2016 Molecular Detection of Animal Viral Pathogens __ Bovine Coronavirus

6 Pages·2016·0.25 MB·English

317

35 Bovine Coronavirus

Dongyou Liu

35.1
INTRODUCTION

Bovine coronavirus (BCoV) is a single-stranded, positive-
sense RNA virus implicated in three distinct clinical syn-
dromes in cattle: (1) calf diarrhea (CD), (2) winter dysentery
(WD) with hemorrhagic diarrhea in adults, and (3) bovine
respiratory disease complex (BRDC) or shipping fever of
feedlot cattle. Given its common occurrence in dairy and beef
cattle farms worldwide and its negative impact on milk pro-
duction in dairy herds and weight gain in calves and adult
cattle, considerable efforts have been made in recent years
toward the elucidation of BCoV’s genetic characteristics,
epidemiology, transmission, clinical features, pathogenesis,
diagnosis, treatment, and prevention.

35.1.1 ClassifiCation

Coronaviruses
are
enveloped,
single-stranded,
positive-
sense RNA viruses classified in the family Coronaviridae,
order Nidovirales. Of the two subfamilies within the family
Coronaviridae, the subfamily Coronavirinae is separated into four
genera, Alphacoronavirus and Betacoronavirus naturally occur-
ring in bats and Deltacoronavirus and Gammacoronavirus resid-
ing primarily in birds and pigs, while the subfamily Torovirinae is
divided into two genera, Bafinivirus and Torovirus, being present
in fish and mammals (causing gastroenteritis in mammals such as
cattle, horses, and pigs, but rarely humans), respectively [1].
Currently, the genus Alphacoronavirus consists of at least
16 species: transmissible gastroenteritis virus, porcine respira-
tory CoV, canine CoV, feline infectious peritonitis virus, mink

CoV, rhinolophus bat CoV HKU2, miniopterus bat CoV 1A,
miniopterus bat CoV 1B, miniopterus bat CoV HKU8, human
CoV 229E (HCoV-229E), human CoV NL63 (HCoV-NL63),
porcine epidemic diarrhea virus (see Chapter 37), scotophi-
lus bat CoV 512, hipposideros bat CoV HKU10, rousettus bat
CoV HKU10, and mystacina tuberculata bat CoV [2].
The genus Betacoronavirus is divided into four lineages
(A–D). Lineage A includes rabbit CoV HKU14, human
CoV-OC43
(HCoV-OC43),
porcine
hemagglutinating
encephalomyelitis virus (PHEV), dromedary camel corona-
virus HKU23, canine respiratory CoV, bovine CoV, giraffe
CoV, sable antelope CoV, equine CoV (ECoV), human CoV-
HKU1 (HCoV-HKU1), murine hepatitis virus, rat CoV, and
China Rattus coronavirus HKU24. Lineage B contains severe
acute respiratory syndrome (SARS)-related palm civet CoV,
SARS-associated human CoV, SARS-related Chinese ferret
badger CoV, and SARS-related rhinolophus bat CoV HKU3.
Lineage C comprises Middle East respiratory syndrome CoV
(MERS-CoV), pipistrellus bat CoV HKU5, and tylonycteris
bat CoV HKU4. Lineage D consists of rousettus bat corona-
virus HKU9 [2–5].
The genus Deltacoronavirus contains wigeon CoV HKU20,
common moorhen CoV HKU21, night heron CoV HKU19,
bulbul CoV HKU11 (type species), munia CoV HKU13, mag-
pie–robin CoV HKU18, thrush CoV HKU12, white-eye CoV
HKU16, porcine CoV HKU15, and sparrow CoV HKU17 [2].
The genus Gammacoronavirus consists of infectious bron-
chitis virus (IBV), partridge CoV (IBV-partridge), turkey
CoV, peafowl CoV (IBV-peafowl), beluga whale CoV SW1,
and bottlenose dolphin CoV HKU22 [2].

CONTENTS

35.1 Introduction ......................................................................................................................................................................317
35.1.1 Classification.........................................................................................................................................................317
35.1.2 Morphology and Genome Organization...............................................................................................................318
35.1.3 Biology and Epidemiology ...................................................................................................................................318
35.1.4 Clinical Features and Pathogenesis ......................................................................................................................319
35.1.4.1 CD (calf scours) .....................................................................................................................................319
35.1.5 Diagnosis ..............................................................................................................................................................319
35.1.6 Treatment and Prevention.................................................................................................................................... 320
35.2 Methods ........................................................................................................................................................................... 320
35.2.1 Sample Preparation.............................................................................................................................................. 320
35.2.2 Detection Procedures........................................................................................................................................... 320
35.2.2.1 Conventional RT-PCR........................................................................................................................... 320
35.2.2.2 Real-Time RT-PCR............................................................................................................................... 321
35.3 Conclusion ....................................................................................................................................................................... 321
References................................................................................................................................................................................. 321

