inhibit the agr system of S. aureus, we assessed activity from the P3-blaZ reporter strain both 30 and 60 min the specificity with respect to the different S. aureus agr types. after addition of the supernatant (Figure 4A). These results Hence,weexaminedexpressionfromapreviouslydescribedP3- confirmthattheAIPproducedbyS.schleiferiisinhibitingagrof yfpreporterconstructpresentinS.aureusstrainsofknownagr S.aureus.TofurthersupportthatitisinfacttheS.schleiferiAIP types(Halletal.,2013)thathadbeengrowninthepresenceor that is responsible for inhibition of S. aureus RNAIII via AgrC absence of supernatant from S. schleiferi strain 2898. Evidently, agonist activity, we synthesized the proposed S. schleiferi AIP the supernatant confered a considerable degree of repression and tested the synthetic material in the same P3-blaZ reporter across all agr groups of S. aureus (Figure 3) giving rise to a strain. Our results show indisputably that the S. schleiferi AIP 10–100 fold reduction in observed fluorescence intensity of all is a potent inhibitor of S. aureus RNAIII expression and that reporters.Wenotethattheagrsystemappearsalmostcompletely it acts antagonistically on the reporter strain at low nanomolar repressed in the types I and III reporters even at the late time concentrations(Figure4B). pointoftheassay(24h),whiletherepressionofthetypesIIand IVreportersdisplayadelayintheresponse.Thisdifferencemay S. aureus agr Repression by S. schleiferi stem from different cross-inhibitory affinities of the suspected is Observed during Niche Competition AIP molecule of S. schleiferi against the different AIP-AgrC Both In vitro and In vivo receptor pairs in S. aureus, or simply reflect a difference in the To address if the agr inhibitory activity of S. schleiferi also is agractivationkineticsand/orauto-fluorescenceofthereporters expressedwhenbothstrainssharethesamenicheenvironment employed. we co-cultured S. aureus SH101F7 rnaIII::lacZ reporter strain togetherwiththeS.schleiferi2898or30743strainsata1:1ratio S. schleiferi Inhibition of S. aureus agr is inTSB.After4hwherebacterialgrowthhadreachedstationary AIP-Mediated phase and the agr quorum sensing system in S. aureus is Having demonstrated that S. schleiferi supernatant is a potent normallyfullyactivated,weobservedalmostcompleteinhibition inhibitor of RNAIII expression in S. aureus we investigated the of S. aureus RNAIII expression in cells co-cultured with either FrontiersinMicrobiology|www.frontiersin.org 6 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #7 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr FIGURE2|Continued andRNAIIIlevelswerequantified.InterferenceofS.schleiferisupernatanton S.aureusagrwasmonitoredusingthestrains(B)RN10829(P2-agrA: P3-blaZ)/pagrC-I(WT)and(C)RN10829(P2-agrA:P3-blaZ)/pagrC-I-R23H (AgrCconst.)ReporterstrainsweregrowntoanOD600of0.4–0.5wherea 1/10volumeofAIP-Icontainingsupernatantfromstrain8325-4and1/10 S.schleiferisupernatantwereaddedtothereporterstrainculture.Samples obtainedat30mintimeintervalsafteradditionoftestsolutionswereanalyzed forβ-lactamaseactivitybynitrocefinconversion(Nielsenetal.,2014).Each barrepresentstheaverageof3biologicalreplicatesandtheerrorbars representthestandarddeviation. FIGURE3|Staphylococcusschleiferisupernatantaffectstheactivity ofallfourS.aureusagrtypes.ActivityoffourS.aureusagrgroup reporters(agr-I,agr-II,agr-III,andagr-IV)assessedbyP3expression(P3-yfp) measuredasYFPaccumulationbyflowcytometry.Non-fluorescent, exponentialphasecellsweregrownwith(blue)orwithout(red)20% S.schleiferi2898supernatantuntilstationaryphase.Depictedfluorescence histogramsoriginatefromcellsanalyzedatthe24htimepoint. of the S. schleiferi strains (Figure 5A). Within the time frame of the experiment, the growth proportion of S. aureus to S.schleifericellsremainedessentiallyunchangedsuggestingthat neitherstrainexertagrowthinhibitoryeffecttowardeachother (Figure5B).Thus,duringco-culturethepresenceofS.schleiferi efficientlyrepressestheS.aureusagrquorumsensingsystem. Given the obvious interaction between the two bacterial speciesduringco-cultureinlaboratorymediumweinvestigated ifasimilarphenomenonisobservedinG.mellonellawaxmoth larvae, a model previously reported for studies of S. aureus FIGURE2|QuantificationofinterferencebyS.schleiferionRNAIII virulence(DesboisandCoote,2011).Applyingthesamegrowth expressioninS.aureus.