Coupling dTTP Hydrolysis with DNA Unwinding by the DNA Helicase of Bacteriophage T7

31 Pages·2011·1.24 MB·English

JBC Papers in Press. Published on August 12, 2011 as Manuscript M111.283796
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M111.283796
Coupling dTTP Hydrolysis with DNA Unwinding by the DNA Helicase of Bacteriophage
T7
Ajit K. Satapathy, Arkadiusz W. Kulczyk, Sharmistha Ghosh, and Charles C. Richardson
From the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School,
Boston, Massachusetts 02115
Running head: DNA unwinding by T7 helicase
Address correspondence to: Charles C. Richardson, Department of Biological Chemistry and Molecular
Pharmacology, Harvard Medical School, 240 Longwood Ave. Boston, MA 02115. Tel.: [phone];
Fax: [phone]. E-mail: [email protected]

The DNA helicase encoded by gene 4 of reconstituted in vitro by gene 5 protein (DNA
bacteriophage T7 assembles on single-stranded polymerase), Escherichia coli thioredoxin
DNA as a hexamer of six identical subunits with (processivity factor), gene 2.5 protein (ssDNA-
the DNA passing through the center of the binding protein), and gene 4 protein (DNA
toroid. The helicase couples the hydrolysis of helicase and DNA primase) (1, 2). The primase
dTTP to unidirectional translocation on single- and helicase activities of gene 4 protein (gp4)
stranded DNA and the unwinding of duplex reside in the N-terminal and C-terminal parts of D
o
w
DNA. Phe523, positioned in a β-hairpin loop at the polypeptide, respectively (3). T7 DNA n
lo
the subunit interface, plays a key role in primase derives several benefits from its physical a
d
e
cuonuwpilnindgin gt.h e hRydeprolalycesims enotf odfT TPPh e5t2o3 DwNitAh ains socoitahtieorn wreitphl icthaeti ohne licsaysest, eamns ,a ssorecqiautiiroens thaatn, d from
h
alanine or valine abolishes the ability of the association of the separately encoded proteins (2- ttp
helicase to unwind DNA or to allow T7 4). The helicase domain of gp4 places it within ://w
w
polymerase to mediate strand-displacement the SF4 family of helicases (5). Like other w
synthesis on duplex DNA. In vivo members of this family, gp4 assembles onto .jb
c
.o
complementation studies reveal a requirement ssDNA as a hexamer, an oligomerization that is rg
for a hydrophobic residue with long side chains facilitated by the binding of dTTP (6, 7). On by/
g
at this position. In a crystal structure of T7 ssDNA, the protein then translocates u
e
s
helicase, when a nucleotide is bound at a unidirectionally 5’ to 3’ by using the energy of t o
n
subunit interface, Phe523 is buried within the hydrolysis of dTTP (8). Upon encountering A
p
interface. However, in the unbound state, it is duplex DNA, gp4 will unwind the DNA. ril 1
more exposed on the outer surface of the The crystal structure of the hexameric gp4 1, 2
0
helicase. This structural difference suggests reveals a 6-fold symmetric ring with a central core 1
9
that the β-hairpin bearing the Phe523 may of 25-30 Ǻ (Fig. 1A) (9). Electron microscopy
undergo a conformational change during and biochemical studies provide strong evidence
nucleotide hydrolysis. We postulate that upon that ssDNA threads through the central core of the
hydrolysis of dTTP, Phe523 moves from within helicase, and it has been proposed that ssDNA
the subunit interface to a more exposed position transfers from one subunit to the adjacent subunit
where it contacts the displaced complementary sequentially as dTTP is hydrolyzed in the inter
strand and facilitates unwinding. subunit interfaces (6, 9, 10). Recent studies have
DNA replication requires the transient also provided information on the mechanism by
unwinding of duplex DNA to enable the DNA which the energy of hydrolysis of a nucleoside
polymerase to have access to a single-stranded triphosphate is coupled to the unidirectional
DNA (ssDNA) template for base pairing during translocation of the gene 4 helicase and unwinding
DNA synthesis. A class of enzymes termed DNA of duplex DNA (10-14). Unlike other DNA
helicases mediate this unwinding of DNA by helicases of this family, T7 DNA helicase
coupling the energy of hydrolysis of a nucleoside preferentially uses dTTP for translocation and
triphosphate to conformational changes in the DNA unwinding (15, 16).
protein for unidirectional movement along DNA. In order for T7 DNA helicase to initiate
The replisome of bacteriophage T7 can be unwinding of a duplex DNA molecule it requires a
1
Copyright 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
preformed fork bearing a 5’-single-stranded tail of amino acids and examined the ability of these
greater than 17 nucleotides and a 3’-tail of at least altered helicases to support T7 growth. We also
7 nucleotides (16, 17). Gp4 assembles on the 5’- determined the biochemical properties of these
ssDNA tail and the 3’-tail prevents duplex DNA helicases in isolation or in association with T7
from entering the central core (18). A report on DNA polymerase. Our results show that Phe523
Escherichia coli DnaB helicase provides evidence plays a crucial role in coupling NTP hydrolysis
that the 3’ arm plays a role analogous to a with DNA unwinding by stabilizing the excluded
mechanical fulcrum for the hexameric helicase strand by hydrophobic interactions.
