NCBI Blast:2 sequences (tRNA F3212) Page 1of 518 BLAST Basic Local Alignment Search Tool (cid:1) Your search parameters were adjusted to search for a short input sequence. Edit and ResubmitSave Search Strategies Formatting options Download 2 sequences (tRNA F3212) Results for: 1:lcl|1886 tRNA F3212(20bp) Your BLAST job specified more than one input sequence. This box lets you choose which input sequence to show BLAST results for. Query ID lcl|1886 lcl|1886 Description tRNA F3212 Molecule type nucleic acid Query Length 20 Database Name dbindex/9606/allcontig_and_rna Description Human build 37 RNA, GRCh37, and HuRef assemblies Program BLASTN 2.2.22+ Citation Reference Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Other reports: Search Summary[Taxonomy reports][Distance tree of results][Human genome view] Search Parameters Search parameter name Search parameter value Program blastn Word size 7 Expect value 1000 Hitlist size 100 Match/Mismatch scores 1,-3 Gapcosts 5,2 Filter string F Genetic Code 1 Database Database parameter name Database parameter value Posted date Dec 1, 2009 4:49 PM Number of letters 5,860,289,005 Number of sequences 47,542 Entrez query none Karlin-Altschul statistics Params Ungapped Gapped Lambda 1.37406 1.37406 K 0.710603 0.710603 H 1.30725 1.30725 Results Statistics Results Statistics parameter name Results Statistics parameter value http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 2of 518 Graphic Summary Distribution of 3594 Blast Hits on the Query Sequence [?] An overview of the database sequences aligned to the query sequence is shown. The score of each alignment is indicated by one of five different colors, which divides the range of scores into five groups. Multiple alignments on the same database sequence are connected by a striped line. Mousing over a hit sequence causes the definition and score to be shown in the window at the top, clicking on a hit sequence takes the user to the associated alignments. New: This graphic is an overview of database sequences aligned to the query sequence. Alignments are color-coded by score, within one of five score ranges. Multiple alignments on the same database sequence are connected by a dashed line. Mousing over an alignment shows the alignment definition and score in the box at the top. Clicking an alignment displays the alignment detail. http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 3of 518 Descriptions Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns) Genomic sequences NC_001807.4 Homo sapiens mitochondrion, complete genome 40.1 40.1 100% 0.015 100% NT_024862.14 Homo sapiens chromosome 17 genomic contig, GRCh37 40.1 90.7 100% 0.015 100% reference primary assembly NT_011630.14 Homo sapiens chromosome X genomic contig, GRCh37 reference 38.2 161 100% 0.057 100% primary assembly NT_011362.10 Homo sapiens chromosome 20 genomic contig, GRCh37 38.2 1413 100% 0.057 100% reference primary assembly NT_010718.16 Homo sapiens chromosome 17 genomic contig, GRCh37 38.2 743 100% 0.057 100% reference primary assembly NT_008705.16 Homo sapiens chromosome 10 genomic contig, GRCh37 38.2 1696 100% 0.057 100% reference primary assembly NT_167186.1 Homo sapiens chromosome 1 genomic contig, GRCh37 reference 38.2 1478 100% 0.057 100% primary assembly NW_001842370.2 Homo sapiens chromosome X genomic contig, alternate 38.2 88.7 100% 0.057 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838666.1 Homo sapiens chromosome 20 genomic contig, alternate 38.2 1012 100% 0.057 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838423.2 Homo sapiens chromosome 17 genomic contig, alternate 38.2 88.7 95% 0.057 100% assembly (based on HuRef), whole genome shotgun sequence NW_001837932.2 Homo sapiens chromosome 10 genomic contig, alternate 38.2 284 95% 0.057 100% assembly (based on HuRef), whole