Construction of an artificial cell membrane anchor using DARC as a fitting for artificial extracellular functionalities of eukaryotic cells.

0.53 MB·English

by  von Nickisch-Rosenegk, Markus

vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1
http://www.jnanobiotechnology.com/content/10/1/1
RESEARCH Open Access
Construction of an artificial cell membrane
anchor using DARC as a fitting for artificial
extracellular functionalities of eukaryotic cells
Markus von Nickisch-Rosenegk*, Till Teschke and Frank F Bier
Abstract
The need to functionalize cell membranes in a directed way for specific applications as single cell arrays or to force
close cell-to-cell contact for artificial intercellular interaction and/or induction concerning stem cell manipulation or
in general to have a tool for membrane and cell surface-associated processes, we envisaged a neutral inactive
membrane anchor for extracellular entities to facillitate the above mentioned functionalities.
The silent Duffy antigen/receptor for chemokines (DARC) is a receptor-like membrane protein of erythrocytes and
mediates no cell transduction not at least regarding a missing or truncated G-loop and therefore it seemed to be
the candidate for our cell membrane anchor.
We isolated the genetic information of DARC from human genomic DNA and cloned it in a mammalian cell line as
a fusion protein via a suitable plasmid vector.
In this report we demonstrate that the human plasma membrane protein DARC can be used as an artificial anchor
molecule in cell surface engineering applications. We constructed the fusion protein SNAP-tag-DARC, consisting of
® ®
DARC and the self-labeling protein tag SNAP-tag (Covalys). The SNAP-tag served as an example for a molecular-
technological developed protein that is artificially attached to the extracellular side of the plasma membrane
through our DARC-anchor. SnapTag should serve as an example for any extracellular entity and was easy to detect
by a commercial detection system. The synthesis of SNAP-tag-DARC, its correct incorporation into the cell
®
membrane and the functionality of the SNAP-tag were verified by RT-PCR, Western blotting and confocal
fluorescence microscopy and showed the desired functionality as an membrane anchor for an extracellular
application entity.
Keywords: Duffy, DARC, artificial cell membrane anchor, artificial cell membrane functionalities, recombinant func-
tional membrane fusion protein
Background differentiation in cell cultures, the connection of natu-
Currently desired manipulations of eukaryotic cells com- rally incompatible cell types, the mutual influence of
prise the specific modification of their extracellular sur- cells staying in closed contact, artificial epitopes, the
face, in particular the cell membrane. Cell membranes artificial fusion of cells, the engineering of antigen pre-
can be engineered by attaching new molecules or by senting cells, the reduction of graft rejection and the
modifying or removing their natural components. Of development of hybrid materials and systems [1-3].
particular interest are proteins, peptides, oligosacchar- The presentation of new molecules on the cell surface
ides and small organic molecules. In combination with can be achieved by attaching them as a fusion partner
other technologies, such modifications of the cell mem- protein to a transmembrane protein through conven-
brane shall enable a range of applications, as cell adhe- tional gene transfer.
sion in general, single cell arrays, the sorting of cells on In this work, we examined whether the human plasma
surfaces, the manipulation of migration and membrane protein DARC [4] can act as such a nanobio-
technological polypeptide anchor fused with a functional
*Correspondence:[email protected] peptide of interest.
FraunhoferIBMT,AmMuehlenberg13,14476Potsdam,Germany
©2012vonNickisch-Rosenegketal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsofthe
CreativeCommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page2of7
http://www.jnanobiotechnology.com/content/10/1/1
®
DARC was chosen because it is functionally redundant expression plasmid. The SNAP-tag ligated to the
and not known to initiate intracellular signal transduc- DARC anchor served as an example for a possible extra-
tion [5]. It is a glycoprotein with the predicted topology cellular functionality. The correct sequences and the
of a G protein-coupled receptor. Its major isoform theo- functional ligation of the gene fragments were verified
retically consists of 336 amino acids. DARC carries the by commercial sequencing.