bound to the 5’ arm, necessary to provide
mechanical support for the advancing helicase on EXPERIMENTAL PROCEDURES
the opposite strand of the DNA (19). However,
the interaction site of the helicase, if any, during Materials
unwinding of DNA with the excluded strand is not E. coli C600, E. coli HMS174 (DE3) and
known. The crystal structures of T7 DNA helicase pET11b were from Novagen. Wild-type and gene
are in the absence of DNA so it is not known if the 4 deficient T7 phage (T7 4) were from the
assembly of gp4 on duplex DNA differs from that laboratory collection. Oligonucleotides were from
on ssDNA. Mechanistically, the interaction of the Integrated DNA Technologies. M13 ssDNA and
helicase with the two strands of duplex DNA T4 polynucleotide kinase were from New England D
o
during unwinding is important for differentiating Biolabs. The site-directed mutagenesis kit was w
n
between whether the helicase destabilizes duplex from Stratagene. All chemicals and reagents were loa
d
DNA (active helicase) or opportunistically from Sigma unless otherwise specified. ed
translocates onto thermally open DNA (passive from
helicase). In earlier studies, a random mutagenesis Methods http
of gene 4 revealed residues (Ser345 and Gly451 in Phage complementation assays- E. coli C600 ://w
the helicase domain) to be important for DNA cells transformed with a plasmid that expresses w
w
unwinding (20). Arg522 (the arginine finger) and gene 4 under a T7 promoter were grown to an .jb
c
Lys467 (central β-hairpin) mutations also lead to a OD600 of 1. Serially diluted T7 phage stocks were .org
loss of DNA unwinding (21, 22). It is interesting mixed with an aliquot of the E. coli culture in b/
y
to note that each of these amino acid residues 0.7% soft agar and poured onto LB plates with gu
e
resides at the subunit interface of the hexameric appropriate antibiotics. After incubation for 4-6 h st o
n
gp4 and all of the mutants retain the ability to at 37 ºC, the number of plaques that appeared was A
p
hydrolyze dTTP (Supplementary Figure S1). counted. The number of plaques formed by ril 1
From examination of the crystal structure of plasmids harboring wild-type gp4 is normalized to 1, 2
gp4, we have identified a β-hairpin located at the 1. The relative efficiency of plating (E.O.P) 01
9
subunit interface that includes residues 522 obtained with the altered gene 4 constructs was
through 530 (Fig. 1). The β-hairpin starts with the determined by the number of plaques (PFU)
arginine finger (Arg522) followed by Phe523 and formed by the mutated gene 4 constructs divided
eight other residues (Thr524-Gly-Asp-Thr-Gly- by the PFU of wild type gene 4.
Ile-Ala530). This β-hairpin adopts different Mutagenesis, over-expression, and purification
orientations depending upon the availability of of gene 4 proteins- Plasmid pET11gp4-63 was
nucleotide in the nucleotide binding site at the used for expression and over production of wild-
subunit interface. In the presence of a nucleotide, type gp4 (23). The plasmid was also used to
Phe523 is buried within the subunit interface, and create point mutations by using the Quick change
Arg522 contacts the gamma-phosphate of the II Mutagenesis kit (Stratagene) in accordance with
nucleotide (Fig. 1B). However, in the absence of a the manufacturer’s instructions. The sequences of
nucleotide, the β-hairpin undergoes a primers used to construct various single mutations
conformational change such that Arg522 makes a are available on request. Mutations were
hydrogen bridge with Glu348 from the adjacent confirmed by DNA sequencing. Constructs
sub-unit and Phe523 is more exposed towards the harboring wild-type or mutated gene 4 were
exterior surface of gp4 (Fig. 1C). In the present transferred to E. coli strain HMS-174 (DE3) for
study, we substituted Phe523 with a variety of over production of the corresponding proteins.
2
Wild-type and altered gene 4 proteins were CCG AGC TCG AAT TCA CTG GCC GTC GTT
purified as described earlier (10). The purified TTA CAA CGT CGT GAC ATG CCT -3’) with
19
proteins are >95% pure as judged by Coomassie an unlabeled 95-mer oligo (5’- T GGC ATG
39
staining of the proteins on a polyacrylamide gel TCA CGA CGT TGT AAA ACG ACG GCC
(Supplemental Fig. S2). AGT GAA TTC GAG CTC GGT ACC CGG CG-
dTTP hydrolysis assays- dTTP hydrolysis 3’). Reaction mixtures (20 l) containing 100 nM
assays were carried out at 37 ºC in a reaction labeled DNA substrate, 50 nM gp4, 40 mM Tris-
mixture containing 40 mM Tris-HCl (pH 7.5), 10 HCl (pH 7.5), 10 mM MgCl , 10 mM DTT, 50
2
mM MgCl , 10 mM DTT, 50 mM potassium mM potassium glutamate, and 1 mM dTTP, were
2
glutamate, 100 nM gp4, 5 nM M13 ssDNA and incubated at 37ºC for up to 10 min. The reactions
the indicated concentration of [ -32P] dTTP (22). were stopped by the addition of 0.4% (w/v) SDS,
After incubation for 30 min at 37 ºC, EDTA was 40 mM EDTA, 8% (v/v) glycerol and 0.1% (w/v)
added to a final concentration of 25 mM to stop bromophenol blue to the final concentrations.