genome shotgun sequence NT_008413.18 Homo sapiens chromosome 9 genomic contig, GRCh37 reference 36.2 1166 100% 0.23 100% primary assembly NW_001839149.2 Homo sapiens chromosome 9 genomic contig, alternate 36.2 1114 100% 0.23 100% assembly (based on HuRef), whole genome shotgun sequence NT_025028.14 Homo sapiens chromosome 18 genomic contig, GRCh37 32.2 873 100% 3.5 100% reference primary assembly NT_010783.15 Homo sapiens chromosome 17 genomic contig, GRCh37 32.2 1912 100% 3.5 100% reference primary assembly NT_030059.13 Homo sapiens chromosome 10 genomic contig, GRCh37 32.2 2849 100% 3.5 100% reference primary assembly NT_167187.1 Homo sapiens chromosome 8 genomic contig, GRCh37 reference 32.2 1401 100% 3.5 100% primary assembly NT_025741.15 Homo sapiens chromosome 6 genomic contig, GRCh37 reference 32.2 2410 100% 3.5 100% primary assembly NT_032977.9 Homo sapiens chromosome 1 genomic contig, GRCh37 reference 32.2 2910 100% 3.5 100% primary assembly NW_001838470.1 Homo sapiens chromosome 18 genomic contig, alternate 32.2 258 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838450.2 Homo sapiens chromosome 17 genomic contig, alternate 32.2 208 90% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838403.1 Homo sapiens chromosome 17 genomic contig, alternate 32.2 531 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001837986.1 Homo sapiens chromosome 10 genomic contig, alternate 32.2 353 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839126.2 Homo sapiens chromosome 8 genomic contig, alternate 32.2 450 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838990.2 Homo sapiens chromosome 6 genomic contig, alternate 32.2 1658 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838589.2 Homo sapiens chromosome 1 genomic contig, alternate 32.2 406 100% 3.5 100% assembly (based on HuRef), whole genome shotgun sequence NT_011896.9 Homo sapiens chromosome Y genomic contig, GRCh37 reference 30.2 479 100% 14 100% primary assembly NT_011651.17 Homo sapiens chromosome X genomic contig, GRCh37 reference 30.2 991 100% 14 100% primary assembly NT_011520.12 Homo sapiens chromosome 22 genomic contig, GRCh37 30.2 1425 100% 14 100% reference primary assembly NT_113949.1 Homo sapiens chromosome 19 unlocalized genomic contig, 30.2 205 75% 14 100% GRCh37 reference primary assembly NT_011109.16 Homo sapiens chromosome 19 genomic contig, GRCh37 30.2 1337 100% 14 100% reference primary assembly http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 4of 518 NT_011295.11 Homo sapiens chromosome 19 genomic contig, GRCh37 30.2 841 100% 14 100% reference primary assembly NT_010859.14 Homo sapiens chromosome 18 genomic contig, GRCh37 30.2 718 100% 14 100% reference primary assembly NT_010799.15 Homo sapiens chromosome 17 genomic contig, GRCh37 30.2 303 100% 14 100% reference primary assembly NT_010498.15 Homo sapiens chromosome 16 genomic contig, GRCh37 30.2 1688 100% 14 100% reference primary assembly NT_010393.16 Homo sapiens chromosome 16 genomic contig, GRCh37 30.2 1112 100% 14 100% reference primary assembly NT_024524.14 Homo sapiens chromosome 13 genomic contig, GRCh37 30.2 1877 100% 14 100% reference primary assembly NT_029419.12 Homo sapiens chromosome 12 genomic contig, GRCh37 30.2 2499 100% 14 100% reference primary assembly NT_033899.8 Homo sapiens chromosome 11 genomic contig, GRCh37 30.2 1203 100% 14 100% reference primary assembly NT_167190.1 Homo sapiens chromosome 11 genomic contig, GRCh37 30.2 1545 100% 14 100% reference primary assembly NT_009237.18 Homo sapiens chromosome 11 genomic contig, GRCh37 30.2 1814 100% 14 100% reference primary assembly NT_008046.16 Homo sapiens chromosome 8 genomic contig, GRCh37 reference 30.2 2101 100% 14 100% primary assembly NT_077531.4 Homo sapiens chromosome 8 genomic contig, GRCh37 reference 30.2 256 100% 14 