318
Molecular Detection of Animal Viral Pathogens

The genus Bafinivirus contains a single species white
bream virus and the genus Torovirus consists of equine toro-
virus (type species; formerly Berne virus), human torovirus,
porcine torovirus, and bovine torovirus (BoTV; formerly
Breda virus, BRV). Of particular relevance, BoTV is a
kidney-shaped virus associated with diarrhea in calves world-
wide (see Chapter 38) [1].
Interestingly, although coronaviruses in the subfamily
Coronavirinae do not usually produce clinical symptoms in
their natural hosts (bats and birds), accidental transmission
of these viruses to humans and other animals may result in
respiratory, enteric, hepatic, or neurologic diseases of variable
severity. Coronaviruses that have been shown to cause dis-
eases in humans include HCoV-229E (alphacoronavirus 1b),
HCoV-NL63 (alphacoronavirus 1b), HCoV-OC43 (betacoro-
navirus 2a), HCoV-HKU1 (betacoronavirus 2a), SARS-HCoV
(betacoronavirus 2b), and MERS-CoV (betacoronavirus 2c) [2].
Belonging to Lineage A, genus Betacoronavirus, subfamily
Coronavirinae, and family Coronaviridae, BCoV consists of a
single serotype that encompasses a diversity of strains/isolates
(e.g., BCoV Bubalus, BCoV cow, BCoV alpaca, bovine enteric
coronavirus, bovine respiratory coronavirus, human enteric
coronavirus 4408, sambar deer coronavirus, waterbuck coro-
navirus, and white-tailed deer coronavirus) that demonstrate
genetic and antigenic proximities to HCoV-OC43, PHEV, and
ECoV. Besides inducing diarrhea in newborn calves, WD with
hemorrhagic diarrhea in adult cattle, and respiratory tract
infections in calves and feedlot cattle, BCoV has the capacity
to cause transboundary infection/disease in buffalos, lamas,
alpacas, deer, and giraffes [6].
Phylogenetic examination of BoCV isolates reveals the
existence of two genomic clades (1 and 2). While reference
enteric BoCV strains and a vaccine strain belong to clade 1,
BCoV from respiratory tract, nasal swab, and bronchoalveolar
washing fluids belongs to clade 2. In addition, the respiratory
isolates from Oklahoma are further separated into three sub-
clades, 2a, 2b, and 2c [7,8].

35.1.2 Morphology and genoMe organization

BCoV possesses an enveloped, pleomorphic/spherical virion
of 65–210 nm in diameter, with a double layer of short (hem-
agglutinin) and long (spike) surface projections, the lat-
ter of which appear club-shaped and measure about 20 nm
in length. The lipoprotein envelope carries four structural
proteins: membrane (M) glycoprotein, spike (S) glycoprotein,
hemagglutinin–esterase (HE) glycoprotein, and small enve-
lope (E) protein. Beneath the envelope is a flexible and helical
nucleocapsid formed by nucleoprotein (N) in association with
the viral genome.
The genome of BCoV is a linear, nonsegmented, single-
stranded, positive-sense RNA of 31,028 nt and includes
13 open reading frames (ORFs) flanked by 5′- (nt 1–210) and 3′-
(nt 30,740–31,028) untranslated regions (UTRs). Its 5′-UTR is
capped, and its 3′-UTR contains a polyadenylated tail. Some over-
lappings are observed in ORF1a (nt 211–13,362, including stop
codon) and ORF1b (13,332–21,494); ORF4 (S, 23,641–27,732)

and ORF5 (Ns “4.9 kDa”, 27,722–27,811); ORF7 (Ns “12.7 kDa”,
28,106–28,435) and ORF8 (E, 28,422–28,676); and ORF10
(N, 29,393–30,739) and ORF11 (I, 29,454–30,077). Intergenic
sequences are identified in ORF1b and ORF2 (Ns 32 kDa,
21,504–22,340); ORF2 and ORF3 (HE, 22,352–23,626); ORF3
and ORF4; ORF5 and ORF6 (Ns “4.8 kDa”, 27,889–28,026);
ORF6 and ORF7; ORF8 and ORF9 (M, 28,691–29,383); and
ORF9 and ORF10] [9].
Comparison of genome sequences of two field isolates
of BCoV, representing respiratory (BCoV-R) and enteric
(BCoV-E) strains, respectively, revealed differences in
107 out of 31,028 positions, scattered throughout the genome
except the 5′-UTR. Differences in 25 positions are nonsyn-
onymous, leading to 24 amino acid changes in all proteins
except pp1b. The remaining 82 nucleotide differences do
not cause amino acid changes, although they might modu-
late phenotypic properties by affecting the RNA structure
and/or RNA interaction(s). Six replicase mutations are identi-
fied within or immediately downstream of the predicted larg-
est pp1a-derived protein, p195/p210. It is possible that single
amino acid changes within p195/p210 as well as within the
S glycoprotein may have contributed to the different pheno-
types of the BCoV isolates [9].
Of the five structural proteins (nucleocapsid [N], trans-
membrane, small envelope [E], hemagglutinin–esterase
[HE], and spike [S] proteins) encoded by the BCoV genome,
the N protein (50 kDa) is highly conserved and offers an ideal
target for molecular diagnostic application; the surface HE gly-
coprotein (120–140 kDa) acts a receptor destroying enzyme
(esterase) to reverse hemagglutination; and the outer surface
S glycoprotein (190 kDa, 1363 aa) forms large club (petal)-
shaped spikes on the surface of the virion. Cleavage of the
S protein by an intracellular protease between aa 768 and
769 results in a variable S1 N-terminal domain (subunit) and
a more conserved S2 C-terminal domain (subunit). The S1
subunit is involved in virus binding to host–cell receptors,
induction of neutralizing antibody expression, and hemagglu-
tinin activity. With a highly variable/mutable sequence, the S1
is associated with changes in antigenicity, tissue tropism, viral
pathogenicity, and host range [10]. Indeed, a single amino acid
change (A528V) within the BCoV S1 subunit has been shown
to confer resistance to VN [11]. The S2 is the transmembrane
subunit with a critical role in the mediation of fusion between
viral and cellular membranes. Interestingly, no consistent
differences are observed in the full-length S gene between
BCoV strains causing respiratory and enteric diseases [12].