the reaction and then the reaction sample was kept Single stranded oligonucleotides were separated
on ice. The product of hydrolysis [ -32P] dNDP from the duplex substrate in a 10% non-denaturing
was separated from [ -32P] dNTP on polyacrylamide gel. Image intensities were
polyethyleneimine coated TLC plates using 0.5 M quantified using Image gauge and Graphad prism
formic acid and 0.5 M lithium chloride. The TLC software. D
o
plates were scanned in a phosphor imager (FUJI) Protein oligomerization assay- Gp4s were wn
and the intensity of the spots was measured using examined for their ability to oligomerize in the loa
d
e
Ifmurathgeer aqnuaalnytz edso uftswinagr eG r(aFpUhaJdI) .P r isTmh seo fdtwataar ew. as pmreetsheynlceen eo fd aT nToPn)-.h yTdhroel yrezaacbtlieo nd TmTiPx taunraeslo (g1 (5 , l)- d from
h
DNA binding assays-A nitrocellulose filter- containing 2µM (monomer) gp4, 40 mM Tris-HCl ttp
binding assay was used for measuring the ability (pH 7.5), 10 mM MgCl2, 10 mM DTT, 50 mM ://w
w
of gp4 to bind to ssDNA or duplex DNA. potassium glutamate, 0.01 to 1 mM , - w
Reaction mixtures (20 l) containing either 1 nM methylene dTTP and 1 M 50-mer ssDNA were .jbc
G5’G- C32 PA TlaGbe lTedC A9 5C-mGeAr oCliGgoTn uTcGleTo tiAdeA A(5 ’-A CTG39 winecrueb asttoedp pfeodr b2y0 tmhein audtedsi taiot n3 7o f Cgl.u tTarhaeld reehaycdtieo ntos by.org/
g
ACG GCC AGT GAA TTC GAG CTC GGT 0.033% v/v. The reaction sample was kept at 37 ue
s
ACC CGG CG-3’) or 1 nM of the 5’- 32P labeled C for another 5 min, and the reaction products t on
95-mer oligonucleotide partially annealed to a 75- were analyzed on a non-denaturing 10% Ap
mer oligonucleotide (5’-CGC CGG GTA CCG polyacrylamide gel using a running buffer of ril 1
1
AGC TCG AAT TCA CTG GCC GTC GTT TTA 0.25X TBE. After staining with Coomassie blue, , 2
0
CAA CGT CGT GAC ATG CCT19 -3’). These the oligomerization status of gp4 was determined 19
DNAs were incubated with different by gel analysis as described (24). The mobility of
concentrations (25-250 nM) of gp4 in 40 mM Tris- hexamers and heptamers were distinguished as
HCl (pH 7.5), 10 mM MgCl2, 10 mM DTT, 50 described earlier (25). The density of protein
mM potassium glutamate, and 1 mM , - bands corresponding to monomers and higher
methylene dTTP at 37 ºC for 30 minutes. The order oligomers in each lane were measured by the
reaction mixtures were filtered through two layers software AlphaEase FC (AlphaImager 3400). The
of membranes, a nitrocellulose membrane fraction of hexamers formed from monomers was
(0.45 M) laid above a Zeta-Probe (Bio-Rad) determined by the density of hexamers and higher
membrane. After washing with the buffer three order oligomers divided by the total density of
times, protein–DNA complex bound to the protein bands in the corresponding lane as
nitrocellulose membrane and free DNA bound to described earlier (26, 27). The fraction of
the Zeta-Probe membrane were measured with a hexamers formed was plotted against the
Fuji/BAS 1000 Bio imaging analyser. concentration of , - methylene dTTP and
DNA unwinding assays-The substrate for DNA obtained the apparent dissociation constant (K )
D
unwinding assays was prepared by annealing a 5’- for hexamer formation (26, 27).
32P end-labeled 75-mer oligo (5’-CGC CGG GTA
3
Strand displacement DNA synthesis assays- with replication buffer with dNTPs and DTT.
M13 circular dsDNA having a 5’ tail was used to Finally, DNA synthesis was initiated by
introducing replication buffer with dNTPs, DTT,
monitor strand displacement DNA synthesis. A
and 10 mM MgCl . After particle tracking, traces
replication fork was constructed by annealing M13 2
were corrected for residual instabilities in the flow
ssDNA to an olginucleotide (5’-
by subtracting traces corresponding to tethers that
T AATTCGTAATCATGGTCATAGCTGTTTC
36 were not enzymatically altered. Bead
CT-3’) having 30 bases complementary to the displacements were converted into numbers of
M13 ssDNA and 36 bases forming a 5’-tail. Then nucleotides synthesized using the known length
gp5/trx was used to convert the ssDNA circle to difference between ssDNA and dsDNA at our
experimental conditions (29).
dsDNA circle. Phenol/chloroform was used to
Physical interaction of proteins- Protein
remove gp5/trx. Strand-displacement synthesis
interactions were measured using surface plasmon
assay was carried out at 37ºC in a 30 l reaction
resonance (SPR). SPR was performed using a
mixture containing 40 mM Tris-HCl (pH 7.5), 10 Biacore 3000 instrument. Wild-type or altered
mM MgCl , 10 mM DTT, 50 mM potassium gp4 were immobilized (3000 response units (RU))
2
glutamate, 10 nM gp5/trx, 20 nM wild-type or on a CM-5 (carboxymethyl-5) chip using
altered gp4 (hexamer), 500 M each of dATP, [α- EDC/NHS chemistry. Immobilization was Do
performed in 10 mM sodium acetate, pH 5.0, at a w
32P] dTTP (10 Ci/mmol), dCTP, and dGTP, and 10 flow rate of 10 μl/min. Binding studies were nloa
nM M13 double-stranded DNA. After incubation performed in 20 mM HEPES (pH 7.5), 10 mM ded
of the reactions up to 30 minutes, the reaction was MgCl , 250 mM potassium glutamate, 5 mM DTT, fro
2 m
stopped with EDTA at a final concentration of 25 at a flow rate of 40 μl/min (30). The chip surface h
ttp
mM and then the mixture was spotted onto a DE was regenerated using 1M NaCl at a flow rate ://w
of100 μl/min. As a control, a flow cell was w
81 filter paper. After washing 3-times with 0.3 M w
activated and blocked in absence of protein to .jb
ammonium formate and 100% ethanol, c
incorporated [32P]dTMP was measured in a liquid aGcpc5o/utrnxt (f0o.r1 cthoa n3geMs )i nw tahse f lbouwlke dr eofvraecr titvhee binoduenxd. b.org/
y
scintillating counter (28). gp4 as shown in the Fig. 7A. Apparent binding gu
e
s
constants were calculated under steady-state t o
Single-molecule analysis- Phage λ DNA n
conditions and the data fitted using BIAEVAL A
mattoalcehceudle sw itcho nthtaei neinndg ofa onreep slitcraantido nt o ftohrek glaarses 3.0.2 software (Biacore). pril 1
surface of a flow cell via biotin-SA link and with p r e Tseon ceex amofi nep rtihmee br/itnedminpgla otef ,g pb5io/ttrixn ytola tgepd4 iDn NthAe 1, 201
the other end to a 2.8 μm paramagnetic bead 9
was coupled to a streptavidin-coated chip as
(Dynal) via digoxigenin-anti-digoxigenin as
previously described (see Fig. 7B). A template
described previously (29, 30). To prevent
strand was used with a biotin group attached to 3’-
nonspecific interactions between the beads and the
end, and an annealed primer (30). The template
surface, a 3 pN magnetic force was applied
DNA was coupled at a concentration of 0.25μM in
upward by positioning a permanent magnet above
HBS-EP buffer (10mM Hepes (pH 7.4), 150mM
the flow cell. Beads were imaged with a CCD
NaCl, and 0.005% (v/v) Tween-20) at a flow rate
camera with a time resolution of 500 ms, and the
of 10μl/min. Binding studies of gp5/trx were
centers of their positions for every acquisition time
performed in 20mM Hepes (pH 7.4), 5mM
point were determined by particle-tracking
MgCl2, 2.5mM DTT, 200mM potassium
software. Bead-bound and surface-tethered DNA
glutamate, and 1% (w/v) glycerol at a flow rate of
were pre-incubated with 100 nM T7 gp5/trx and
10μl/min. gp5/trx was injected at a concentration
50 nM T7 gp4 (wild-type gp4, gp4-F523H or gp4-
of 0.2 M in a flow buffer containing 1 mM dGTP
F523V) in replication buffer (40 mM Tris 7.5, 50
and 10 M ddATP: a saturating 1:1 binding
mM potassium glutamate, 2 mM EDTA, 0.1
condition between gp5/trx and primer-template.
