ebook img

Cell lines: Valuable tools or useless artifacts. PDF

2012·0.99 MB·English
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview Cell lines: Valuable tools or useless artifacts.

EDITORIAL Spermatogenesis2:1,1–5;January/February/March2012;G2012LandesBioscience Cell lines Valuable tools or useless artifacts Gurvinder Kaur and Jannette M. Dufour* DepartmentofCellBiologyandBiochemistry;TexasTechUniversityHealthSciencesCenter;Lubbock,TXUSA Keywords: Sertoli cells, cell lines, MSC-1 cells, immune privilege, transplantation, follicle stimulating hormone receptor Cell lines are often used in place of primary cells to study biological processes. However, care must be taken when interpretingtheresultsascelllinesdonotalwaysaccuratelyreplicatetheprimarycells.Inthisarticle,wewillbrieflytalkabout advantagesanddisadvantagesofcelllinesandthendiscussresultsusingthemouseSertolicellline,MSC-1,comparedwith primary mouse Sertoli cells. MSC-1 cells resemble Sertoli cells morphologically and possess several biochemical markers associatedwithSertolicells.Studieshavedemonstratedthatthefunctionandregulationofretinoicacidreceptora(RARa)is similarbetweenMSC-1andratSertolicells.However,MSC-1cellslacksomeoftheimmuneprivilegepropertiesassociated withprimarySertolicells,includingsurvivalinanimalswithafullyfunctionalimmunesystem.Therefore,ithastobekeptin mindthatcelllinesdonotbehaveidenticallywithprimarycellsandshouldnotbeusedtoreplaceprimarycells.Inorderto strengthenthefindings,keycontrolexperimentsusingprimarycellsshouldalwaysbeperformed. ©Immorta l c2ell lin0es are1often2used iLn uandersntood.dSince ceell linses are gBeneticaillyocellscultucres foir aelongnperiodcof tieme an.d research in place of primary cells. They manipulated this may alter their pheno- cause extensive alterations in gene expres- offer several advantages, such as they are type, native functions and their respon- sion and cell behavior. Based on sub- cost effective, easy to use, provide an siveness to stimuli. Serial passage of cell missions to cell banks, 15–35% of cell unlimited supply of material and bypass lines can further cause genotypic and lines were estimated to be contaminated ethical concerns associated with the use of phenotypic variation over an extended with mycoplasma.7,8 Therefore, great care animal and human tissDue. Celol lines anlso poeriodtof timde andigesnetictdrifrt cain ablso ushouldtbeetaken.when using cell lines and provideapurepopulationofcells,whichis cause heterogeneity in cultures at a single experiments where key findings are con- valuable since it provides a consistent pointintime.Therefore,celllinesmaynot firmed in primary cultures should always sample and reproducible results. Cell lines adequatelyrepresentprimarycellsandmay be included. have revolutionized scientific research and provide different results. The other major Herein we share our experience using are being used in vaccine production, problems associated with cell lines are an immortalized mouse Sertoli cell line testing drug metabolism and cytotoxicity, contamination with other cell lines and (MSC-1), that was developed in 1992 by antibody production, study of gene func- mycoplasma. The bitter truth of cross- Peschon et al.9 This cell line was isolated tion, generation of artificial tissues (e.g., contamination of cell lines either inter from transgenic mice containing Sertoli artificial skin) and synthesis of biological or intraspecies was exposed by Walter cells transformed by the small and large compounds e.g., therapeutic proteins.1-3 Nelson-Rees in the early 1970s. He T-antigens of the SV40 virus, which were Cell line popularity can be estimated by showed that at that time point the major- targeted to Sertoli cells using the pro- the numerous publications using cell lines ity of cell lines being used worldwide and moter for Mullerian inhibiting substance. and American Type Culture Collection distributed by cell banks were contami- MSC-1 cells were similar to primary (ATCC) Cell Biology Collection which natedwithHeLacells.4Thisstillremainsa Sertolicellsmorphologicallyandexpressed consists of over 3,600 cell lines from over problem even after 40 y.5,6 When con- manyof thesame genes as primary Sertoli 150 different species. However, despite tamination of a cell line occurs whereby cells.9,10 Although, follicle-stimulating beingapowerfultool,onemustbecareful a very rapidly proliferating cell line is hormone receptor (FSHr) and Mullerian when using cell lines in place of primary introduced, it only takes a few passages inhibiting substance were not detected in cells. Cell lines should display and main- until the culture is entirely taken over by MSC-1 cells.9,10 tainfunctionalfeaturesasclosetoprimary the contaminating cell line. HeLa cell Previously, MSC-1 cells were used to cells as possible. This may particularly be contamination is well known to cause study the function and regulation of difficult to determine as often the func- such problems. Additionally, mycoplasma retinoic acid receptor a (RARa). In these tions of the primary cells are not entirely contamination can persist undetected in studies, retinoic acid, activation of protein *Correspondenceto:JannetteM.Dufour;Email:[email protected] Submitted:02/29/12;Accepted:03/02/12 http://dx.doi.org/10.4161/spmg.2.1.19885 www.landesbioscience.com Spermatogenesis 1 kinase C (PKC) and mitogen activated co-transplantation of BALB/c primary As mentioned earlier, FSHr was not protein kinase (MAPK) were shown to Sertoli cells with BALB/c islets as allo- detected in MSC-1 cells.10 FSHr is acti- increasethenuclearlocalizationandtrans- graftsintodiabeticC3Hmicesignificantly vated by follicle-stimulating hormone criptional activity of RARa.11 Addition- prolonged islet graft survival (. 61.1 ± (FSH) and is important for Sertoli cell ally,peroxisomeproliferatorsinhibitedthe 6.9 d), with 59% of the Sertoli cell/islet proliferation, macromolecular synthesis, retinoic acid-induced nuclear localization co-grafts surviving throughout the study morphological structure, and ultimately andtranscriptionalactivityofRARa,while period.14 In addition, 100% graft survival the spermatogenic capability.25 However, increasing the nuclear localization and was observed when primary Sertoli cells the role of FSHin creationof an immune transcriptional activity of peroxisome pro- were transplanted alone as allografts into privileged environment is not clear. In liferator-activated receptor a (PPARa) in naïveBALB/cmicefor20d.13Incontrast, one study there was an increase in testi- MSC-1 cells.12 Importantly, the results MSC-1 cells were unable to protect co- cular graft size/survival after transplanting were confirmed in primary Sertoli cells grafted cells in diabetic animals and were to oophorectomized rodents that corre- isolated from 20-d old rats,11,12 which themselves rejected when transplanted lated with FSH and luteinizing hormone verified that RARa nuclear localization into naïve mice with a fully functional (LH) levels.26 Additionally, Selawry et al., and transcription were regulated by reti- immune system.13,14 This emphasizes the demonstrated that media collected from noic acid, PKC, MAPK and peroxisome importance of being cautious before rat Sertoli cells cultured at 37°C for 24 h proliferators. This demonstrates that assuming results obtained from cell lines supplemented with FSH significantly RARa regulation and function is similar are the same as those obtained using inhibited the ConA stimulated prolifera- in MSC-1 and primary Sertoli cells and primary cells. tion of spleen lymphocytes, suggesting that MSC-1 cells can be used as a model Interestingly,MSC-1cellsdidsurvivein FSH may be important for Sertoli cells to study RARa regulation in primary 66% of the recipient diabetic mice even immune protection.27 In contrast, the Sertoli cells. though the islet grafts were rejected.14 same group also demonstrated that pro- However, not all results using the This is most likely due to the suppressed tection of cellular grafts within the testis ©MSC-1c ell2linear0econs1istentw2ithre sulLts iammunne sysdtem asesociatsed w ithBdiabetiesowassnotcdepeindeent onnFSHcoreLH a.s from primary Sertoli cells as illustrated by and suggests MSC-1 cells express some treatment of rats with a gonadotropin- studiesonimmuneprivilege.13,14Immune- immunoprotectivefactorsbutlackorhave releasing hormone (GnRH) analog or privileged sites are anatomical sites where lower expression of the key factors needed hypophysectomy had no effect on the foreigntissuessurviveforextendedperiods for immune protection of co-grafted cells survival of transplanted intratesticular of time because immune surveillance is and for fully functional immune privilege. islet allografts.28 reduced, and thus foreigDn antigoens ca nnbe Tohus,tMS C-d1 cellsimsay ntot mrimiic tbhe uSincte FeSHr i.s known to be important tolerated without evoking a detrimental survival and immune privilege properties for the function of primary Sertoli cells immune response. The testis is an of primary Sertoli cells but are useful as and MSC-1 cells lack FSHr, the survival immune-privileged site that results in a control cell line to identify the key of MSC-1 cells stably transfected with protection ofthe auto-immunogenicgerm mechanisms or factors important for FSHr (MSC-1FSHr) was examined after cells (when germ cells are removed from primary Sertoli cell immune privilege. To allotransplantation. MSC-1FSHr cells the testis and injected at a different site in identify genes and immune-related func- were shown previously to express func- the same animal, the cells are rejected).15 tional pathways that are differentially tional FSHr as demonstrated by northern Sertoli cells play an important role in regulated in these cells gene expression blot analysis and increased c-fos mRNA creating this immune-privileged environ- profiles of primary mouse Sertoli cells after FSH treatment.29 Prior to trans- ment by expressing several immuno- and MSC-1 cells were compared by plantation, the expression of FSHr was regulatory factors.16-19 Moreover, isolated microarray and ontological analyses.13 We confirmed by RT-PCR and as expected, Sertoli cells survive and prolong the survi- found that 2,369 genes were expressed FSHr mRNA was not detected in MSC-1 val of co-transplanted cells when trans- with a ± 4-fold or higher level in primary cells (Fig.1A, lane 3) while MSC-1FSHr planted as allografts20,21 or xenografts.22 Sertoli cells than in MSC-1 cells. Genes cells expressed FSHr mRNA (Fig.1A, Similarly, Sertoli cells grafted alone across involved in immune functions were Lane 2). Four million MSC-1 or MSC- species survive longer than other cell identified and differentially expressed.13 1FSHr cells were cultured as aggregates types.23,24 While the Sertoli cells and MSC-1 cells (Fig.1C and D) and transplanted into To compare the immunoprotective express many of the same genes, they naïve BALB/c mice as allografts. Graft- properties of MSC-1 cells with primary were expressed at different levels which bearing kidneys were removed 20 d post- Sertoli cells, MSC-1 cells were co- appear to result in different immune transplantation and examined for cell transplanted with BALB/c pancreatic regulatory functions. This confirms that survival by immunohistochemistry for islets as allografts intodiabetic C3H mice. the MSC-1 cell line is substantially dif- SV-40 large T antigen and RT-PCR for The islets were rejected in 32.8 ± 8.4 d, ferent from primary mouse Sertoli cells FSHr. Consistent with the previous which was not significantly different and reiterates the importance of being survival data in naïve mice, MSC-1 cell from control mice that received allogeneic cautious when making conclusions based grafts were rejected (0/6) by 20 d islets alone (26.9 ± 2.1 d). In contrast, on the results from cell lines. post-transplantation (Fig.1F). Similarly, 2 Spermatogenesis Volume2Issue1 © 2012 Landes Bioscience. Do not distribute. Figure1.FSHrmRNAexpressionandsurvivalofMSC-1andMSC-1FSHrcellsasallografts.MSC-1cellsstablytransfectedwithratFSHrcDNAwere obtainedfromDr.Griswold(WashingtonStateUniversity,Pullman,WA).29MSC-1FSHrcellsweremaintainedandculturedessentiallythesameasMSC-1 cellswiththeexceptionoftheadditionof250mg/mlG418(Invitrogen,Carlsbad,CA).AandB)RT-PCRwasperformedforFSHr(A),Lanes2and3; Primers-For5’CCATTGTGTCCTCATCAAGC,Rev5’CATGGAAGTTGTGGGTAGCG)orcyclophilin(B),Lanes2and3;Primers-For5’CCCACCGTGTTC TTCGAC,Rev5’ATCTTCTTGCTGGTCTTGCC)withRNAisolatedfromMSC-1FSHr(AandB,Lane2)orMSC-1cells(AandB,Lane3).Lane1(AandB)is 1kbPlusDNALadder(Invitrogen).(CandD)MSC-1(D)orMSC-1FSHr(C)cellswereculturedasaggregatedfor48h.Aggregateswerefixed,dispersed inagar,embeddedinparaffin,sectionedandimmunostainedforlargeTantigen(browncolor)andhematoxylin(bluecolor).(E-H)Fourmillionof theseaggregatedcellsweretransplantedunderthekidneycapsuleofnaïve(EandF)anddiabetic(GandH)BALB/cmice.Thegraftswerecollectedat day20post-transplantation,andtissuesectionswereimmunostainedforMSC-1cellmarker,largeTantigen(browncolor,E-H).Allsectionswere counterstainedwithhematoxylin(bluecolor).Adottedlineseparatesthekidneyfromthegraft.K,kidney;Arrow,largeTantigenpositivecells.Careand maintenanceofanimalsdescribedin(E-H)wasperformedinaccordancewiththeInstituteforLaboratoryAnimalResearchCareandUseofLaboratory Animals,andTexasTechUniversityInstitutionalAnimalCareandUseCommittee-approvedprotocols. www.landesbioscience.com Spermatogenesis 3 MSC-1FSHr grafts were also rejected in may serve as a good comparison cell line In conclusion, cell lines are a powerful naïve BALB/c animals and no large T to study key factors/mechanisms required tool and offer several advantages over antigen positive MSC-1FSHr cells or for primary Sertoli cell immune privilege primary cells. However, it must be FSHr mRNA were detected at 20 d post- but they should not be used in place of understood that cell lines do not comple- transplantation (0/7) (Fig.1E, data not primary Sertoli cells to study survival tely mimic primary cells. Therefore, great shown). In contrast, both MSC-1 (2/2) mechanisms. caution should be taken when designing and MSC-1FSHr (4/4) cells survived in A different MSC-1FSHr cell line was experiments to assure that the conclusions diabetic mice at 20 d post-transplantation created by Eskola et al.30 In this cell line, drawn from cell line are sound. Key as shown by large T antigen staining intact FSHR signaling and function, experiments should also be replicated in (Fig.1G–H) and RT-PCR for FSHr similar to Sertoli cells was verified by primary cells. mRNA (MSC-1FSHr only; data not cAMP response to FSH and PKC. Finally, it should be recognized that a shown). However, the MSC-1FSHr grafts Antiproliferative effects of FSH on MSC- weakness of in vitro cell cultures, both were slightly smaller than the MSC-1 cell 1FSHr further demonstrated that these primarycellsandcelllines,isthattheyare grafts (Fig.1, compare G and H). This cells resemble adult Sertoli cells and thus being studied in the absence of their local indicates that the addition of functional can be used a model to study post- environment that often includes interac- FSHrtoMSC-1cellsdoesnotcompensate transcriptional regulation of FSHR and tions with other cell types that may be for the loss of immune privilege. its signal transduction.30 However, regula- critical to the hypothesis being tested. Immune privilege involves a complex tion of inhibin-a expression in response Sertoli cells are well known to interact interplay between immunoregulatory toFSH was different from primary Sertoli with other cell types in the local environ- factors, the transplant environment and cells. In a separate study, the basal and ment and therefore these cells are parti- thehost’s immunesystem. Thus,addition cAMP regulated expression of PKA sub- cularly vulnerable to deficiencies of the of just one factor e.g., FSHr to a cell line units was compared in MSC-1 cells to rat isolated or enriched culture environment. does not make it immune-privileged. Sertoli cells.31 This study demonstrates ©Other s tud2ies h0ave i1dentifi2ed sev erLal tahat thne RIIβdmRNeA bassal lev elBs, magnii-oscAickneowledgnmentsce. potential pathways or factors that may tude of induction of RIIβ mRNA by This work was supported in part by NIH contribute to Sertoli cell immune pri- cAMP, half-life after cAMP removal and grant HD067400 (to JMD) from the vilege.13 For example, Sertoli cells express mRNA induction independent of protein Eunice Kennedy Shriver NICHD. The or secrete complement inhibitors, apo- synthesis is different from primary rat authors would like to thank Dr. Michael ptosis inhibitors and factors that modu- Sertoli cells.31 These results further Griswold (Washington State University) late the immune responDse. Thuos, it s eemns doemontstra te dthat eivensthotughra Siertboli ufor genteroeusly p.roviding the MSC-1FSHr likelythat acombinationof several factors cell line retains major characteristics of cells and Drs. James C. Hutson and is required to make Sertoli cells immune- primary Sertoli cells; they do not com- Sandra M. Whelly (TTUHSC) for criti- privileged. Overall, the MSC-1 cell line pletely replicate primary Sertoli cells. cally reading this manuscript. References 7. Fleckenstein E, Uphoff CC, Drexler HG. Effective 13. Doyle TJ, et al. Immunoprotective Properties of treatment of mycoplasma contamination in cell lines Primary Sertoli Cells in Mice: Potential Functional 1. Gómez-LechónMJ,DonatoMT,CastellJV,JoverR. with enrofloxacin (Baytril). Leukemia 1994; 8:1424- PathwaysThatConferImmunePrivilege.BiolReprod Human hepatocytes as a tool for studying toxicity 34;PMID:7520103 2011 Biol Reprod 2012; 86:1-14; PMID:21900683; and drug metabolism. Curr Drug Metab 2003; 4: 8. HayRJ,MacyML,ChenTR.Mycoplasmainfectionof http://dx.doi.org/10.1095/biolreprod.110.089425 292-312;PMID:12871046;http://dx.doi.org/10.2174/ cultured cells. Nature 1989; 339:487-8; PMID: 14. DufourJM,DassB,HalleyKR,KorbuttGS,DixonDE, 1389200033489424 2725683;http://dx.doi.org/10.1038/339487a0 RajotteRV.Sertolicelllinelackstheimmunoprotective 2. MacDonald C. Development of new cell lines for 9. Peschon JJ, Behringer RR, Cate RL, Harwood KA, properties associated with primary Sertoli cells. Cell animalcellbiotechnology.CritRevBiotechnol1990; IdzerdaRL,BrinsterRL,etal.Directedexpressionof Transplant2008;17:525-34;PMID:18714671;http:// 10:155-78;PMID:2202521;http://dx.doi.org/10.3109/ anoncogene toSertolicellsintransgenic miceusing dx.doi.org/10.3727/096368908785096033 07388559009068265 mullerian inhibiting substance regulatory sequences. 15. BarkerCF,BillinghamRE.Immunologicallyprivileged 3. Schurr MJ, Foster KN, Centanni JM, Comer AR, Mol Endocrinol 1992; 6:1403-11; PMID:1331774; sites. Adv Immunol 1977; 25:1-54; PMID:345773; Wicks A, Gibson AL, et al. Phase I/II clinical http://dx.doi.org/10.1210/me.6.9.1403 http://dx.doi.org/10.1016/S0065-2776(08)60930-X evaluation of StrataGraft: a consistent, pathogen-free 10. McGuinness MP, Linder CC, Morales CR, Heckert 16. WhitmoreWF,3rd,KarshL,GittesRF.Theroleof human skin substitute. J Trauma 2009; 66:866-73, LL,PikusJ,GriswoldMD.Relationshipofamouse germinal epithelium and spermatogenesis in the discussion873-4;PMID:19276766;http://dx.doi.org/ Sertolicellline(MSC-1)tonormalSertolicells.Biol privileged survival of intratesticular grafts. J Urol 10.1097/TA.0b013e31819849d6 Reprod1994;51:116-24;PMID:7918865;http://dx. 1985;134:782-6;PMID:2863395 4. Nelson-Rees WA, Daniels DW, Flandermeyer RR. doi.org/10.1095/biolreprod51.1.116 17. Cameron DF, Whittington K, Schultz RE, Selawry Cross-contaminationofcellsinculture.Science1981; 11. BraunKW,VoMN,KimKH.Positiveregulationof HP. Successful islet/abdominal testis transplantation 212:446-52;PMID:6451928;http://dx.doi.org/10.1126/ retinoic acid receptor alpha by protein kinase C and does not require Leydig cells. Transplantation 1990; science.6451928 mitogen-activated protein kinase in sertoli cells. Biol 50:649-53;PMID:2171164;http://dx.doi.org/10.1097/ 5. Capes-Davis A, Theodosopoulos G, Atkin I, Drexler Reprod2002;67:29-37;PMID:12079996;http://dx. 00007890-199010000-00024 HG, Kohara A, MacLeod RA, et al. Check your doi.org/10.1095/biolreprod67.1.29 18. Meinhardt A, Hedger MP. Immunological, paracrine cultures!Alistofcross-contaminatedormisidentified 12. DufourJM,VoMN,BhattacharyaN,OkitaJ,Okita and endocrine aspects of testicular immune privilege. cell lines. Int J Cancer 2010; 127:1-8; PMID: R,KimKH.Peroxisomeproliferatorsdisruptretinoic MolCellEndocrinol2011;335:60-8;PMID:20363290; 20143388;http://dx.doi.org/10.1002/ijc.25242 acidreceptoralphasignalinginthetestis.BiolReprod http://dx.doi.org/10.1016/j.mce.2010.03.022 6. JiangL,ZengX,WangZ,ChenQ.Celllinecross- 2003; 68:1215-24; PMID:12606456; http://dx.doi. contamination: KB is not an oral squamous cell org/10.1095/biolreprod.102.010488 carcinoma cell line. Eur J Oral Sci 2009; 117:90-1; PMID:19196324; http://dx.doi.org/10.1111/j.1600- 0722.2008.00599.x 4 Spermatogenesis Volume2Issue1 19. MitalP,KaurG,DufourJM.Immunoprotectivesertoli 25. Heckert LL, Griswold MD. The expression of the 29. Braun KW, Tribley WA, Griswold MD, Kim KH. cells:makingallogeneicandxenogeneictransplantation follicle-stimulatinghormonereceptorinspermatogene- Follicle-stimulating hormone inhibits all-trans-retinoic feasible. Reproduction 2010; 139:495-504; PMID: sis.RecentProgHormRes2002;57:129-48;PMID: acid-inducedretinoicacidreceptoralphanuclearlocaliza- 19995832;http://dx.doi.org/10.1530/REP-09-0384 12017540;http://dx.doi.org/10.1210/rp.57.1.129 tion and transcriptional activation in mouse Sertoli 20. Selawry HP, CameronDF. Sertolicell-enrichedfrac- 26. Barksdale EM, Jr., McGenis TG, Donahoe PK. cell lines. J Biol Chem 2000; 275:4145-51; PMID: tions in successful islet cell transplantation. Cell Gonadotropins moderate rejection of trophic-specific 10660575;http://dx.doi.org/10.1074/jbc.275.6.4145 Transplant1993;2:123-9;PMID:8143079 congenictestesgrafts.JPediatrSurg1991;26:886-92; 30. Eskola V, Ryhänen P, Savisalo M, Rannikko A, 21. KorbuttGS,ElliottJF,RajotteRV.Cotransplantationof PMID:1919978; http://dx.doi.org/10.1016/0022- Kananen K, Sprengel R, et al. Stable transfection of allogeneicisletswithallogeneictesticularcellaggregates 3468(91)90831-D the rat follicle-stimulating hormone receptor comple- allowslong-termgraftsurvivalwithoutsystemicimmuno- 27. SelawryHP,KotbM,HerrodHG,LuZN.Production mentaryDNAintoanimmortalizedmurineSertolicell suppression.Diabetes1997;46:317-22;PMID:9000711; ofafactor,orfactors,suppressingIL-2productionand line.MolCellEndocrinol1998;139:143-52;PMID: http://dx.doi.org/10.2337/diabetes.46.2.317 T cell proliferation by Sertoli cell-enriched prepara- 9705082; http://dx.doi.org/10.1016/S0303-7207(98) 22. SanbergPR,BorlonganCV,SaportaS,CameronDF. tions. A potential role for islet transplantation in an 00063-X Testis-derivedSertolicellssurviveandprovidelocalized immunologicallyprivilegedsite.Transplantation1991; 31. KnutsenHK,ReintonN,TaskénKA,HanssonV,Eskild immunoprotection for xenografts in rat brain. Nat 52:846-50;PMID:1949171;http://dx.doi.org/10.1097/ W.Regulation ofprotein kinaseA subunitsbycyclic Biotechnol1996;14:1692-5;PMID:9634853;http:// 00007890-199111000-00018 adenosine3',5'-monophosphateinamouseSertolicell dx.doi.org/10.1038/nbt1296-1692 28. SelawryHP,WhittingtonKB.Prolongedintratesticular line (MSC-1): induction of RII beta messenger ribo- 23. DufourJM,RajotteRV,SeebergerK,KinT,Korbutt isletallograftsurvivalisnotdependentonlocalstero- nucleic acid is independent of continuous protein GS.Long-termsurvivalofneonatalporcineSertolicells idogenesis.HormMetabRes1988;20:562-5;PMID: synthesis.BiolReprod1996;55:5-10;PMID:8793051; in non-immunosuppressed rats. Xenotransplantation 3143654;http://dx.doi.org/10.1055/s-2007-1010885 http://dx.doi.org/10.1095/biolreprod55.1.5 2003;10:577-86;PMID:14708526;http://dx.doi.org/ 10.1034/j.1399-3089.2003.00059.x 24. DufourJM,HemendingerR,HalberstadtCR,Gores P, Emerich DF, Korbutt GS, et al. Genetically engineered Sertoli cells are able to survive allogeneic transplantation.GeneTher2004;11:694-700;PMID: 14724669;http://dx.doi.org/10.1038/sj.gt.3302218 © 2012 Landes Bioscience. Do not distribute. www.landesbioscience.com Spermatogenesis 5

See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.