100% primary assembly NT_023736.17 Homo sapiens chromosome 8 genomic contig, GRCh37 reference 30.2 307 100% 14 100% primary assembly NT_007914.15 Homo sapiens chromosome 7 genomic contig, GRCh37 reference 30.2 701 100% 14 100% primary assembly NT_007819.17 Homo sapiens chromosome 7 genomic contig, GRCh37 reference 30.2 1874 100% 14 100% primary assembly NT_016354.19 Homo sapiens chromosome 4 genomic contig, GRCh37 reference 30.2 2904 100% 14 100% primary assembly NT_016297.16 Homo sapiens chromosome 4 genomic contig, GRCh37 reference 30.2 278 90% 14 100% primary assembly NT_005612.16 Homo sapiens chromosome 3 genomic contig, GRCh37 reference 30.2 3681 100% 14 100% primary assembly NT_022135.16 Homo sapiens chromosome 2 genomic contig, GRCh37 reference 30.2 1332 100% 14 100% primary assembly NT_022171.15 Homo sapiens chromosome 2 genomic contig, GRCh37 reference 30.2 507 100% 14 100% primary assembly NT_022184.15 Homo sapiens chromosome 2 genomic contig, GRCh37 reference 30.2 2093 100% 14 100% primary assembly NT_004487.19 Homo sapiens chromosome 1 genomic contig, GRCh37 reference 30.2 1789 100% 14 100% primary assembly NW_001842380.1 Homo sapiens chromosome X genomic contig, alternate 30.2 105 95% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001841719.1 Homo sapiens unplaced genomic contig, alternate assembly 30.2 30.2 75% 14 100% (based on HuRef), whole genome shotgun sequence NW_001838745.1 Homo sapiens chromosome 22 genomic contig, alternate 30.2 855 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838501.2 Homo sapiens chromosome 19 genomic contig, alternate 30.2 177 85% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838498.2 Homo sapiens chromosome 19 genomic contig, alternate 30.2 345 95% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838496.1 Homo sapiens chromosome 19 genomic contig, alternate 30.2 254 85% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838491.1 Homo sapiens chromosome 19 genomic contig, alternate 30.2 258 95% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838483.2 Homo sapiens chromosome 19 genomic contig, alternate 30.2 226 95% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838461.1 Homo sapiens chromosome 18 genomic contig, alternate 30.2 618 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838454.2 Homo sapiens chromosome 17 genomic contig, alternate 30.2 576 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838448.1 Homo sapiens chromosome 17 genomic contig, alternate 30.2 576 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838430.2 Homo sapiens chromosome 17 genomic contig, alternate 30.2 78.8 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838326.2 Homo sapiens chromosome 16 genomic contig, alternate 30.2 54.5 75% 14 100% http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 5of 518 assembly (based on HuRef), whole genome shotgun sequence NW_001838400.2 Homo sapiens chromosome 16 genomic contig, alternate 30.2 30.2 75% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838073.2 Homo sapiens chromosome 13 genomic contig, alternate 30.2 303 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838061.2 Homo sapiens chromosome 12 genomic contig, alternate 30.2 1096 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838042.2 Homo sapiens chromosome 11 genomic contig, alternate 30.2 1051 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838028.2 Homo sapiens chromosome 11 genomic contig, alternate 30.2 731 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838022.2 Homo sapiens chromosome 11 genomic contig, alternate 30.2 1447 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001837987.2 Homo sapiens chromosome 10 genomic contig, alternate 30.2 555 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839139.2 Homo sapiens chromosome 8 genomic contig, alternate 30.2 