mg∕mL BSA) with 600 μM each dNTP and 10 mM
Gp4 was injected over the chip in the above buffer
DTT for 15 min. Next, the flow cell was washed
containing 0.1mM ATP and 2mM dGTP. A flow
4
cell blocked with biotin was used as a control to 1.mM-1). In the absence of ssDNA gp4 hydrolyzes
measure nonspecific interaction and bulk dTTP at a significantly slower rate (10) and this
refractive index of the sample buffer containing observation also is true for the altered proteins
gp4. The chip surface was stripped of bound (Table 2). All of the proteins have significant
proteins by sequential injections of 150μl 1M activity in the absence of ssDNA although there is
NaCl at a flow rate of 100μl/min. a considerable variation in the ability of the altered
gp4 to hydrolyze dTTP. Altogether, results show
RESULTS that Phe523 altered proteins retained dTTP
hydrolysis activity.
Phe523 is required for T7 phage growth- The Further, we have measured the effect of ssDNA
effect of the genetically altered gene 4 proteins on concentration on DNA-dependent dTTP
the growth of T7 phage was examined (Table 1). hydrolysis (Fig. 2B and Table 2). All of the
T7 4 phage, lacking gene 4, are dependent on the altered gp4 (except gp4-F523A and gp4-F523V)
expression of plasmid encoded gene 4 protein for bind M13 ssDNA with a K of 0.1 -0.3 nM, a
D
viability (31). To ascertain the role of Phe523, value comparable to that observed with wild type
gene 4 mutants were constructed in which Phe523 gp4 (K = 0.1nM). Gp4-F523A and Gp4-F523V
D
was replaced with alanine (gp4-523A), valine bind M13 ssDNA relatively less tightly than does
(gp4-523V), isoleucine (gp4-523I), leucine (gp4- wild type gp4 with a KD of 0.5 and 0.9 nM Do
523L), histidine (gp4-523H), or tyrosine (gp4- respectively. This weaker binding affinity could w
n
523Y). Plasmids encoding gp4-F523I, gp4- account for the lower rate of dTTP hydrolysis loa
d
F523L, gp4-F523H, and gp4-F523Y activity by gp4-F523A and gp4-F523V. However, ed
complemented the growth of T7 4 with similar the lower rate of dTTP hydrolysis catalyzed by from
levels of efficiency of plating as wild-type gp4 gp4-F523H cannot be explained in this http
(Table 1). In contrast, gp4-F523A and gp4-F523V experiment. ://w
did not support the growth of T7 4 phage. Wild- Role of Phe523 in DNA unwinding- Upon ww
type T7 phage grow normally in the presence of binding of dTTP, Phe523 in the β-hairpin is .jb
c
these altered helicases. located in the NTP binding site. In the empty state .org
Role of Phe523 in ssDNA-dependent dTTP Phe523 is oriented towards the outer surface of the by/
hydrolysis- The proteins coded by Phe523 altered helicase (Fig. 1). This reorientation suggests a gu
e
constructs were overproduced, purified, and role for Phe523 in helicase activity. Initially, the st o
n
characterized biochemically. To determine altered proteins were compared with wild-type gp4 A
p
whether Phe523 plays a role in DNA-dependent for their ability to unwind dsDNA with a ril 1
hydrolysis of dTTP, we measured dTTP replication fork at one end. Wild-type gp4 will 1, 2
hydrolysis activity of the gene 4 proteins in the initiate unwinding on a duplex DNA molecule 01
9
presence of M13 ssDNA (Fig. 2). All of the provided a preformed replication fork is present at
altered proteins had DNA-dependent dTTP one end of the DNA. The preformed fork consists
hydrolysis activity albeit with reduced efficiency. of a 5’-single-stranded tail of 39-nucleotides and a
The kinetic parameters of these assays are 3’-single-stranded tail of 19-nucleotides (Figure
presented in Table 2. Gp4-F523A, gp4-F523V 3A). On this DNA gp4 can assemble on the 5’-tail
and gp4-F523H exhibited about 20-30% of dTTP and initiate unwinding whereas it cannot on a
hydrolysis activity. However, only gp4-F523H DNA molecule having only a 3’ or a 5’-tail or a
blunt end (Fig. 3A). In this assay one strand of the
complemented the growth of T7 4 phage. Gp4-
duplex is labeled at its 5’-terminus with 32P which
F523I, gp4-F523L and gp4-F523Y exhibited 60-
is released as ssDNA in unwinding by the
70% of dTTP hydrolysis activity as compared to
helicase. Duplex and ssDNA can be identified by
that of wild type gp4 and all of them
electrophoresis through non-denaturing
complemented gene 4 function in vivo. Despite the
polyacrylamide gels (Fig. 3B). Using the DNA
differences in maximal rate of dTTP hydrolysis
molecule with the preformed replication fork we
activity among the Phe523 altered helicases, the
find that gp4-F523A, and gp4-F523V does not
calculated k / K values for each of these proteins
cat m
are comparable with the wild type gp4 (7.6 s- catalyze unwinding of the DNA. Interestingly, in
spite of the reduced levels (~30%) of dTTP
5
hydrolysis, gp4-F523H exhibited the highest level activity. Histidine or tyrosine can also replace
of unwinding activity (~70%) among all the Phe523 with no significant defect in binding to
Phe523 altered proteins. Gp4-F523I, gp4-F523L, ssDNA or to the fork on dsDNA. Again these
and gp4-F523Y can unwind the DNA but not as proteins show only a marginal loss in unwinding
efficiently as does wild-type gp4. While Gp4- activity.