35.1.3 Biology and epideMiology

BCoV has a predilection for intestinal and pulmonary epi-
thelial cells. First recognized as enteric pathogens (BCoV-E)
in association with CD and WD in adult cattle, BCoV was
also identified as respiratory pathogens (BCoV-R) in associa-
tion with BRDC or shipping fever of feedlot cattle. Although
BCoV strains causing enteric (BCoV-E) or respiratory
(BCoV-R) infection may show distinct biological properties
and host cell tropism, they are closely related antigenically

Downloaded by [Swinburne University of Technology - Australia] at 12:13 02 October 2016

319
Bovine Coronavirus

and genetically [13–17]. In fact, some BCoV strain may cause
simultaneous enteric and respiratory tract infections.
Transmission of BCoV is mainly through fecal–oral and
respiratory (aerosol) routes. As in the case of BRDC, BCoV
may enter the host via aerosol and undergo initial and exten-
sive replication in the nasal mucosa. Following ingestion of
mucus secretions containing large quantities of infectious
virus with protective coating, cattle with respiratory infec-
tion may develop gastrointestinal symptoms such as diarrhea.
Clinically or subclinically infected calves and young adult
cattle function as reservoirs for BCoV in the herd, with spo-
radical shedding of the virus in feces and nasal secretions [18].
BCoV has a widespread presence in both dairy and beef
cattle. WD has been described in Europe, North America, and
East Asia, with a peak incidence in winter, while CD and ship-
ping fever are found in various regions of the world [19–21].
Although BCoV outbreaks typically occur in autumn and win-
ter, severe cases of infection in adult cattle may also emerge in
warmer seasons. Economic losses due to BCoV infection are
attributable to dramatic reduction in milk yield in dairy herds
and loss of body condition in both calves and adults, with death
being a not uncommon outcome for affected calves.
Unlike many other coronaviruses that have restricted host
ranges, BCoV has the ability to cause transboundary infec-
tions. This is evidenced by the findings that bovine-like CoV
is present in sambar deer (Cervus unicolor), white-tailed deer
(Odocoileus virginianus), waterbuck (Kobus ellipsiprymnus),
elk (Cervus elephus), caribou (Rangifer tarandus), giraffe, water
buffalo calves, alpacas, and dogs [22–27], and that bovine-like
CoV is implicated in deer and waterbuck with bloody diarrhea
resembling WD in cattle. Furthermore, isolation of a BCoV-
like human enteric coronavirus-4408/US/94 from a child with
acute diarrhea highlights the public health impact of BCoV.
As an enveloped virus, BCoV is sensitive to detergents and
lipid solvents such as ether and chloroform. It is also inacti-
vated by conventional disinfectants, formalin, and heat [28].

35.1.4 CliniCal features and pathogenesis

With an incubation of 3–8 days, BCoV is implicated in enteric
disease in newly born calves (CD) and adult cattle (WD) as
well as respiratory tract infections of growing calves and
shipping fever pneumonia in feedlot cattle. Although BCoV
infection rarely causes death, its morbidity can be as high as
100%, contributing to sudden and dramatic reduction in milk
production and loss of body weight.