(A)RT-qPCRquantitativeverificationofRNAIII downregulationintheS.aureus8325-4strain.S.aureusin15mLTSBwas conditionsasfortheinvitroco-cultureexperimentweinoculated growntoanOD600=0.35andsupplementedwitha1:10volumeof 2 × 107 colony forming units (CFUs) into the prolegs of fifth- S.schleiferi2898supernatant.Sampleswerecollected30and60min instar larvae and followed the CFU counts and larval survival post-exposuretoS.schleiferisupernatant,RNAwasisolated,cDNAprepared over a period of 3 days. When single species were inoculated, (Continued) S. aureus was recovered at 1 × 108 cells 24 h post-inoculation FrontiersinMicrobiology|www.frontiersin.org 7 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #8 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr FIGURE5|StaphylococcusschleiferiinhibitsS.aureusagrduring co-culturewithoutinfluencinggrowth.(A)S.aureusrnaIII:lacZreporter strainSH101F7grownaloneorinco-culture(1:1)withS.schleiferistrain 30743or2898inTSB.β-galactosidaseactivityundereachconditionwas determinedtomonitoragrinduction.Eachbarrepresentstheaverageofthree replicatesandtheerrorbarsrepresentthestandarderrorofthemean.(B) Growthofthebacterialculturesmeasuredascolonyformingunits(CFUs)/mL monitoredinparallelforeachtimepoint.Distinctionbetweenthetwospecies FIGURE4|StaphylococcusschleiferiAIPinterfereswithS.aureusagr. intheco-culturewasmadebyplatingonTSAsubstitutedwithX-gal,resulting (A)RNAIIIexpressionwasrecordedasβ-lactamaseexpressedfromthe intheSH101F7reporterstraingrowingasbluecolonies,whiletheS.schleiferi P3-blaZreporterfusioninS.aureusRN10829(P2-agrA:P3-blaZ)/pagrC-I(WT) growingaswhite. withadditionof5%AIP-Isupernatantand20%supernatantfromeitherstrain 8325-4(cid:49)agr/pRAB12-agrBDSs(AIPSs)orthecontrolstrain8325-4(cid:49)agr/ pRAB12-lacZ(vectorcontrol)thathadbeengrownandinduced(0.2µg/ml anhydrotetracycline)overnight.Eachbarrepresentstheaverageofthree were present in equal numbers at 24 h, followed by a decline biologicalreplicatesandtheerrorbarsrepresentthestandarddeviation.(B) at 48 h and complete eradication of both species after 72 h P3-blaZexpressionrecordedfromS.aureusRN10829(P2-agrA:P3-blaZ)/ (Figure 6A). The presence of S. schleiferi 24 and 48 h after pagrC-I(WT)whentheinducingAIP-Icontainingsupernatant(10%)is inoculation with S. aureus suggests that factors produced by challengedfor45minwithdifferentconcentrationsofsyntheticS.schleiferi S. aureus allow maintenance of both species in the larva, while AIPatindicatedconcentrations.NoinductionandAIP-Icontaining supernatantalonewasincludedascontrols.Eachbarrepresentstheaverage inverselytheclearanceofbothspeciesat72hmaybesuggestive ofthreebiologicalreplicatesandtheerrorbarsrepresentthestandard that there is a S. schleiferi-mediated repression of S. aureus deviation. virulencefactorsviaagrdown-regulation,andthatthisrepression allows the larvae to eradicate the combined staphylococcal population. Despite the clearance of both species at 72 h, the andonlydeclinedslightlyat72h.Wewereunabletodetectany co-culturedidnotofferasignificantlarvalsurvivalbenefitover S. schleiferi in the larval hemolymph at any of the time points the single S. aureus inoculant group (Figure 6B). Nevertheless, (Figure 6A), where survival of this group was comparable to our data show that in the presence of S. aureus, S. schleiferi is the PBS control larvae group (Figure 6B). In contrast, when