F523I retains 30% of the activity of wild-type gp4, Oligomerization of gp4- The functional form of T7
gp4-F523L and gp4-F523Y retain up to 50%, as DNA helicase is a hexamer. Although gp4 is
calculated from the exponential phase of the found in the form of hexamers and heptamers in
reactions. These results demonstrate that small solution only hexamers are found bind to DNA
residues like alanine and valine cannot substitute (25). Nucleotides play an essential role in the
for phenyalanine. However, hydrophobic residues formation of stable hexamers. Wild-type gp4
with a longer side chains like leucine and monomers or dimers convert to the hexamer
isoleucine can partially substitute and amino acids species in the presence of dTTP (26). At saturated
with aromatic side chains such as tyrosine and concentrations of β, methylene dTTP and
histidine approach the efficiency of phenylalanine ssDNA, wild-type gp4 and altered gp4s do not
for unwinding activity. Gp4-F523A and Gp4- show any significant difference in forming
F523V did not exhibit DNA unwinding activity hexamers even at low concentrations of protein
even at higher protein concentrations (2 M) (Supplementary Fig. S5). Further, the ability of D
o
(Supplemenatary Fig. S3). It is clear from these the altered gp4 to oligomerize was measured on a w
n
results that Phe523 is important in DNA 50-mer oligonucleotide in the presence of various loa
d
e
unwinding by T7 DNA helicase. concentration of β, γ methylene dTTP (0.01 to d
Binding of gp4 to ssDNA and at a fork on 1mM) (Fig.4A). The results from this ligand- from
duplex DNA- Gp4-F523A and gp4-F523V are dependent oligomeric assay show that gp4-F523A http
completely defective and gp4-F523I is partially and gp4-F523V are relatively defective in forming ://w
defective in unwinding duplex DNA although the hexamers at lower concentration of β, γ methylene w
w
later protein retains considerable level of dTTP dTTP (Fig. 4A & B). The apparent K values in .jb
D c
hydrolysis activity. One explanation for the defect terms of concentration of β, γ methylene dTTP for .org
in unwinding of duplex DNA is an altered hexamer formation by gp4-F523A and gp4-F523V b/
y
interaction of the phenylalanine substituted gp4 are 8.4 and 6.3 M respectively, as compared to gu
e
s
with the DNA at the fork to which it binds. We that of wild type KD value (1.2 M) (27). GP4- t on
have measured the affinity of wild-type gp4 and F523I exhibits a K of 3.5 M for hexamer A
D p
the variant gp4s to both ssDNA and duplex DNA formation. However, gp4-F523L, gp4-F523H and ril 1
bearing a fork (Table 3). Wild-type helicase binds gp4-F523Y exhibit a comparable KD values with 1, 2
ssDNA and dsDNA with KD of 16 and 9 nM wild type gp4 to form hexamers and higher order 019
respectively. Gp4-F523A binds ssDNA and oligomers (Fig. 4C). Despite showing defects for
dsDNA with the KD value calculated to be ~15 fold forming hexamers at lower nucleotide
higher than wild type gp4. Gp4-F523V and gp4- concentrations, all the Phe523 altered helicases
F523I bind to ssDNA ~4-6 fold weaker than wild including gp4-F523A and gp4-F523V, form more
type gp4. In similar experiments Gp4-F523V and than 90% hexamers at 1mM β, γ methylene dTTP.
gp4-F523I shown to have higher KD for dsDNA; At this concentration of dTTP, gp4-F523A and
~16 and 8 fold higher than wild type protein. gp4-F523V did not exhibit any DNA unwinding
Gp4-F523L, gp4-F523H, and gp4-F523Y did not activity; however, other Phe523 altered helicases
exhibit any significant differences in binding exhibit unwinding activity perhaps based on the
ssDNA or dsDNA as compared to wild type gp4 length or size of side chain of the amino acid
(Table 3). These results show that valine can replaced for phenylalanine. Thus, the severe
substitute for phenylalanine for binding ssDNA defects in DNA unwinding by gp4-F523A and
but not for binding at a fork on dsDNA. The gp4-F523V cannot be attributed solely to the
increase in the size of the functional group from differences in the ability of these proteins to form
valine to isoleucine or leucine increases the hexamers or higher order oligomers.
affinity of the protein to bind the fork on dsDNA,
an increase that parallels with their unwinding
6
Strand displacement DNA synthesis mediated dTTPase activity parallel to its unwinding rate in
by gp4 and T7 DNA polymerase (gp5/trx) - T7 conjunction with gp5/trx at the replication fork
gene 5 protein functions in vivo in a 1 to 1 progression (Fig. 5B).
complex with its processivity factor, E. coli Single-molecule analysis of strand
thioredoxin. This gene 5 polymerase/thioredoxin displacement synthesis mediated by gp4 and T7
(gp5/trx) complex catalyzes processive DNA gp5/trx- Gp4-F523H complements for T7 4 phage
synthesis on ssDNA templates but is unable to growth and the purified protein mediates leading
catalyze strand-displacement DNA synthesis on strand synthesis in association with T7 gp5/trx.