103 90% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839122.2 Homo sapiens chromosome 8 genomic contig, alternate 30.2 177 90% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839120.1 Homo sapiens chromosome 8 genomic contig, alternate 30.2 30.2 75% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839078.1 Homo sapiens chromosome 7 genomic contig, alternate 30.2 175 95% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001839003.1 Homo sapiens chromosome 7 genomic contig, alternate 30.2 1002 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838921.1 Homo sapiens chromosome 4 genomic contig, alternate 30.2 1116 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838901.1 Homo sapiens chromosome 4 genomic contig, alternate 30.2 228 90% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838884.2 Homo sapiens chromosome 3 genomic contig, alternate 30.2 2404 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838848.1 Homo sapiens chromosome 2 genomic contig, alternate 30.2 155 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838818.2 Homo sapiens chromosome 2 genomic contig, alternate 30.2 404 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838769.1 Homo sapiens chromosome 2 genomic contig, alternate 30.2 1644 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838549.1 Homo sapiens chromosome 1 genomic contig, alternate 30.2 485 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838533.2 Homo sapiens chromosome 1 genomic contig, alternate 30.2 1069 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838579.2 Homo sapiens chromosome 1 genomic contig, alternate 30.2 1193 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838578.2 Homo sapiens chromosome 1 genomic contig, alternate 30.2 349 100% 14 100% assembly (based on HuRef), whole genome shotgun sequence NT_035014.4 Homo sapiens chromosome 9 genomic contig, GRCh37 reference 28.2 347 100% 55 100% primary assembly NT_008470.19 Homo sapiens chromosome 9 genomic contig, GRCh37 reference 28.2 2497 100% 55 100% primary assembly NT_008183.19 Homo sapiens chromosome 8 genomic contig, GRCh37 reference 28.2 1051 100% 55 100% primary assembly NT_167249.1 Homo sapiens chromosome 6 genomic contig, GRCh37 reference 28.2 301 95% 55 100% assembly alternate locus group ALT_REF_LOCI_7 NT_006316.16 Homo sapiens chromosome 4 genomic contig, GRCh37 reference 28.2 546 100% 55 100% primary assembly NW_001838336.2 Homo sapiens chromosome 16 genomic contig, alternate 28.2 103 90% 55 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838017.1 Homo sapiens chromosome 11 genomic contig, alternate 28.2 76.8 80% 55 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838010.1 Homo sapiens chromosome 10 genomic contig, alternate 28.2 76.8 95% 55 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838006.2 Homo sapiens chromosome 10 genomic contig, alternate 28.2 936 100% 55 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838878.1 Homo sapiens chromosome 3 genomic contig, alternate 28.2 667 100% 55 100% assembly (based on HuRef), whole genome shotgun sequence NW_001838877.2 Homo sapiens chromosome 3 genomic contig, alternate 28.2 1877 100% 55 100% assembly (based on HuRef), whole genome shotgun sequence http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 6of 518 Transcripts [show first] NM_001039.3 Homo sapiens sodium channel, nonvoltage-gated 1, gamma 30.2 30.2 75% 14 100% (SCNN1G), mRNA http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 7of 518 Alignments Select All Get selected sequencesDistance tree of resultsMultiple alignment >ref|NC_001807.4| Homo sapiens mitochondrion, complete genome Length=16571 Score = 40.1 bits (20), Expect = 0.015 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAGGGTTTGT 20 |||||||||||||||||||| Sbjct 3213 CACCCAAGAACAGGGTTTGT 3232 >ref|NT_024862.14| Homo