maintainedforanextendedperiodoftimeinthelarvaeandthat S. schleiferi was inoculated together with S. aureus both species ultimatelytheirpresenceleadstoeradicationofbothspecies. FrontiersinMicrobiology|www.frontiersin.org 8 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #9 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr FIGURE6|DualpresenceofS.schleiferiandS.aureusinfluencecolonizationcapabilitiesinaGalleriamellonellainfectionmodel.Fifth-instar G.mellonellalarvaewereinoculatedwithatotalof2×107CFU/mLofS.aureus(SH101F7),S.schleiferi(2898)oraco-cultureofthetwostrains(toacombined finalCFU/mLof2×107)andsplitintogroupsforCFUcounting(35pergroup)andsurvivalbenefitobservation(20pergroup).(A)At24,48,and72h post-inoculation,thehemolymphofthelarvaewascollectedforCFUdetermination.ColonieswerecountedafterO/Nincubationat37◦ConTSAcontaining erythromycinandX-gal,asbothstrainsareerythromycinresistant.(B)Survivalofthelarvaewasmonitoredatthesametimepointsashemolymphcollection.This experimentwasrepeatedthreetimeswithsimilarresults. AIP Homology in Staphylococci is not required for the antagonistic or the activation activity The AIP amino acid composition, positioning and properties (Wright et al., 2004). Also they retained the central cysteine havebeenreportedtoplayanimportantroleinthetypeofAgrC necessary for AIP cyclization (Thoendel and Horswill, 2009). interaction(Mayvilleetal.,1999;Lyonetal.,2000;Wrightetal., Interestingly, despite their strong inhibitory activity toward 2004;Tal-Ganetal.,2013a).Accordingly,weanalyzedsequence S. aureus agr, neither S. schleiferi nor Staphylococcus delphini homology of AIPs from a selection of staphylococci for which AIP contain an alanine residue, which has been reported to supernatantactivityrangedfromnoeffecttosevereinhibitionof play a role in non-native AIP-AgrC binding antagonism (Lyon S.aureusagr(Figure7A).AlignmentofAIPsequencesbetween et al., 2000; Tal-Gan et al., 2013a). Inferred relationships of differentstaphylococcalspeciesrevealedlessthan30–40%amino the various AIPs revealed that they clustered according to acidconservation.Withinthesamespecies,theAIPswerehighly species and for the most part also according to AIP group conserved;aphenomenonthathasalsobeenobservedforalready (Figure7B).Thedifferencesinaminoacidconservationandthe reported staphylococcal AIP sequences (Dufour et al., 2002; difficultiesinlocatingspecificaminoacidsequencesresponsible Thoendel and Horswill, 2009). For our sequenced S. schleiferi for non-cognate AIP-AgrC interactions, highlights that spatial AIPs there was 100% conservation and we noted that the most arrangement and secondary structure of the AIPs play an highly conserved amino acids between species were those with importantroleintheinteractionsbetweenthenon-cognateAIPs specific properties needed for correct interaction or folding of andtheS.aureusAgr-C(Mayvilleetal.,1999;Lyonetal.,2000; AIP. For example, the C-terminal amino acid of most of the Wright et al., 2004). We speculate, that AgrC is promiscuous ascertained AIP sequences is tyrosine or phenylalanine which in terms of susceptibility to AIP inhibitory structures and provides the hydrophobicity essential for binding of the AIP this promiscuity allows inhibition by multiple staphylococcal to a putative hydrophobic pocket in the AgrC receptor, but species. FrontiersinMicrobiology|www.frontiersin.org 9 November2016|Volume7|Article1733 fmicb-07-01733 October5,2017 Time:15:56 #10 Canovasetal. StaphylococcalSpeciesCross-Talkviatheagr FIGURE7|agrDhomologyofselectedStaphylococci.IsolateswereanalyzedforagrDhomologybyIlluminasequencing;(A)TableshowingAIP-alignment.The AIPregionishighlightedinred.S.I.G.:StaphylococcusintermediusGroup;S.A.G.:S.aureusGroup;Strains8325-4,RN6607,MOZ53,andRN4580wereincluded asS.aureusAIPsequencereferences.(B)PhylogeneticanalysisbasedonaMusclealignmentoftheAIPsequenceswithmidpointrooting.Scalebarindicate substitutionspersite. DISCUSSION withS.aureusagr,buteveninfluencevirulenceandcolonization capabilities of S. aureus when forced to share a niche, as was Thisstudylooksattheecologicalaspectsofregulatorycross-talk shownintheco-infectionofG.mellonellawithS.schleiferiand andnichesharingbetweenstaphylococciasmediatedviatheagr S. aureus. Cross-communication involving agr interference has quorumsensingsystem,anddelvesintothepossibleeffectsthis previouslybeenobservedasaresultofco-habitualcompetition cross-talkmayhaveonaspectsofvirulenceandcolonizationfor within the same ecological niche, and we speculate that this thehumanpathogenStaphylococcusaureus. also is a reason for the observed interference in our study. Cell to cell communication via quorum sensing is very A few known examples are the interactions between S. aureus common amongst bacteria and promotes both inter and intra- and S. epidermidis on human skin and between S. aureus and species interactions (LaSarre and Federle, 2013). The agr QS Pseudomonasaeruginosainthelungsofpatientssufferingfrom system of S. aureus is especially sensitive to pheromones cystic fibrosis (Otto et al., 2001; Qazi et al., 2006). In the first produced by S. aureus strains of other agr groups (Thoendel example,S.epidermidisAIPpheromoneiscapableofinhibiting andHorswill,2009;Thoendeletal.,2011)orproducedbyother agr activity of S. aureus groups I, II and III, but not that of staphyloccocalspecies,namelyS.epidermidis(Ottoetal.,2001), group IV, which interestingly is the only S. aureus AIP capable and has even displayed sensitivity to compounds produced by of inhibiting S. epidermidis agr activity. It has been suggested other microorganisms of unrelated niche environments such as that this cross-talk is one of the reasons why S. epidermidis the marine Photobacterium halotolerans-derived QS inhibitor predominatesoverS.aureusonhumanskin(Ottoetal.,2001). solonamide B (Nielsen et al., 2010, 2014). Despite this well- Inthesecondexample,thecross-talkbetweenP.aeruginosaand documentedagrcross-inhibitionbetweenthedifferentS.aureus S.aureusisacaseofcross-communicationbetweentwounrelated agr groups and between S. aureus and other staphylococcal microorganisms. It has been shown that N-acylhomoserine species,weaimedtoexplorefurtherthecommunicationbetween lactone 3-oxo-C -HSL produced by Pseudomonas is capable 12 S. aureus and staphylococci with little niche overlap, and what of inhibiting S. aureus growth, and that this compound at repercussions this communication might have in terms of sub-inhibitory concentrations interferes with S. aureus agr and virulence adaptation. While our findings corroborate those of sarA expression in a manner involving cytoplasmic membrane others with regards to staphylococcal cross-talk via agr (Otto saturation (Qazi et al., 2006). In cystic fibrosis patients, the et al., 2001; Lina et al., 2003; Thoendel et al., 2011), we interaction between them in addition to host factors tends to alsoshowextensiveAIP-mediatedcross-talkbetweenpreviously favor the predominance of S. aureus colonization in young untestedstaphylococciandS.aureus,with82%ofthepreviously patientsandP.aeruginosainadultpatients,thoughco-isolation untested staphylococci exerting ability to interfere with agr of of both organisms is still found in 50% of adult CF patients S.aureus.Importantly,weshowthatstaphylococcifromvarying (Qazi et al., 2006). The co-existence of these two organisms environmental niches not only have the capacity to interfere in CF patients suggests an evolutionary role of cross-talk on FrontiersinMicrobiology|www.frontiersin.org 10 November2016|Volume7|Article1733

Description:
S. aureus virulence is controlled by the agr quorum sensing system responding to . template generating plasmid pRAB12-agrBDSs. This construct.
See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.