35.1.4.1 CD (calf scours)

BCoV infection in calves between the ages of 1 and 3 weeks
often produces gastrointestinal signs such as profuse diarrhea
(watery yellow, gray, or greenish containing blood or mucus),
dehydration, depression, weakness, weight loss, anorexia, con-
vulsions, and sometimes death. Notable lesions include colon
villous atrophy. Some calves (2–6 months of age) may develop
respiratory infection with a serous to purulent nasal dis-
charge, coughing, rhinitis, pneumonia, fever, and inappetence,

often with concurrent diarrhea. Sporadic shedding of virus in
nasal secretions and feces may begin 5 days after infection.
Secondary bacterial infections with other common respiratory
viruses (e.g., bovine rotavirus A), bacteria, and mycoplasms
may exacerbate clinical signs [2,29].
WD with hemorrhagic diarrhea in adults: BCoV infec-
tion in adults is normally subclinical, although it may cause
WD outbreaks in housed cattle over the winter months, with
a sudden onset of semiliquid, often hemorrhagic diarrhea,
leading to severe anemia, marked drop in milk production in
dairy herds, and death. Histopathologically, loss of surface
epithelial cells and necrosis of crypt epithelial cells in the
large intestine containing detectable virus particles are noted
[30–32].
BRDC or shipping fever: BCoV infection in young adult
feedlot cattle (6–10 months of age) may develop fever, cough-
ing, dyspnea, rhinitis, bronchopneumonia, anorexia, diarrhea,
and weight loss, accompanied by necrotizing lung lesions
(e.g., interstitial emphysema, bronchiolitis, and alveolitis).
Death of infected cattle may occur as a result of necrotizing
pneumonia. Shedding of respiratory BCoV in nasal secre-
tions and feces begins 4–10 days after infection, with nasal
shedding consistently preceding fecal shedding. Interestingly,
cattle with relatively high respiratory BCoV antibody ELISA
titers or neutralizing antibodies in serum are less likely to
shed respiratory BCoV [33,34].
The pathogenesis of BCoV-induced diarrhea lies in its
ability to destroy surface epithelial cells of the intestinal villi
in both the small and large intestines, with remarkable loss
of absorptive capacity, increase in the gut fluid volume, and
osmotic imbalance. This contributes to rapid loss of water
and electrolytes, hypoglycemia, lactic acidosis, hypervol-
emia, acute shock, cardiac failure, and death. The severity
of the disease is influenced by the host age, nutritional and
immune status, virus load, stresses, and copresence of other
pathogenic organisms. For example, the onset of BRDC may
be linked to coinfection with bovine respiratory syncytial
virus, parainfluenza-3 virus, bovine herpesvirus, and bovine
viral diarrhea virus that have the capacity to sabotage host’s
immune mechanisms. In addition, long-distance shipping
with cattle from multiple feedlots may create physical stresses
that compromise host’s immune defense against BCoV and
other pathogens, and also increase exposure of cattle to high
concentrations of new pathogens not previously encountered.
Chemotherapy (e.g., corticosteroids and dexamethasone) may
reduce the numbers of cells (CD4 and CD8 T cells) and levels
of cytokines that directly impact on host immune fitness.

35.1.5 diagnosis

BCoV is associated with CD, WD in adults, and BRDC (ship-
ping fever). Diagnosis of BCoV infection requires differentia-
tion from other diseases with similar symptoms. For example,
bovine rotavirus A (BRV), Escherichia coli, Salmonella
enterica, Giardia intestinalis, and Cryptosporidium parvum
are known to cause diarrhea in calves, while Mannheimia
haemolytica, Pasteurella multocida, Histophilus somni,

Downloaded by [Swinburne University of Technology - Australia] at 12:13 02 October 2016

320
Molecular Detection of Animal Viral Pathogens

Arcanobacterium pyogenes, and Mycoplasma are often
involved in bovine respiratory disease [35,36].
Although a presumptive diagnosis can be made on the
basis of history and clinical signs, definitive diagnosis of
BCoV infection relies on laboratory confirmation of the pres-
ence of virus particles/antigens and antiviral antibodies in
nasal secretions, feces, and tissues.
Virus isolation using the G clone of human rectal tumor
(HRT)-18 cells, or Vero cells, provides a useful way to diag-
nose BCoV infection [37].
Electron microscopy allows direct observation of BCoV
particles in feces and other samples. Typically, 5 g of feces
is resuspended in 25 mL of phosphate buffered saline (PBS)
and centrifuged at 5000 × g for 20 min. The clarified super-
natant (12 mL) is centrifuged again at 100,000 × g for 1 h, and
the resultant pellet is resuspended in 1 mL of water. Then,
5 µL of sample is mixed with 5 µL of 2% phosphotungstic
acid (pH 6.9), and 1 µL of the mixture is applied to the center
of a 300-mesh grid. The sample is side blotted with a piece
of torn filter paper to remove the majority of the sample, thus
leaving a fine layer to air dry. Samples are examined under a
microscope at 30,000× magnification [10].
Serological assays such as direct fluorescent antibody test,
virus neutralization (VN), hemagglutination inhibition, and
enzyme-linked immunosorbent assay (ELISA) enable detec-
tion of viral antigens and antiviral antibodies in nasal secre-
tions, feces, serum, and frozen or paraffin-embedded tissues
(trachea, lung, ileum, and colon) [10].
Nucleic acid amplification techniques such as PCR allow
sensitive detection of viral nucleic acids directly from clinical
specimens [38–46]. In particular, real-time reverse transcription
(RT)-PCR targeting conserved regions of the BCoV genome
(polymerase or N protein) facilitates rapid detection of divergent
strains [47,48]. In addition, sequence analysis of the S gene
facilitates subtyping of BCoV strains causing intestinal and
respiratory infections [49–53].