duplex DNA (32, 33). However, in the presence However, gp4-F523H has only 30% of the DNA
of T7 DNA helicase, T7 gp5/trx mediates dependent dTTP hydrolysis activity but exhibit
extensive strand-displacement DNA synthesis, a 75% of the strand displacement activity as
process that mimics leading-strand DNA synthesis compared to that of wild-type helicase. On the
at a replication fork (34, 35). The ability of the other hand gp4-F523A and gp4-F523V also retains
altered helicases to support strand-displacement a considerable level of dTTP hydrolysis activity
synthesis with gp5/trx was measured using circular (20%), but are significantly defective in DNA
M13 dsDNA bearing a 5’-ssDNA tail onto which unwinding and strand displacement synthesis
gp4 can assemble. As anticipated, wild-type gp4 activity. Earlier we found that gp4-K467A, an
enables gp5/trx to mediate strand-displacement altered gp4 with an alanine substituted a lysine in D
o
synthesis (Fig. 5A). Gp4-F523I, gp4-F523L and the central β-hairpin, has 15% of the wild-type w
n
gp4-F523Y support strand displacement DNA rates of dTTP hydrolysis activity but no significant loa
d
synthesis, albeit at a reduced rate (~45-55% as unwinding activity (22). However, gp4-K467A ed
compared to wild-type gp4) (Fig. 5A). Gp4- complements for gp4 function in vivo. By using from
F523H retains approximately 75% of the wild type single-molecule techniques we showed that gp4- http
activity. Gp4-F523A and gp4-F523V, devoid of K467A can support T7 DNA polymerase for ://w
unwinding activity, do not support strand leading strand synthesis at a rate comparable to w
w
displacement synthesis. that observed with wild-type gp4. In the present .jb
c
The dTTP hydrolysis activity that study, we have examined the wild-type gp4 and .org
accompanies DNA unwinding and strand- the altered proteins: gp4-F523H and gp4-F523V b/
y
displacement synthesis in these reactions was also for T7 gp5/trx mediated leading strand synthesis. gu
e
measured (Fig. 5B). As a control dTTP hydrolysis Single-molecule analysis of strand st o
n
was also measured during translocation of gp4 on displacement synthesis was carried out as A
p
M13 ssDNA in the presence of gp5/trx (Fig. 5C). previously described (22, 29) and is shown ril 1
Not surprising in view of their inability to mediate schematically in Fig. 6A. Bacteriophage duplex 1, 2
strand-displacement synthesis with gp5/trx, neither DNA (48.5 kb) containing a replication fork is 01
9
gp4-F523A nor gp4-F523V hydrolyzes dTTP on attached to a glass flow cell via the 5’-end of one
M13 dsDNA (Fig.5B). However, as shown in Fig. strand whose 3’-end is linked to a 2.8 m-sized
2 they do hydrolyze dTTP on ssDNA at ~25% that bead. A constant laminar flow is applied such that
observed with wild-type gp4; the presence of the resultant drag on the bead stretches the DNA
gp5/trx does not have any effect in these reactions molecule with a force of 3 pN. At this force the
(Fig. 5C). Gp4-F523Y hydrolyzes dTTP at a elasticity of the DNA is determined by entropic
faster rate than wild type gp4 on M13 ssDNA, but contributions and thus does not influence protein
retains only 50% of the rate of wild type activity interactions with DNA (29). The ssDNA, due to
on M13 dsDNA. The results suggest that the coiling, is shorter than dsDNA at low stretching
dTTP hydrolysis activity on M13 ssDNA depends forces (<6 pN). Consequently, the conversion of
only on the translocation activity of the protein. dsDNA to ssDNA as a result of leading-strand
However, dTTP hydrolysis in the presence of M13 synthesis can be monitored through a decrease in
dsDNA accompanies unwinding in conjunction length of DNA. The change in lengths of
with T7 gp5/trx. Therefore gp4-F523A and gp4- individual DNA molecules is measured by
F523V retains the ability to translocate on ssDNA, imaging the beads and tracking their positions.
however, are defective in unwind dsDNA. The In the present experiment the bound DNA was
experiments also show that gp4-F523H exhibit pre-incubated with T7 DNA
7
polymerase/thioredoxin (gp5/trx) and T7 gp4 with in a template position. This procedure essentially
the four dNTPs but in the absence of Mg2+ for 15 locks the polymerase into a polymerizing mode
minutes. The flow cell was then washed with 3 (30). Then gp4 is flowed over the polymerase,
flow cell volumes of buffer containing the dNTPs. primer-template complex and the change in
DNA synthesis was initiated by introducing buffer surface plasmon resonance measured (Fig. 7B &
containing dNTPs, and MgCl . Examples of Supplementary Fig. S6). The binding of gp4 with
2
single molecule trajectories for leading-strand gp5/trx is tighter in the presence of primer-
synthesis obtained with wild-type gp4, gp4-F523H template as compared to its absence (30). As
and gp4-F523V are shown (Fig. 6B). With wild- expected, in our experiments, wild type gp4 bound
type gp4 and gp5/trx leading-strand synthesis to the gp5/trx with a K of 110nM and 38nM in
D
proceeded at a rate of 112 ± 24 bp/s (n=21) with a the absence and presence of primer-template
processivity of 16 ± 4 kbp (Fig. 6C), in good respectively (Fig. 7C). Unlike wild type gp4, the
agreement with previous results (22, 29, 30). binding of the gp4-F523H or gp4-F523V with T7
Gp4–F523H was also able to support strand- gp5/trx did not change significantly in the absence
displacement synthesis with a rate of 87 ± 24 bp/s or presence of the primer-template (Fig. 7C).
(n=13) and a processivity of 12 ± 5kbp. Unlike Although there is a difference between the binding
gp4-K467A, as described above Gp4-F523V did of wild type gp4 and altered gp4 with gp5/trx in
not support strand displacement synthesis in these the presence of primer/template, the difference can D
o
experiments. We have analyzed more than 50 not be attributed to the defect of gp4-F523V for its w
n
events for gp4-F523V mediated strand inability to support strand displacement synthesis loa
d
displacement synthesis, however, none of them because in such an experiment we did not observe ed
showed a considerable bead movement. In similar any significant difference in the binding of gp4- fro
m
reaction conditions gp4-F523A also behaved like F523H or gp4-F523V with gp5/trx. h
ttp
gp4-F523V (data not shown). These single- ://w
molecule results support the data obtained with the w
w
ensemble experiments. DISCUSSION .jb
c
Interaction of gp4 with T7 gp5/trx- Gene 4 .org
protein and T7 gp5/trx has multiple modes of The helicase encoded by bacteriophage T7 is a b/
y
interaction (30). In one mode the acidic C- multifunctional protein that plays an essential role gu
e
terminal tail of gp4 interacts with two basic loops in unwinding dsDNA to provide a template for T7 st o
n
located in the thioredoxin-binding domain of T7 DNA polymerase on the leading strand. Structural A
p
DNA polymerase. This electrostatic mode studies of several hexameric helicases suggest a ril 1
captures DNA polymerase that may dissociate general model by which DNA binding loops move 1
, 2
from the primer-template and delivers it back to within the central channel of the functional 01
9
the primer. When T7 gp5/trx is in a polymerizing hexamer as a function of the NTP hydrolysis cycle
mode, gp4 forms a complex of high affinity that (36). Despite the differences in the nucleotide
does not require the electrostatic mode. In order binding site architecture of hexameric helicases
to find out whether the lack of support by gp4- from SF IV (T7 gp4, E. coli DnaB, and T4 gp41),
F523V in leading strand synthesis is not associated and AAA+ ATPases (MCM, BPV E1), these
with its inability to interact with gp5/trx, we have enzymes appear to translocate on ssDNA using a
measured the binding of altered gp4s (gp4-F523V mechanism involving the sequential hydrolysis of
and gp4-F523H) to T7 gp5/trx both in the absence NTP. It has been hypothesized that during the
and presence of DNA using surface plasmon unwinding of duplex DNA, the translocation of
resonance. these ring helicases on one strand of DNA
In the absence of DNA gp4 was bound to a excludes the complementary strand from its
CM5 chip and gp5/trx flowed over the bound gp4 central channel (37-39). The hexameric helicases
(Fig. 7A). In the presence of a primer-template, require dsDNA bearing 5’ and 3’-ssDNA tails; T7
the primer-template was attached to a SA chip and helicase cannot initiate unwinding on either a
gp5/trx was flowed over the bound primer- blunt end DNA or a DNA with only one ssDNA
template in the presence of a dideoxynucleoside tail (16-18, 40). However, it is not known if the
triphosphate complementary to the first nucleotide excluded strand interacts with the surface of the
8
helicase. In this study, we have examined an dTTP hydrolysis activity. However, the gp4-
amino acid, phenylalanine-523, on the surface of F523I binds to dsDNA 7-fold less tightly than
T7 DNA helicase that undergoes conformational does wild type gp4, presumably the explanation
changes upon changes in the state of hydrolysis of for its low rate of unwinding activity. The rate of
dTTP and that has the potential to contact the DNA unwinding increases with an increase in the
DNA. size of the functional group from isoleucine or
Previous reports identified residues responsible leucine to tyrosine and histidine. This order also
for coupling nucleotide hydrolysis with the correlates well with their binding affinity to
unwinding of DNA (20-22). These residues lie in dsDNA. Thus, Gp4-F523H retains 70% of the
proximity to the nucleotide binding sites located at wild type level of unwinding activity despite of
the interfaces of the subunits of the hexamer. having only 30% dTTPase activity. Gp4-F523H
From the crystal structure of T7 DNA helicase, we thus efficiently couples dTTP hydrolysis to the
identified a β-hairpin structure located at the sub- unwinding of dsDNA. Compared to wild type
unit interface that shows a difference in gp4, gp4-F523H exhibits a 2 fold higher efficiency
conformation based on the presence of a in coupling dTTP hydrolysis with unwinding.
nucleotide in the nucleotide binding site. The β- However, wild-type gp4 performs an overall
hairpin commences at Arg522 (arginine finger), higher rate of unwinding. Taken together, these
that makes contact with the γ-phosphate of the results suggest that Phe523 plays a role in D
o
bound nucleotide. Once hydrolysis takes place, coupling the energy released from the hydrolysis w
n
Arg522 is displaced from the active site and of dTTP to the unwinding of duplex DNA. loa
d
probably makes contact with Glu348 on the On the basis of our results and the crystal ed
adjacent subunit. In the process, the rest of the β- structure analysis we propose that Phe523 interacts fro
m
hairpin undergoes a conformational change, with the excluded strand (Fig. 8). We speculate h
ttp
positioning itself towards the exterior surface of that in the process of DNA unwinding at a ://w
the protein. Phe523 lies at the tip of this β-hairpin replication fork one strand passes through the w
w
and is thus in a position to interact with DNA (Fig. central channel by making interactions with the .jb
c
1). This phenomenon is analogous to the central residues in the central β-hairpins whereas the .org
β-hairpin in gp4, where His-465 acts as a excluded strand interacts with the outer parts of b/
y
phosphate sensor and plays an important role in the ring through Phe523 of the subunit-interface β- gu
e
conveying the occupancy of the nucleotide in the hairpins. These contacts can possibly rotate the st o
n
subunit interface to the ssDNA binding site at the two ssDNA strands with respect to each other and A
p
centre of the ring, this communication facilitates facilitates destabilizing the duplex DNA. The ril 1
ssDNA dependent stimulation of dTTP hydrolysis ssDNA, passing through the central channel, is 1
, 2
(22). transferred from one subunit to the adjacent one 01
9
Our results show that substituting alanine or parallel with the sequential hydrolysis of NTP
valine for Phe523 results in defective coupling of around the ring. However, it remains to be
dTTP hydrolysis to unwinding of dsDNA. These determined if the excluded strand is passed from
altered helicases retain >20% of the wild type one subunit to another using Phe523 on each of
level of dTTP hydrolysis activity. The reduced the subunits. A recent report on the mechanism
dTTP hydrolysis activity may be due to their of DNA unwinding by MCM helicase
relatively weak ability to form hexamers and thus demonstrates that the excluded strand makes
low affinity for ssDNA in the reactions as contact with the exterior surface of the ring and
evidenced by the ligand-dependent wrap around the outer surface to provide stability
oligomerization assays, and by the effect of to the DNA helicase complex for an efficient
ssDNA on dTTP hydrolysis. The order of DNA unwinding (41). We also examined the ability of
unwinding activity by helicases with substitutions the altered helicases to interact with T7 gp5/trx to
for Phe523 are gp4-F523I gp4-F523L= gp4- mediate strand displacement DNA synthesis, the
F523Y gp4-F523H. This order of unwinding is equivalent of leading strand DNA synthesis at a
the exact opposite of their ability to hydrolyze replication fork. Gp4-F523A and gp4-F523V can
dTTP in the presence of M13 ssDNA. Isoleucine not catalyze the unwinding of duplex DNA despite
can substitute for Phe523 for ssDNA dependent having considerable ssDNA-dependent dTTP
9
hydrolysis. Gp4-F523V and gp4-F523H bind would be its own defect in coupling NTP
equally well to T7 gp5/trx in the absence or hydrolysis with DNA unwinding. We propose that
presence of primer/ template. Thus the defect of Phe523 is crucial for unwinding a duplex DNA
gp4-F523V for not supporting the strand junction ahead of polymerase during leading
displacement synthesis is not due to its inability to strand synthesis.
interact with the T7 gp5/trx, rather the reason

REFERENCES

1. Richardson, C. C. (1983) Cell 33, 315-317
2. Hamdan, S. M., and Richardson, C. C. (2009) Annu. Rev. Biochem. 78, 205-243
3. Frick, D. N., and Richardson, C. C. (2001) Annu. Rev. Biochem. 70, 39-80
4. Zhu, B., Lee, S. J., and Richardson, C. C. (2009) J. Biol. Chem. 284, 23842-23851
5. Singleton, M. R., Dillingham, M. S., and Wigley, D. B. (2007) Annu. Rev. Biochem. 76, 23-50
6. Egelman, E. H., Yu, X., Wild, R., Hingorani, M. M., and Patel, S. S. (1995) Proc. Natl. Acad. Sci. U. S.
A. 92, 3869-3873
7. Kim, D. E., Narayan, M., and Patel, S. S. (2002) J. Mol. Biol. 321, 807-819
8. Tabor, S., and Richardson, C. C. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 205-209 D
o
9. Singleton, M. R., Sawaya, M. R., Ellenberger, T., and Wigley, D. B. (2000) Cell 101, 589-600. w
n
10. Crampton, D. J., Mukherjee, S., and Richardson, C. C. (2006) Mol. Cell. 21, 165-174 loa
d
11. Liao, J. C., Jeong, Y. J., Kim, D. E., Patel, S. S., and Oster, G. (2005) J. Mol. Biol. 350, 452-475 ed
12. Johnson, D. S., Bai, L., Smith, B. Y., Patel, S. S., and Wang, M. D. (2007) Cell 129, 1299-1309. fro
m
13. Donmez, I., and Patel, S. S. (2006) Nucleic. Acids. Res. 34, 4216-4224 h
ttp
14. Donmez, I., and Patel, S.S. (2008) EMBO J. 27, 1718-1726 ://w
15. Matson, S.W., and Richardson, C. C. (1983a) J. Biol. Chem. 258,14009-14016 w
w
16. Matson, S.W., Tabor, S., Richardson, C. C. (1983b) J. Biol. Chem. 258, 14017-14024 .jb
c
17. Ahnert, P., and Patel, S. S. (1997) J. Biol. Chem. 272, 32267-32273 .org
18. Kaplan, D. L. (2000) J. Mol. Biol. 301, 285-299 b/
y
19. Galletto, R., Jezewska, M. J., and Bujalowski, W. (2004) J. Mol. Biol. 343. 101-114 gu
e
20. Washington, M. T., Rosenberg, A. H., Griffin, K., Studier, F. W., and Patel, S. S. (1996) J. Biol. Chem. st o
n
271, 26825-26834 A
p
21. Crampton, D. J., Guo, S., Johnson, D. E., and Richardson, C. C. (2004) Proc. Natl. Acad. Sci. U. S. A. ril 1
101, 4373-4378 1
, 2
22. Satapathy, A. K., Kochaniak, A., Mukherjee, S., Crampton, D. J., van Oijen, A. M, and Richardson C. 01
9
C. (2010). Proc. Natl. Acad. Sci. U .S. A. 107, 6782-6787
23. Mendelman, L. V., Notarnicola, S. M., and Richardson, C. C. (1993) J. Biol. Chem. 268, 27208-27213
24. Notarnicola, S. M., Park, K., Griffith, J. D., and Richardson, C. C. (1995) J. Biol. Chem. 270, 20215-
20224
25. Crampton, D. J., Ohi, M., Qimron, U., Walz, T., and Richardson, C. C. (2006) J. Mol. Biol. 360, 667-677.
26. Picha, K. M., and Patel, S. S. (1998) J. Biol. Chem. 273, 27315-27319
27. Satapathy, A. K., and Richardson, C. C. (2011) J. Biol. Chem. 286, 23113-23120
28. Satapathy, A. K., Crampton, D. J., Beauchamp, B. B., and Richardson, C. C. (2009) J. Biol. Chem. 284,
14286-14295
29. Lee, J. B., Hite, R. K., Hamdan, S. M., Xie, S., Richardson, C. C., and van Oijen, A. M. (2006) Nature
439, 621-624
30. Hamdan, S. M., et al. (2007) Mol. Cell 27, 539-549
31. Mendelman, L. V., Notarnicola, S. M., and Richardson, C. C. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,
10638-10642
32. Kolodner, R., and Richardson, C. C. (1977) Proc. Natl. Acad. Sci. USA. 74, 1525-1529
33. Stano, N. M., Jeong, J. Y., Donmez, I., Tummalapalli, P., Levin, M. K., and Patel, S. S. (2005) Nature
435, 370-373
10