antigenic determinants of the human blood group sys- In Figure 1 the final construct of SNAP-tag-DARC is
tem Duffy and is an erythrocyte co-receptor for the shown in the plasmid pSEMS1-Sig-26 as a vector-map
merozoites of the human malaria parasite Plasmodium and in an agarose gel where the plasmid is digested by
vivax [6,7]. In addition, DARC is a silent chemokine restriction enzymes. A suitable enzyme, which cuts the
receptor that binds several chemokines, but shows no G plasmid two times could be identified from the plasmid
protein-coupled signal transduction. DARC lacks the sequence shown in additional file 1. The KpnI digestion
typical DRY-motif on the second intracellular loop, generates two fragments of around 4500 bp and 2500
which is an essential requirement for signal transduction bp. The latter represents the genes of the fusion protein
of all residual polypeptides of the GPCR family [8]. SNAP-tag-DARC plus some basepairs of the vector
DARC is present on erythrocytes and certain endothe- backbone caused by the KpnI restriction sites (see 1b)
lial cells of terminal vessels, but also on some epithelial In order to examine whether the SNAP-tag-DARC
cells. It is produced in special vessels of kidney, lung, fusion gene was properly transcribed in transfected cells,
thyroid and spleen, especially along postcapillary RT-PCR was performed. In transfected cells the tran-
venules. DARC plays a role in metastasis suppression scripts of the SNAP-tag-DARC fusion gene were
and inflammation as extracellular functionalities but see- detected in the correct size, which could be observed in
mingly missing the intracellular ones as described above the first four lanes of an agarose gel in Figure 2. The
[9-11]. Therefore it is the best candidate for an trans- transcript of the SNAP-tag-DARC fusion gene could be
fectable artificial cell membrane anchor, which promise visualized as well as in the transfected cells used positive
to behave inert within target cells. control (ATPase). Control reactions of the transfected
®
The SNAP-tag was chosen to exemplify a protein cells containing no reverse transcriptase (RT) proved
attached to DARC that protrudes into the extracellular that the signals resulted from cDNA and not from plas-
space as an artificial functionality. Additionally, SNAP- mid DNA used to transfect the cells.
®
tag was used as a method for detecting the intended The transcript of a housekeeping gene for ATPase
SNAP-tag-DARC fusion proteins on the surface of served as a positive control for the RT-PCR reaction
®
transfected cells. The SNAP-tag is a self-labeling pro- even in the reactions of the untransfected cells (lane 6),
tein tag derived from the human O6-alkylguanine-DNA which are visualized in the lanes five to seven of Figure
®
alkyltransferase (AGT) [12]. SNAP-tag can establish a 2.
covalent bond between the benzyl group of O6-benzyl- Subsequent restriction of the RT-PCR products with
guanine and a cysteine in its active center, releasing gua- SbfI showed that they were hydrolyzed in the sizes as
®
nine. By fusing the SNAP-tag to a protein of interest expected for SNAP-tag-DARC DNA (data not shown).
and using a substrate carrying a fluorophore on its ben- In order to examine whether SNAP-tag-DARC was
zyl group, one can specifically and covalently label the synthesized in the transfected cells, Western Blotting
protein of interest. Under physiological conditions, the was performed. SNAP-tag-DARC was expected to have
®
reaction is irreversible. The SNAP-tag was chosen a molecular mass of 58 to 69 kDa, depending on the
because it allows cell surface labeling along with cell extent of DARC’s glycosylation (with 69 kDa corre-
impermeable substrates. Intracellular SNAP-tag-DARC sponding to full glycosylation, and 58 kDa correspond-
and endogenous AGT are not labeled. ing to no glycosylation). To elucidate possible cross-
reactivity we blotted the complete membrane fraction of
Results and discussion the used CHO-K1 cells and of erythrocytes and incu-
In order to create an anchor which is located within the bated the blots with anti-DARC and anti-Transferrin
cell membrane of eukaryotic cells and is able to provide antibodies shown in Figure 3a. In contrast to the Trans-
extracellular functionalities, we chose the 7-trans-mem- ferrin-positive control, no signal of DARC is visible in
brane protein DARC. DARC is a silent receptor regard- the CHO-K1 membrane fraction. For comparison differ-
ing the intracellular transduction cascade and therefore ent amounts of extracts from erythrocytes are shown in
promises a suitable building block as a membrane Figure 3b.
anchor for an extracellular and artificial receptor for In order to examine whether SNAP-tag-DARC is loca-
controlled applications with specific ligands. The chosen lized to the plasma membrane and was incorporated
®
DARC was amplified from human genomic DNA by with the SNAP-tag protruding into the extracellular
PCR and the synthesis products were ligated in an space, cells were treated with the cell impermeable
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page3of7
http://www.jnanobiotechnology.com/content/10/1/1
a
b

1 2 3 4
5000 bp
4000 bp
2500 bp
Figure 1 Finalconstruct of SNAP-Tag-DARC. In 1a thecomplete vector map of the final constructenabling theSNAP-Tag-DARC fusion
proteinisshown.1brepresentsanagarosegeloftherelatedplasmidafterdigestionwithKpnI,whichhastworestrictionsitesflankingthe
completeSNAP-Tag-DARCconstructlane1=sizemarker,lane2-4=twobandsofthedigestedplasmid.
®
SNAP-tag substrate BG-488. The strategy of using the labeled. A recent study has shown that different SNAP-
®
SNAP-tag with a cell impermeable substrate to prove tag fusion proteins, despite possessing a reactive
correct localization of the fusion protein has the advan- cysteine, can be labeled with fluoresceine and the trans-
tage that endogenous SNAP-tag-DARC will not be port of the protein could be tracked through the
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page4of7
http://www.jnanobiotechnology.com/content/10/1/1
M 1 2 3 4 5 6 7 - + M
2000 bp
1500 bp
1000 bp
600 bp
Figure2AgarosegelofRT-PCRoftransfectedcells(lanes1-4)anduntransfectedcells(Lanes5-7).TranscriptsoftheSNAP-tag-DARC
fusiongeneweredetected(lane2).1)noRTcontrolwithSNAP-tag-DARCprimers,3)noRTcontrolwithATPaseprimers,4)RTpositivecontrol
withATPaseprimers(housekeepinggene),5)RTcontrolwithSNAP-tag-DARCprimers,6)RTpositivecontrolwithATPaseprimers(housekeeping
gene),7)noRTcontrolwithATPaseprimers,-)PCRcontrolwithoutprimers,+)PCRcontrolwithSNAP-tag-DARCprimersandtotalDNAfrom
transfectedcells,M)sizemarker.
3a: CHO-K1 3b: erythrocytes
1 2 3 4 5 6
-100 kDa-
- 70 kDa-
- DARC -
- 40 kDa-
Figure 3 Western Blot of DARC in transfected cells and erythrocytes. In 3a of total membrane fraction of CHO-K1 cells (lane 1) and
solubilizedmembranefractionoferythrocytes(lane2)co-incubatedwithantibodiesagainsttheDARC-andtheTransferrinreceptor.Lane1
showstheexpectedbandofTransferrinofaround100kDa.Infigure3bdifferentproteinloadsareshown:lane3carries10μgofsolubilized
erythrocytemembrane;lane4=5μg;lane6=15μg;lane5=molecularweightmarker.
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page5of7
http://www.jnanobiotechnology.com/content/10/1/1
a
b
c
Figure4TransientlytransfectedCHO-K1cellsexpressingtheSNAP-tag-DARCfusiongeneintheMembrane.Cellswerelabeledwiththe
cellimpermeableSNAP-tag®substrateBG-488.Topof4aand4b;leftof4c;Fluorescencechannel,opticalslice<1.2μm.Bottomof4aand4b
andrightof4c:Samesectionintransmittedlight.
membrane and to the extracellular side of the plasma gene. The Adrenergic Receptor Beta 2 (ADRB2) was
membrane [13]. cloned in analogy to DARC and co-expressed with the
As a control for the correct localization of a recombi- SNAP-tag.
nant membrane receptor fusion protein, we transfected The labeling of transfected SNAP-tag-DARC cells with
CHO-K1 cells with an other G-protein coupled receptor BG-488 was successful. Confocal micrographs of
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page6of7
http://www.jnanobiotechnology.com/content/10/1/1
transfected cells showed homogeneous surface labeling Cell culture and transfection
(Figure 4). The fluorescing structures were congruent CHO-K1 cells from the German Collection of Micro-
with the rims of the cells as seen in transmitted light. organisms and Cell Cultures were grown in Ham’s F-
Fluorescence signals corresponded even well with those 12 supplemented with 10% FCS (Biochrom). Cells
of the cell surface localization control, SNAP-tag- were transiently transfected with the recombinant vec-
ADRB2-receptor (Figure 5). These results were reprodu- tor pSEMS1-Sig-26m-DARC using FuGENE HD
cible in three independent transfection and labeling (Roche).
experiments.
For control of autofluorescence of transfected cells or Sequencing of the cloned vector construct
unspecific binding of BG-488 to untransfected cells (the Subsequent sequencing from plasmid prep of transfected
letter were incubated with the BG-488 substrate), fluor- cells was accomplished commercially by Agowa GmbH
escence microscopy has been performed. No fluores- to confirm the construct.
cence could be detected
RT-PCR
Methods 40 hours following transfection, total RNA was extracted
Preparation of DARC gene from the cells and treated with DNase I. After DNase
Human genomic DNA was amplified with the primers inactivation, RNA was reverse-transcribed and cDNA
(DARC-SbfI-forward: gggctgggtcctgcaggtatggcctcctctggg- was amplified by PCR.
tatgtcc and DARC-XhoI-reverse: gtgtgtcactcgaggctag-
gatttgcttccaagggtgtcc) spanning arround 1000 bp and Western Blot
constructed with homology of the 3’- and the 5’-end of 72 hours following transfection, total cellular membrane
the DARC exon (Genbank: AM887935) and for cloning proteins were extracted from the cells. Proteins were
with suitable restriction sites enabling in-frame ligation analyzed by Western Blot using a monoclonal antibody
in the appropriate expression vector. to human blood group Fy6 (Becton Dickinson) and a
monoclonal antibody to human transferrin receptor
Construction of the SNAP-tag-DARC expression plasmid (Invitrogen) at final concentrations of 0,50 μg/ml and
For the construction of SNAP-tag-DARC and a correct 0,17 μg/ml, respectively. For protein denaturation, no
localization to the cell surface, DARC was fused to the reducing agent was used.
®
C terminus of a SNAP-tag equipped with a suitable
signal peptide. For this purpose, the human gene Fluorescence labeling
DARC (exon 2 encoding the minor isoform of 338 Cells were grown on chambered coverglass slides. 24 to
amino acids) was amplified by PCR and cloned into 48 hours after transfection, the cell impermeable SNAP-
the SbfI and XhoI sites of the vector pSEMS1-Sig-26m tag® substrate BG-488 (Covalys) was added to the med-
(Covalys). ium to a final concentration of 10 μM. Cells were
Figure5TransientlytransfectedCHO-K1cellsexpressingthecellsurfacelocalizationcontrolSNAP-tag-ADRB2receptorgeneinthe
cellmembrane.CellswerelabeledwiththecellimpermeableSNAP-tag®substrateBG-488.Top;Fluorescencechannel,opticalslice<1.5μm.
Bottom:Samesectionintransmittedlight.
vonNickisch-Rosenegketal.JournalofNanobiotechnology2012,10:1 Page7of7
http://www.jnanobiotechnology.com/content/10/1/1
incubated for 10 minutes in the incubator, washed with 5. LuoH,ChaudhuriA,ZbrzeznaV,HeY,PogoAO:Deletionofthemurine
ice cold medium and fixed with 4% paraformaldehyde. Duffygene(Dfy)revealsthattheDuffyreceptorisfunctionally
redundant.MolCellBio2000,20:3097-3101.
Laser-scanning confocal micrographs were recorded
6. TurnamilleC,BlancherA,LeVanKimC,GaneP,ApoilPA,NakamotoW,
using a 488 nm laser line and appropriate filter sets on CartronJP,ColinY:Sequence,evolutionandligandbindingpropertiesof
a Zeiss LSM 510 microscope with an x40 oil objective mammalianDuffyantigen.Immunogenetics2004,55:682-694.
7. HadleyTJ,PeiperSC:FromMalariatochemokinereceptor.Blood1997,
(Zeiss).
89:3077-3091.
8. ChakeraA,SeeberRM,JohnAE,EidneKA,GreavesDR:TheDuffyAntigen/
Conclusion ReceptorforChemokinesExistsinanOligomericForminLivingCells
andFunctionallyAntagonizesCCR5SignalingthroughHetero-
Our experiments show that DARC can serve as a func-
Oligomerization.MolPharmacol2008,73:1362-1370.
tional membrane anchor, which allows an extracellular 9. NoeteK,MakJY,KolakowskiLFJr,SchallTJ:Functionalandbiochemical
fusion protein to react with an offered ligand in living analysisoftheclonedDuffyantigen.Blood1994,84:44-52.
10. HorukR,MartinAW,WangZ,SchweitzerL,GerassimidesA,GuoH,LuZ,
eukaryotic cells. DARC was correctly integrated within
HesselgesserJ,PerezHD,KimJ,ParkerJ,HadleyTJ,PeiperSC:Expression
the cell membrane presenting the aminoterminally fused ofchemokinereceptorsbysubsetsofneuronsinthecentralnervous
enzyme protein to the extracellular space. system.JImmunology1997,158:2882-2890.
11. PeiperSC,WangZX,NeoteK,MartinAW,ShowellHJ,ConklynMJ,
These results provide us a tool to functionalize cell
OgborneK,HadleyTJ,LuZH,HesselgesserJ,HorukR:TheDuffyantigen/
membranes with well-defined entities. Further experi- receptorforchemokines(DARC)isexpressedinendothelialcellsof
ments should show the influence of artificially closed Duffynegativeindividuals.JExpMed1995,181:1311-1317.
12. KepplerA,KindermannM,GendreizigS,PickH,VogelH,JohnssonK:
attached ligands to relevant target cells to examine and
LabelingoffusionproteinsofO6-alkylguanine-DNAalkyltransferasewith
elucidate functions and influence and to understand smallmoleculesinvivoandinvitro.Methods2004,32:437-444.
protein to protein interactions. 13. KepplerA,PickH,ArrivoliC,VogelH,JohnssonK:Labelingoffusion
proteinswithsyntheticfluorophoresinlivecells.PNAS2004,
101:9955-9959.
Additional material
doi:10.1186/1477-3155-10-1
Citethisarticleas:vonNickisch-Rosenegketal.:Constructionofan
Additionalfile1:CompletesequenceofthepSEMS1-Sig-26m-DARC artificialcellmembraneanchorusingDARCasafittingforartificial
vector:DNAsequenceoftheCovalysSNAP-tag-DARCplasmid extracellularfunctionalitiesofeukaryoticcells.Journalof
containingthegenesforthefusionproteinofSNAP-tagandDARC. Nanobiotechnology201210:1.
Acknowledgements
TheauthorsaregratefultoDr.AndreasLankenauforhishelpful
contributionsincellstainingandBeateMorgensternforexcellentassistance
andintensetechnicalsupportduringcellculture.
WeareverythankfultoDr.MarkusSchwab,CovalysBiosciencesAGfor
supplyingusthepSEMS1-Sig-26mvectorfortheSNAP-tagfusion.
Authors’contributions
MvNRhascreatetdthebasicideaandmadesubstantialcontributionsto
conceptionanddesignandwrote50%ofthemanuscript.TTperformedthe
experiments,madesubstantialcontributionstotheanalysisand
interpretationofthedataandwrote50%ofthemanuscript.FBhasbeen
involvedinrevisingthemanuscriptcriticallyforimportantintellectual
contentandhasgivenfinalapprovaloftheversiontobepublished.All
authorshavereadandapprovedthefinalmanuscript.
Competinginterests
Theauthorsdeclarethattheyhavenocompetinginterests.
Received:12August2011 Accepted:5January2012
Published:5January2012
Submit your next manuscript to BioMed Central
and take full advantage of:
References
1. PatersonRG,LambRA:AbilityoftheHydrophobicFusion-Related
ExternalDomainofaParamyxovirusFProteintoActAsaMembrane • Convenient online submission
Anchor.Cell1987,48:441-452.
• Thorough peer review
2. HerselU,DahmenC,KesslerH:RGDmodifiedpolymers:biomaterialsfor
stimulatedcelladhesionandbeyond.Biomaterials2003,24:4385-4415. • No space constraints or color figure charges
3. Kurihara1H,NagamuneT:CellAdhesionAbilityofArtificialExtracellular • Immediate publication on acceptance
MatrixProteinsContainingaLongRepetitiveArg-Gly-AspSequence.J
• Inclusion in PubMed, CAS, Scopus and Google Scholar
BiosciBioeng2005,100:82-87.
4. ChaudhuriA,ZbrzeznaV,JohnsonC,NicholsM,RubinsteinP,MarshWL, • Research which is freely available for redistribution
PogoAO:Purificationandcharacterizationofanerthrocytemembrane
proteincomplex.JBiolChem1989,264:13770-13774. Submit your manuscript at
www.biomedcentral.com/submit