sapiens chromosome 17 genomic contig, GRCh37 reference primary assembly Length=596398 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features flanking this part of subject sequence: 88671 bp at 5' side: hypothetical protein XP_002343544 Score = 40.1 bits (20), Expect = 0.015 Identities = 20/20 (100%), Gaps = 0/20 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAGGGTTTGT 20 |||||||||||||||||||| Sbjct 357359 CACCCAAGAACAGGGTTTGT 357378 Features flanking this part of subject sequence: 16769 bp at 3' side: hypothetical protein Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAG 13 ||||||||||||| Sbjct 129570 CACCCAAGAACAG 129582 Features flanking this part of subject sequence: 109205 bp at 5' side: hypothetical protein XP_002343544 Score = 24.3 bits (12), Expect = 862 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 9 AACAGGGTTTGT 20 |||||||||||| Sbjct 377893 AACAGGGTTTGT 377904 >ref|NT_011630.14| Homo sapiens chromosome X genomic contig, GRCh37 reference primary assembly Length=6136098 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features flanking this part of subject sequence: 20239 bp at 5' side: hypothetical protein LOC90736 39187 bp at 3' side: P antigen family, member 5 isoform 1 Score = 38.2 bits (19), Expect = 0.057 Identities = 19/19 (100%), Gaps = 0/19 (0%) Strand=Plus/Minus http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 8of 518 Query 2 ACCCAAGAACAGGGTTTGT 20 ||||||||||||||||||| Sbjct 2761932 ACCCAAGAACAGGGTTTGT 2761914 Features flanking this part of subject sequence: 408893 bp at 5' side: ubiquilin 2 19518 bp at 3' side: spindlin family, member 3 Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAG 13 ||||||||||||| Sbjct 4555160 CACCCAAGAACAG 4555172 Features flanking this part of subject sequence: 29427 bp at 5' side: TSPY-like 2 75281 bp at 3' side: hypothetical protein XP_002344235 Score = 24.3 bits (12), Expect = 862 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACA 12 |||||||||||| Sbjct 700634 CACCCAAGAACA 700645 Features in this part of subject sequence: IQ motif and Sec7 domain 2 isoform1 IQ motif and Sec7 domain 2 isoform 2 Score = 24.3 bits (12), Expect = 862 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Minus Query 7 AGAACAGGGTTT 18 |||||||||||| Sbjct 856974 AGAACAGGGTTT 856963 Features in this part of subject sequence: HECT, UBA and WWE domain containing 1 Score = 24.3 bits (12), Expect = 862 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 5 CAAGAACAGGGT 16 |||||||||||| Sbjct 1228362 CAAGAACAGGGT 1228373 Features in this part of subject sequence: Ras-related GTP binding B long isoform Ras-related GTP binding B short isoform Score = 24.3 bits (12), Expect = 862 Identities = 12/12 (100%), Gaps = 0/12 (0%) Strand=Plus/Plus Query 7 AGAACAGGGTTT 18 |||||||||||| Sbjct 3302372 AGAACAGGGTTT 3302383 >ref|NT_011362.10| Homo sapiens chromosome 20 genomic contig, GRCh37 reference primary assembly Length=31409461 Sort alignments for this subject sequence by: E value Score Percent identity Query start position Subject start position Features in this part of subject sequence: RAE1 (RNA export 1, S.pombe) homolog RAE1 (RNA export 1, S.pombe) homolog Score = 38.2 bits (19), Expect = 0.057 Identities = 19/19 (100%), Gaps = 0/19 (0%) Strand=Plus/Minus Query 2 ACCCAAGAACAGGGTTTGT 20 ||||||||||||||||||| Sbjct 26129611 ACCCAAGAACAGGGTTTGT 26129593 http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 9of 518 Features flanking this part of subject sequence: 31827 bp at 5' side: inhibitor of DNA binding 1 isoform b 1341 bp at 3' side: cytochrome c oxidase subunit IV isoform 2 Score = 28.2 bits (14), Expect = 55 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 3 CCCAAGAACAGGGT 16 |||||||||||||| Sbjct 421572 CCCAAGAACAGGGT 421559 Features in this part of subject sequence: lipopolysaccharide-binding