35.1.6 treatMent and prevention

Treatments of animals with BCoV infections are largely aimed
at alleviation of clinical symptoms, including intravenous fluid
therapy and provision of adequate colostrum intake in newborn
calves. In addition, isolation of calves with diarrhea and ventila-
tion of housing are helpful in reducing disease incidence.
Control of BCoV-related diarrhea is possible by vaccinating
calves on farm prior to shipping to auction barns or feedlots
with a live vaccine (ATCvet code QI02). Although no vaccines
are currently available to prevent BCoV-associated pneumonia
in young calves or in the BRDC of feedlot cattle, there is evi-
dence that intranasal (IN) vaccination of feedlot calves with a
modified live BCoV calf vaccine on entry to a feedlot reduces
the risk of treatment for BRDC in calves. In addition, IN
administration of a BCoV CD strain induces cross-protection
against field exposure to a respiratory BCoV [54,55]. Future
research on the combined use of strains representing CD, WD,
and respiratory isolates may open a way for a single broad-
spectrum BCoV vaccine against BCoV infections [10].

35.2 METHODS

35.2.1 saMple preparation

Samples (feces, fecal swabs, and nasal swabs) are collected
from suspected cases of gastrointestinal and/or respiratory
tract infections. Swabs are placed immediately after collec-
tion in 2 mL minimum essential media (MEM) containing
1000 U penicillin and 1 mg streptomycin. After transporta-
tion on dry ice, samples are mixed by pulse-vortexing for
15 s, and swabs are discarded. Sample suspensions are diluted
1:10 in MEM and centrifuged at 5000 rpm for 15 min at 4°C.
The clarified supernatants are transferred to sterile vials, and
aliquots of 140 μL are separated for RNA extraction using
QIAamp Viral RNA Extraction Kit (Qiagen).
Fecal suspensions (approximately 0.1 g of feces or 100 µL
in 1 mL 1× PBS, pH 7.5–8.0) are mixed for 1 min at 15 Hz on
a tissue lyser. Fecal suspension of 50 µL is mixed with 400 µL
of lysis solution, 1 µL of carrier RNA (1 µg/µL), and 1 µL of
exogenous internal positive control (XIPC) RNA (at 10,000
copies/µL) for 5 min at 15 Hz and centrifuged at 20,000 × g
for 3 min to generate the clarified lysate. The clarified lysate
(350 µL) is transferred to a 96-well, deep-well plate containing
20 µL of magnetic bead mix (10 µL of lysis/ binding enhancer
and 10 µL of RNA binding beads), and 200 µL of isopropa-
nol is added. The plate is loaded onto an automated magnetic
particle processor for nucleic acid purification: lysis/binding
for 5 min, one 2 min wash 1, one 2 min wash 2, 1 min dry
step, and a 3 min heated elution step at 70°C. Purified nucleic
acid is then denatured at 95°C for 5 min in a thermal cycler to
denature the double-stranded BRV RNA for RT-PCR.
Alternatively, feces are diluted in nuclease-free water
(Promega) at a ratio of 3:1 (v/v), and suspensions are centrifuged
at 5000 × g for 10 min at 4°C. RNA is extracted from 250 μL of
supernatant recovered using the TRIzol Reagent (Invitrogen),
and the RNA pellet is diluted in 30 μL of nuclease-free water
(Promega).
Tissues from the upper respiratory tract (nasal, pharyngeal
tissues, trachea) and lung, and tissues from the distal small
intestine and colon may be collected from suspect necropsied
disease cases. RNA is extracted from these tissues by using
Qiagen RNeasy Kit.

35.2.2 deteCtion proCedures

35.2.2.1 Conventional RT-PCR
Erles et al. [56] reported a gel-based RT-PCR for the
detection of BCoV RNA in clinical samples with prim-
ers from the spike-protein gene (Sp1: 5′-CTTATAAGT
GCCCCCAAACTAAA-3′, nt 25,277–25,300 and Sp2: 5′-CC
TACTGTGAGATCACATGTTTG-3′, nt 25,876–25,898), which
generate a specific product of 622 bp.
RT-PCR is conducted with SuperScript™ One-Step
RT-PCR Kit (Invitrogen) using the following cycling pro-
gram: RT at 50°C for 30 min, inactivation of Superscript II
RT at 94°C for 2 min, and 45 cycles of 94°C for 30 s, 55°C
for 30 s, and 68°C for 30 s, with a final extension at 68°C

Downloaded by [Swinburne University of Technology - Australia] at 12:13 02 October 2016

321
Bovine Coronavirus

for 10 min. PCR products are separated by electrophoresis in
1.5% agarose gels and visualized under UV light after ethid-
ium bromide staining [56,57].

35.2.2.2
Real-Time RT-PCR

Cho et al. [58] utilized primers BCVF and BCVR from the
spike (S) gene sequence for specific detection of BCoV. The
TaqMan probe BCVPb is labeled with 6-carboxyfluorescein
(FAM) at the 5′ end and with a nonfluorescent quencher
1 (NFQ1) at the 3′ end (Table 35.1).
RT-PCR mixture (25 μL) is prepared with AgPath-ID™
Multiplex RT-PCR Kit (Applied Biosystems), containing 5
μL extracted template, 500 nM each of BCVF and BCVR,
and 150 nM BCVPb.
Amplification and detection are carried out on an auto-
mated real-time PCR system (Smart Cycler® II, Cepheid, Inc.)
with the following cycling parameters: 50°C for 30 min, 95°C
for 15 min, and 35 cycles of 94°C for 15 s and 60°C for 60 s.
Samples with a Ct of 35 cycles or less are considered positive.

35.3
CONCLUSION

With a specific tropism for intestinal and pulmonary epithe-
lial cells, BcoV is associated with CD, WD in adult cattle, and
respiratory distresses in cattle of all ages. Economical losses
due to BCoV outbreaks are not limited by animal mortalities
(which can be as high as 80% in complicated cases), as dra-
matic reduction in milk yield in dairy herds and poor growth
in calves and cattle together with cost of veterinary care and
medications can add a significant burden on the affected farms.
Due to the fact that a number of other microbial pathogens
cause similar clinical signs, laboratory identification of BCoV
antigen, antibodies, and nucleic acids is essential for correct
diagnosis. In particular, the application of real-time RT-PCR
has made it possible to detect and identify BCoV with unprec-
edented sensitivity, specificity, and speed [59].

REFERENCES

1. Aita T et al. Characterization of epidemic diarrhea outbreaks
associated with bovine torovirus in adult cows. Arch Virol.
2012;157(3):423–431.

2. Woo PC et al. Novel betacoronavirus in dromedaries of the
Middle East, 2013. Emerg Infect Dis. 2014;20(4):560–572.

3. Vijgen L et al. Evolutionary history of the closely related
group 2 coronaviruses: Porcine hemagglutinating encepha-
lomyelitis virus, bovine coronavirus, and human coronavirus
OC43. J Virol. 2006;80:7270–7274.

4. Zhang J et al. Genomic characterization of equine coronavi-
rus. Virology. 2007;369(1):92–104.

5. Lau SK et al. Discovery of a novel coronavirus, China
Rattus coronavirus HKU24, from Norway rats supports
the murine origin of Betacoronavirus 1 and has implica-
tions for the ancestor of Betacoronavirus lineage A. J Virol.
2015;89(6):3076–3092.

6. Barros IN et al. A multigene approach for comparing geneal-
ogy of Betacoronavirus from cattle and horses. Sci World J.
2013;2013:349702.

7. Martínez N et al. Molecular and phylogenetic analysis of
bovine coronavirus based on the spike glycoprotein gene.
Infect Genet Evol. 2012;12(8):1870–1878.

8. Fulton RW, Ridpath JF, Burge LJ. Bovine coronaviruses from
the respiratory tract: Antigenic and genetic diversity. Vaccine.
2013;31(6):886–892.

9. Chouljenko VN, Lin XQ, Storz J, Kousoulas KG, Gorbalenya
AE. Comparison of genomic and predicted amino acid
sequences of respiratory and enteric bovine coronaviruses
isolated from the same animal with fatal shipping pneumonia.
J Gen Virol. 2001;82(12):2927–233.

10. Saif LJ. Bovine respiratory coronavirus. Vet Clin North Am
Food Anim Pract. 2010;26(2):349–364.

11. Yoo D, Deregt D. A single amino acid change within antigenic
domain II of the spike protein of bovine coronavirus confers
resistance to virus neutralization. Clin Diagn Lab Immunol.
2001;8:297–302.

12. Bidokhti MR et al. Tracing the transmission of bovine corona-
virus infections in cattle herds based on S gene diversity. Vet
J. 2012;193(2):386–390.

13. Hasoksuz M, Lathrop SL, Gadfield KL, Saif LJ. Isolation
of bovine respiratory coronaviruses from feedlot cattle
and comparison of their biological and antigenic prop-
erties with bovine enteric coronaviruses. Am J Vet Res.
1999;60:1227–1233.

14. Gelinas AM, Sasseville AM, Dea S. Identification of specific
variations within the HE, S1, and ORF4 genes of bovine coro-
naviruses associated with enteric and respiratory diseases in
dairy cattle. Adv Exp Medicine Biol. 2001;494:63–67.

15. Lin XQ, O’Reilly KL, Storz J. Antibody responses of cattle
with respiratory coronavirus infections during pathogenesis of
shipping fever pneumonia are lower with antigens of enteric
strains than with those of a respiratory strain. Clin Diagn Lab
Immunol. 2002;9:1010–1013.

16. Zhang X et al. Quasispecies of bovine enteric and respira-
tory coronaviruses based on complete genome sequences
and genetic changes after tissue culture adaptation. Virology.
2007;363(1):1–10.

17. Fulton RW et al. Enteric disease in postweaned beef calves
associated with Bovine coronavirus clade 2. J Vet Diagn
Invest. 2015;27(1):97–101.

18. Thomas CJ et al. Transmission of bovine coronavirus and
serologic responses in feedlot calves under field conditions.
Am J Vet Res. 2006;67:1412–1420.

19. Park SJ et al. Detection and molecular characteriza-
tion of calf diarrhoea bovine coronaviruses circulating in
South Korea during 2004–2005. Zoonoses Public Health.
2007;54(6–7):223–230.

20. Kanno T, Kamiyoshi T, Ishihara R, Hatama S, Uchida I.
Phylogenetic studies of bovine coronaviruses isolated in
Japan. J Vet Med Sci. 2009;71(1):83–86.

21. Stipp DT et al. Frequency of BCoV detection by a semi-nested
PCR assay in faeces of calves from Brazilian cattle herds.
Trop Anim Health Prod. 2009;41(7):1563–1567.

TABLE 35.1
Identity of Primers and Probe for Real-Time RT-PCR
Detection of BCoV

Primer/Probe
Sequence (5′–3′)

BCVFc
GCTACATCAATCTCAAGGACATTGGT
BCVRc
CTTAAAACAACTAGTCCCACATCCTGT
BCVPbc
FAM-TAAAAGCCATACATACCAAGGCCA-BHQ1

Downloaded by [Swinburne University of Technology - Australia] at 12:13 02 October 2016

322
Molecular Detection of Animal Viral Pathogens

22. Hasoksuz M et al. Biologic, antigenic, and full-length genomic
characterization of a bovine-like coronavirus isolated from a
giraffe. J Virol. 2007;81:4981–4990.
23. Hasoksuz M, Vlasova A, Saif LJ. Detection of group 2a coro-
naviruses with emphasis on bovine and wild ruminant strains.
Virus isolation and detection of antibody, antigen, and nucleic
acid. Methods Mol Biol. 2008;454:43–59.
24. Kaneshima T et al. The infectivity and pathogenicity of a group 2
bovine coronavirus in pups. J Vet Med Sci. 2007;69(3):301–303.
25. Alekseev KP et al. Bovine-like coronaviruses isolated from
four species of captive wild ruminants are homologous to
bovine coronaviruses, based on complete genomic sequences.
J Virol. 2008;82:12422–12431.
26. Decaro N et al. Characterisation of bubaline coronavirus
strains associated with gastroenteritis in water buffalo (Bubalus
bubalis) calves. Vet Microbiol. 2010;145(3–4):245–251.
27. Chung JY, Kim HR, Bae YC, Lee OS, Oem JK. Detection and
characterization of bovine-like coronaviruses from four spe-
cies of zoo ruminants. Vet Microbiol. 2011;148(2–4):396–401.
28. Mullis L, Saif LJ, Zhang Y, Zhang X, Azevedo MS. Stability
of bovine coronavirus on lettuce surfaces under household
refrigeration conditions. Food Microbiol. 2012;30(1):180–186.
29. Tsunemitsu H, Saif LJ. Antigenic and biological compari-
sons of bovine coronaviruses derived from neonatal calf
diarrhea and winter dysentery of adult cattle. Arch Virol.
1995;140:1303–1311.
30. Traven M et al. Experimental reproduction of winter dysen-
tery in lactating cows using BCV—Comparison with BCV
infection in milk-fed calves. Vet Microbiol. 2001;81:127–151.
31. Jeong JH et al. Detection and isolation of winter dysentery
bovine coronavirus circulated in Korea during 2002–2004.
J Vet Med Sci. 2005;67(2):187–189.
32. Natsuaki S et al. Fatal winter dysentery with severe anemia in
an adult cow. J Vet Med Sci. 2007;69(9):957–960.
33. Lathrop SL, Wittum TE, Loerch SC, Perino LJ, Saif LJ.
Antibody titers against bovine coronavirus and shedding of
the virus via the respiratory tract in feedlot cattle. Am J Vet
Res. 2000;61:1057–1061.
34. Hick PM et al. Coronavirus infection in intensively managed
cattle with respiratory disease. Aust Vet J. 2012;90(10):381–386.
35. Storz J et al. Isolation of respiratory bovine coronavirus, other
cytocidal viruses, and Pasteurella spp. from cattle involved in
two natural outbreaks of shipping fever. J Am Vet Med Assoc.
2000;216:1599–1604.
36. Fulton RW et al. Lung pathology and infectious agents in fatal
feedlot pneumonias and relationship with mortality, disease
onset, and treatments. J Vet Diagn Invest. 2009;21(4):464–477.
37. Hansa A et al. Isolation of bovine coronavirus (BCoV) in vero
cell line and its confirmation by direct FAT and RT-PCR. Pak
J Biol Sci. 2013;16(21):1342–1347.
38. Tsunemitsu H, Smith DR, Saif LJ. Experimental inoculation of
adult dairy cows with bovine coronavirus and detection of coro-
navirus in feces by RT-PCR. Arch Virol. 1999;144:167–175.
39. Cho KO et al. Cross-protection studies between respiratory
and calf diarrhea and winter dysentery coronavirus strains in
calves and RT-PCR and nested PCR for their detection. Arch
Virol. 2001;146:2401–2419.
40. Loa CC et al. Differential detection of turkey coronavi-
rus, infectious bronchitis virus, and bovine coronavirus
by a multiplex polymerase chain reaction. J Virol Methods.
2006;131(1):86–91.
41. Takiuchi E, Stipp DT, Alfieri AF, Alfieri AA. Improved detec-
tion of bovine coronavirus N gene in faeces of calves infected
naturally by a semi-nested PCR assay and an internal control.
J Virol Methods. 2006;131(2):148–154.

42. Asano KM et al. Multiplex semi-nested RT-PCR with exogenous
internal control for simultaneous detection of bovine coronavirus
and group A rotavirus. J Virol Methods. 2010;169(2):375–379.
43. Zhu W, Dong J, Haga T, Goto Y, Sueyoshi M. Rapid and sensi-
tive detection of bovine coronavirus and group a bovine rota-
virus from fecal samples by using one-step duplex RT-PCR
assay. J Vet Med Sci. 2011;73(4):531–534.
44. Fukuda M et al. Development and application of one-step
multiplex reverse transcription PCR for simultaneous detec-
tion of five diarrheal viruses in adult cattle. Arch Virol.
2012;157(6):1063–1069.
45. Schroeder ME et al. Development and performance evalua-
tion of calf diarrhea pathogen nucleic acid purification and
detection workflow. J Vet Diagn Invest. 2012;24(5):945–953.
46. Liang X, Chigerwe M, Hietala SK, Crossley BM. Evaluation
of Fast Technology Analysis (FTA) Cards as an improved
method for specimen collection and shipment targeting
viruses associated with Bovine Respiratory Disease Complex.
J Virol Methods. 2014;202:69–72.
47. Amer HM, Almajhdi FN. Development of a SYBR Green I
based real-time RT-PCR assay for detection and quantification
of bovine coronavirus. Mol Cell Probes. 2011;25(2–3):101–107.
48. Amer HM et al. A new approach for diagnosis of bovine coro-
navirus using a reverse transcription recombinase polymerase
amplification assay. J Virol Methods. 2013;193(2):337–340.
49. Hasoksuz M, Sreevatsan S, Cho KO, Hoet AE, Saif LJ.
Molecular analysis of the S1 subunit of the spike glycoprotein
of respiratory and enteric bovine coronavirus isolates. Virus
Res. 2002;84:101–109.
50. Jeong JH, Kim GY, Yoon SS. Molecular analysis of S gene
of spike glycoprotein of winter dysentery bovine corona-
virus circulating in Korea during 2002–2003. Virus Res.
2005;108:207–212.
51. Liu L et al. Molecular epidemiology of bovine coronavirus
on the basis of comparative analyses of the S gene. J Clin
Microbiol. 2006;44(3):957–960. Erratum in: J Clin Microbiol.
2006;44(5):1924.
52. Kanno T, Hatama S, Ishihara R, Uchida I. Molecular analysis
of the S glycoprotein gene of bovine coronaviruses isolated in
Japan from 1999 to 2006. J Gen Virol. 2007;88:1218–1224.
53. Takiuchi E, Alfieri AF, Alfieri AA. Molecular analysis of the
bovine coronavirus S1 gene by direct sequencing of diarrheic
fecal specimens. Braz J Med Biol Res. 2008;41(4):277–282.
54. Han MG, Cheon DS, Zhang X, Saif LJ. Cross-protection
against a human enteric coronavirus and a virulent
bovine enteric coronavirus in gnotobiotic calves. J Virol.
2006;80(24):12350–12356.
55. Plummer PJ et al. Effect of intranasal vaccination against
bovine enteric coronavirus on the occurrence of respiratory
tract disease in a commercial backgrounding feedlot. J Am Vet
Med Assoc. 2004;225:726–731.
56. Erles K, Toomey C, Brooks HW, Brownlie J. Detection of a
group 2 coronavirus in dogs with canine infectious respiratory
disease. Virology. 2003;310(2):216–223.
57. Decaro N et al. Detection of bovine coronavirus using a
TaqMan-based real-time RT-PCR assay. J Virol Methods.
2008;151(2):167–171.
58. Cho YI, Kim WI, Liu S, Kinyon JM, Yoon KJ. Development
of a panel of multiplex real-time polymerase chain reaction
assays for simultaneous detection of major agents causing calf
diarrhea in feces. J Vet Diagn Invest. 2010;22(4):509–517.
59. Cho KO, Hoet AE, Loerch SC, Wittum TE, Saif LJ. Evaluation
of concurrent shedding of bovine coronavirus via the respira-
tory tract and enteric route in feedlot cattle. Am J Vet Res.
2001;62:1436–1441.

Downloaded by [Swinburne University of Technology - Australia] at 12:13 02 October 2016