protein precursor Score = 28.2 bits (14), Expect = 55 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Minus Query 1 CACCCAAGAACAGG 14 |||||||||||||| Sbjct 7201377 CACCCAAGAACAGG 7201364 Features flanking this part of subject sequence: 57488 bp at 5' side: zinc fingers and homeoboxes 3 83387 bp at 3' side: lipin 3 Score = 28.2 bits (14), Expect = 55 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 3 CCCAAGAACAGGGT 16 |||||||||||||| Sbjct 10087136 CCCAAGAACAGGGT 10087149 Features in this part of subject sequence: RAS-related protein RAB-22A Score = 28.2 bits (14), Expect = 55 Identities = 14/14 (100%), Gaps = 0/14 (0%) Strand=Plus/Plus Query 6 AAGAACAGGGTTTG 19 |||||||||||||| Sbjct 27110135 AAGAACAGGGTTTG 27110148 Features flanking this part of subject sequence: 4691 bp at 5' side: hypothetical protein LOC25980 211751 bp at 3' side: disks large-associated protein 4 isoform a Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAG 13 ||||||||||||| Sbjct 5044450 CACCCAAGAACAG 5044462 Features flanking this part of subject sequence: 779988 bp at 5' side: DEAH (Asp-Glu-Ala-His) box polypeptide 35 869333 bp at 3' side: transcription factor MAFB Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AGAACAGGGTTTG 19 ||||||||||||| Sbjct 8643278 AGAACAGGGTTTG 8643266 Features in this part of subject sequence: regulating synaptic membrane exocytosis 4 Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 4 CCAAGAACAGGGT 16 ||||||||||||| Sbjct 13597143 CCAAGAACAGGGT 13597155 Features flanking this part of subject sequence: 35545 bp at 5' side: phosphatidylinositol glycan anchor biosynthesis, class T ... 8399 bp at 3' side: WAP four-disulfide core domain 2 precursor http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010 NCBI Blast:2 sequences (tRNA F3212) Page 10 of 518 Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 3 CCCAAGAACAGGG 15 ||||||||||||| Sbjct 14286115 CCCAAGAACAGGG 14286103 Features in this part of subject sequence: eyes absent 2 isoform b eyes absent 2 isoform a Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 7 AGAACAGGGTTTG 19 ||||||||||||| Sbjct 15949290 AGAACAGGGTTTG 15949278 Features flanking this part of subject sequence: 20848 bp at 5' side: zinc finger protein 313 10059 bp at 3' side: snail 1 homolog Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 4 CCAAGAACAGGGT 16 ||||||||||||| Sbjct 18785630 CCAAGAACAGGGT 18785618 Features in this part of subject sequence: breast carcinoma amplified sequence 4 isoform b breast carcinoma amplified sequence 4 isoform c Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 1 CACCCAAGAACAG 13 ||||||||||||| Sbjct 19682154 CACCCAAGAACAG 19682166 Features flanking this part of subject sequence: 55189 bp at 5' side: hypothetical protein XP_002343767 27337 bp at 3' side: zinc finger protein 217 Score = 26.3 bits (13), Expect = 218 Identities = 16/17 (94%), Gaps = 0/17 (0%) Strand=Plus/Plus Query 2 ACCCAAGAACAGGGTTT 18 |||| |||||||||||| Sbjct 22357022 ACCCTAGAACAGGGTTT 22357038 Features flanking this part of subject sequence: 21669 bp at 5' side: hypothetical protein XP_002343752 12754 bp at 3' side: prefoldin subunit 4 Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Minus Query 5 CAAGAACAGGGTT 17 ||||||||||||| Sbjct 23007978 CAAGAACAGGGTT 23007966 Features flanking this part of subject sequence: 122000 bp at 5' side: prefoldin subunit 4 134785 bp at 3' side: docking protein 5 Score = 26.3 bits (13), Expect = 218 Identities = 13/13 (100%), Gaps = 0/13 (0%) Strand=Plus/Plus Query 3 CCCAAGAACAGGG 15 ||||||||||||| Sbjct 23153781 CCCAAGAACAGGG 23153793 Features flanking this part of subject sequence: 40544 bp at 5' side: RNA-binding region containing protein 1 isoform b 40289 bp at 3' side: high-mobility group box 1-like 1 http://blast.ncbi.nlm.nih.gov/Blast.cgi 2/24/2010
Description: