1.3 kilobases of the lung type I cell T1[agr] gene promoter mimics endogenous gene expression

13 Pages·1999·0.8 MB·English

DEVELOPMENTALDYNAMICS215:319–331(1999)
a
1.3 Kilobases of the Lung Type I Cell T1 Gene Promoter
Mimics Endogenous Gene Expression Patterns During
Development but Lacks Sequences to Enhance Expression
in Perinatal and Adult Lung
MARIAI. RAMIREZ,1*YU XIACAO,1 AND MARY C. WILLIAMS1,2
1ThePulmonaryCenter,DepartmentofMedicine,BostonUniversitySchoolofMedicine,Boston,Massachusetts
2ThePulmonaryCenter,DepartmentofAnatomy,BostonUniversitySchoolofMedicine,Boston,Massachusetts
ABSTRACT TheT1ageneisoneoffewmark- cis-elements for forkhead proteins (TGT3) (Hackett et
ers for the type I cell phenotype in the adult al., 1995; Zhou et al., 1996; Ye et al., 1997), thyroid
mammalian lung. Type I cells form a large, thin transcription factor-1 (TTF-1) (Kimura et al., 1996),
epitheliallayerthatfacilitatesgasexchangeand andSp1/Sp3(MarganaandBoggaram,1997)arepres-
transport of fluids between the air spaces and ent in the 21- to 2170-bp enhancer. These transcrip-
capillaries. The T1a gene has a complex pattern tion factors are believed to be important regulators of
ofdevelopmentalexpressioninlungandbrain;in lungmorphogenesis.
vitro studies indicate that expression is regu- RegulationofexpressionoftheT1ageneisespecially
lated in part by thyroid transcription factor 1, interesting,bothingeneralandinthecontextofthegas
forkhead proteins, and Sp1/Sp3 proteins. To ex- exchange area of the mammalian lung. The gene is
plore the mechanisms that confine T1a expres- developmentally regulated and changes from a wide-
sioninintactadultanimalstoalveolartypeIand spreadpatternofexpressioninearlyratembryos(e.g.,
choroidplexusepithelialcells,wegeneratedmice neuroepithelium of the central nervous system (CNS),
bearing a 1.3-kb T1a promoter-chloramphenicol lung epithelium, and other foregut derivatives) to a
acetyltransferase (CAT) gene. In situ hybridiza- highly restricted pattern in the adult (choroid plexus
tion and RNase protection assays show that the epithelium, ciliary epithelia of the eye, alveolar type I
1.3-kbpromoterconfersapatternofCATexpres- cells, osteoblasts) (Rishi et al., 1995; Williams et al.,
sionthatlargelymatchestheendogenousT1ain 1996). In the late fetal lung, type I cells undergo
embryos and mid-term fetuses in lung and cen- morphogenesis and T1a, having been gradually down-
tral nervous system. However, the 1.3-kb pro- regulatedintheupperairways,isrestrictedtothiscell
moter lacks elements important for perinatal type(Meneghettietal.,1996;Williamsetal.,1996).
up-regulationofT1ainthelungandmaintenance In alveolar injuries in adult rodents, type I cells are
of that expression in the adult lung and brain. preferentiallydamagedbutareregeneratedbydifferen-
ThefinaladultpatternofT1aexpressionmaybe tiation of the postmitotic progeny of nearby alveolar
directedbyelementsoutsidethe1.3-kbfragment, epithelialtypeIIcells(Evansetal.,1975).Thisdenovo
perhaps those 5’ to the 1.3-kb fragment as we acquisitionofthetypeIcellphenotypeismimickedby
show herein, or in 3’ and intronic regions. Dev typeIIcellswhenplacedinmonolayerculture.Invitro
Dyn1999;215:319–331. r1999Wiley-Liss,Inc. studies of isolated type II cells show that T1a can be
reversibly induced or repressed, depending on culture
Keywords: lung;brain;development;transgenic; conditions (Borok et al., 1998a). These features make
type I cells; alveoli; choroid plexus; T1a a good marker gene for studies on transcriptional
T1a; gas exchange; epithelium; pro- controloftypeIcelldifferentiationduringdevelopment
moter;transcription andinadultanimals.
ThetypeIandtypeIIcellstogetherformthealveolar
INTRODUCTION epithelium of the mammalian lung. Flattened type I
The 1.3 kb promoter of T1a, a gene expressed by cells,apparentlyunabletodivideinvivo(Weibel,1971),
facilitate the rapid exchange of gases between air and
alveolar epithelial type I cells of the adult lung, con-
blood and are important in the transepithelial water
tains regulatory elements important for tissue- and
permeability (Dobbs et al., 1998a). Cuboidal type II
cell-specific expression. Deletion, gel retardation, and
mutationalanalysisincelllines(Ramirezetal.,1997)
and primary alveolar epithelial cell cultures (Vander-
Grant sponsor: NHLBI; Grant number: HL47049; Grant sponsor:
biltandDobbs,1998)showthattworegions(2170-bp, FrancisFamiliesFoundation.
2789-bpto21.3-kbfragments)accountformostofthe *Correspondenceto:MariaI.Ramirez,ThePulmonaryCenterR-3,
80 East Concord Street, Boston, MA 02118. E-mail: mramirez@
transcriptional activity of this promoter in vitro. Our
bupula.bu.edu
previous study showed that functionally important Received1March1999;Accepted17May1999
r1999WILEY-LISS,INC.
320 RAMIREZETAL.
cellssynthesizeandsecretesurfactantandotherprod-
ucts (Mason and Voelker, 1998) and act as stem cells
that can proliferate and differentiate into type I cells
(Evansetal.,1975).Therelationshipbetweenthetwo
celltypesinadultanimals,therefore,isclearinterms
of adult cell lineage, but this relationship is less well
understoodintheembryo(Evansetal.,1975;Boroket
al.,1995;Dantoetal.,1995;Masonetal.,1997).
InvitroT1amRNAandproteinlevelsaremodulated
bysolublefactorsandchangesincellshapeinparallel
withothermarkersofalveolarepithelialcellphenotype
(Boroketal.,1998a).T1aremainsloworisreducedby
agents such as rat serum or KGF that promote reten-
tionofthetypeIIphenotype,e.g.,expressionofsurfac-
tant protein genes that are hallmarks of the type II
phenotype.MechanicalforcesalsoincreaseT1amRNA
expression while reducing surfactant protein expres-
sion in primary type II cell cultures (Gutierrez et al.,
1998). In vitro these changes in phenotype are revers-
ible.
These kinds of data generated in cell lines cannot
reveal exactly how T1a is regulated in vivo, however. Fig.1. A:Designofthe1.3-kbT1a-chloramphenicolacetyltransfer-
ase(CAT)CATtransgene.ThehatchedbarindicatestheT1apromoter
Forthatreason,wechosetousetransgenictechnology
fragmentunderstudy(-1251bpto1101bp).Thisfragmentwasinserted
toevaluatepromoterfunctioninaphysiologicalenviron-
intothepCATvectorcontainingtheCATcodingsequence(filledbar)and
ment.Thisapproachalsoprovidesawaytocharacter- theSV40smallTantigen(openbar)asdescribedintheExperimental
ize the molecular information required for the initial Procedures section. The black line indicates the 1386-bp fragment
onsetofgeneexpressionearlyindevelopment,anissue obtainedafterdigestionofgenomicDNAwithScaI.Thisfragmentwas
usedtoidentifytransgenicanimalsinSouthernblotanalysis.B:Trans-
for which tissue culture models are uninformative
genecopynumber.SouthernblotanalysisofgenomicDNA(5µg)isolated
(Brinster,1993). fromF1andF2miceusedintheseexperiments.Thecalibrationcurve
We therefore generated transgenic mice in which wasproducedbydigestingdifferentamountsof1.3-kbT1a-CATvectorin
1.3-kb promoter of the T1a gene drives expression of 5µgofcarrierDNAwithScaI.Themembranewashybridizedwithaprobe
for the CAT sequence as described in the Experimental Procedures
chloramphenicol acetyl transferase (CAT). By in situ
section.
hybridizationandRNaseprotectionassays(RPAs),we
demonstratethat1.3kboftheT1apromotercanconfer
mostifnotallofthecharacteristicexpressionpatterns
of the endogenous gene during early to mid-develop- CATTransgeneandEndogenousT1amRNA
ment.However,thisfragmentlackscis-elementsimpor- ExpressionDuringMouseDevelopment
tantforenhancingtheexpressionoftheT1ageneinthe By using in situ hybridization, immunohistochemis-
lung right before birth and for achieving the normal tryandWesternblots,wehavepreviouslyreportedthe
patterns of expression in adult lung and brain. In developmentalpatternsofexpressionofT1aintherat
principle, the missing elements could be 5’, 3’, or (Rishi et al., 1995; Williams et al., 1996) but were
intronic. Additional in vitro studies on a 10-kb 5’ uncertainwhethertheseobservationswouldpertainto
promoter fragment suggest that 5’upstream elements mouse.Forthatreason,weanalyzedtransgenicmouse
increasethespecificityforexpressioninlungepithelial embryos(11.5,15.5,and19.5day)byinsituhybridiza-
cells and are likely to provide additional regulatory tion for both CAT mRNAand endogenous T1a mRNA.
informationinvivo. We compared the two expression patterns on adjacent
tissue sections from the transgenic animals. The pat-
RESULTS terns of endogenous T1a mRNAexpression in murine
TransgenicMice
brain and lung are identical to those previously re-
Transgenicmicebearinga1.3-kbfragmentoftheT1a portedfortherat(Rishietal.,1995;Meneghettietal.,
promoterdrivingexpressionofCATreportergene(Fig. 1996;Williamsetal.,1996).
1A) were generated to define the promoter elements
thatregulateT1agenetranscriptioninvivo.Fourteen Lung
foundermiceweregenerated.BySouthernblotanaly- Developmentofthelunginmicestartsatday9–10of
sis, these animals were shown to contain one or two gestation as an epithelial evagination from the poste-
copies of the transgene per genome (data not shown). rior pharyngeal wall into undifferentiated mesen-
One mouse bearing one copy per genome was bred to chyme.Byday11.5,formationoflunglobeshasalready
generate a line that was used in most of the studies been initiated and the first branches of the main
(Fig.1B). bronchi are observed (Ten Have-Opbroek, 1991; Kauf-
TRANSCRIPTIONALCONTROLOFT1aEXPRESSIONINTRANSGENICMICE 321
whole brain is reduced compared with the 11.5 brain,
and the grains are more concentrated in some regions
such as the forming choroid plexus. T1a and CAT
mRNAlevelsaredown-regulatedinlatebraindevelop-
ment. This down-regulation is clearly seen in the T1a
andCATRPAanalysesoftotalbrainRNA(seebelow).
Thisissimilartotheratinwhich,byfetalday16,T1a
protein expression in the neural derivatives is greatly
diminished but still detectable at low concentrations
(Williamsetal.,1996).
OtherTissues
Gut derivatives.Transgenic embryos show expres-
sion of CAT in the forming stomach by day 11.5 of
development(Fig.6A).Expressionisalsodetectablein
theepitheliallayeroftheforminggut,intheprimitive
smooth muscle (Fig. 6B), and in the pancreas on day
Fig. 2. In situ hybridization analysis of an 11.5-day embryo shows
15.5(Fig.6C,D).Byinsituhybridization,theseorgans
transgene expression. The pattern and timing of expression at this
developmentalagemimicsthatoftheendogenousT1agene.Chloram- are negative for endogenous T1a mRNA(Fig. 6E). We
phenicolacetyltransferase(CAT)mRNAwasdetectedintheepitheliumof havepreviouslyshowninday-13ratembryosthatT1a
theforminglungandstomach(smallarrowheads)andtheneuroepithe- isexpressedintheprimitivestomach;intheadultrat,
liumoftheformingbrainvesiclesandspinalcord(largearrowheads).The T1amRNAisdetectedinintestineafterasecondround
circlemarksbirefringentredbloodcellsintheheart,whichisnegativefor
transgeneexpression.Originalmagnification,320. of amplification by reverse transcription-polymerase
chain reaction (PCR) by using nested oligonucleotides
(Rishietal.,1995).
man,1992).Insituhybridizationofsagittalsectionsof Salivary gland.In situ hybridization showed that
11.5 day embryos shows binding of both CAT (Figs. 2, theepitheliumofsalivaryglandandductsexpressboth
3A,B) and T1a riboprobes (data not shown) to the endogenousT1aandtheCATtransgenebyday15.5of
epithelium of the forming bronchi, similar to the pat- gestation. In rat, expression in salivary gland has not
ternsshownin14dayratembryos(Rishietal.,1995). beenobservedbyinsituhybridization.
By day 15.5, terminal bronchioles are formed within Formingbones.TwogeneshomologoustoT1awere
which endogenous T1a mRNA could be detected (Fig. cloned from osteoblastic cell lines. Mouse OTS-8 gene
3D,E).HighlevelsofCATmessagearedetectedinthe (Noseetal.,1990)andratE11gene(Wetterwaldetal.,
lungatthisgestationalage(Fig.3C),althoughthereis 1996) were shown to be expressed in osteoblasts and
a higher level of expression in the main bronchi com- newly embedded osteocytes. In our present in situ
pared with the more distal bronchioles. No signal for hybridizationexperiments,wedetectedCATandendog-
eitherCATorT1amRNAisdetectableinmesenchymal enous T1a mRNA in the cartilage primordium of the
tissue surrounding the lining epithelial cells of the developingribsbyday15.5(Fig.3C,E).
bronchi/bronchiolesandalveoliatanygestationalage. Hair follicles.15.5-day embryos express CAT and
endogenousT1aintheepitheliallayeroftheprimordial
NeuralDerivatives folliclesofthevibrissa(Fig.4A,C).
ThepatternsofexpressionofT1aandCATmRNAsin
T1aandCATmRNAExpressioninAdultTissues
the CNS appear to be identical throughout mouse
development. Endogenous T1a and CAT mRNAs are T1amRNAiseasilydetectedbyNorthernblotoftotal
detectedintheneuroepitheliumoftheformingvesicles, RNA of adult mouse lung and brain (Fig. 7C) (rat
inthespinalcord,andinthedorsalrootgangliaofthe expression,Rishietal.,1995).AnalysisofCATmessage
11.5daymouseembryos.ExpressionlevelsintheCNS by Northern blot and in situ hybridization shows no
are very high compared with that of the epithelium of detectable signal, suggesting that the level of CAT
the forming lung bud (Figs. 2, 4A–C). This pattern of mRNAexpressionislowerthanthatoftheendogenous
expressionisthesameasthatfoundintheratembryos T1a. Therefore, we studied expression of the CAT
of the corresponding developmental age (Rishi et al., transgene by RPA of total RNA purified from adult
1995;Williamsetal.,1996). transgenic tissues. Because of its greater sensitivity,
Onday15.5ofgestation,mouseembryoscontinueto RPA permits a semiquantitative comparison of the
expressendogenousT1amRNAintheneuroepithelium expressionindifferenttissues.AnalysisbyRPAforCAT
(not shown) and a high concentration of grains is infourdifferenttransgeniclinesshowthattheexpres-
detectedintheformingchoroidplexusepithelium(Fig. sioninadultlungwaslowinalllines(datanotshown).
5F).Thus,CATmRNAmatchestheexpressionpattern The level of endogenous T1a mRNAin adult mouse
andtimingoftheendogenousgene(Fig.5A,B,D,E).The lungissignificantlyhigherthanthelevelofexpression
relativenumberofcellsexpressingT1aandCATinthe inbrain(Fig.7C),similartothatreportedinrat(Rishi
322 RAMIREZETAL.
Fig. 3. In situ hybridization for chloramphenicol acetyltransferase formingribs(smallarrowheads).Originalmagnification,350.D:Phase
(CAT)andendogenousT1amRNAsinthelung.A:Darkfieldimageofa imageofC.Originalmagnification,350.E:Darkfieldimageofa15.5-day
11.5-day embryo expressing CAT mRNA; lung epithelial layer (arrow- embryoexpressingT1amRNA;epitheliumofthedistalairways(arrow-
heads),birefringentredbloodcellsinheart,liver,andaorta(diamonds). heads). Original magnification, 350. The 1.3-kb promoter confers the
Originalmagnification,3130.B:PhaseimageofA.Originalmagnifica- correcttimingofonsetofexpressioninthelung.Onday15.5,CATand
tion, 3130. C: Darkfield image of a 15.5-day embryo expressing CAT T1acanbedetectedinthedistalairways,althoughthereisadelayinthe
mRNA;epitheliallayerinupperanddistalairways(largearrowheads)and down-regulationofCATexpressionintheproximalairways.
TRANSCRIPTIONALCONTROLOFT1aEXPRESSIONINTRANSGENICMICE 323
etal.,1995).AnalysisofCATexpressionshowsthatthe
relativeamountofCATmessageinthelungisreduced
comparedwithbrain(Fig.7A,B).Theseresultssuggest
that,althoughthe1.3-kbfragmentoftheT1apromoter
directs transcription of the T1a gene at the correct
developmental time and sustains expression through-
out development in both lung and brain, it lacks
information to drive the expected enhancement of the
expressioninadultlung.
T1aandCATmRNAExpressioninPerinatal
LungandBrain
We analyzed CAT and endogenous T1a mRNA by
RPAduringtheperinatalperiodtodeterminewhether
the1.3-kbpromoterhastheelementsthatup-regulate
the expression of T1a before birth. The assay was
performedontotalRNApurifiedfromlungandbrainof
16.5-day and 19.5-day embryos, 3-day-old newborns,
and adults. We observed that, in the lung, the trans-
gene is not up-regulated before birth as is the endog-
enous gene and the level of expression remains low as
in16.5dayembryoniclung(Fig.8A,B).Inbrain,onthe
other hand, the pattern of expression of CAT mRNA
matchestheendogenousT1aineverystagestudiedby
RPA(Fig.8C,D).
DeletionStudiesofthe10-kbT1aPromoterin
LungEpithelialandFibroblastCellLines
TheaboveRPAsindicatethatcriticalinformationfor
up-regulationofT1amRNAexpressionbeforebirthand
in the adult lung is absent from the 1.3-kb promoter
under study. To test sequences upstream of the 1.3-kb
promoter, two positive clones containing ,80-kb ge-
nomicDNAwereobtainedbyPCRscreeningofaP1rat
library with two oligonucleotides spanning part of the
T1a 5’ untranslated region and first exon (Genome
Systems, Inc., St. Louis, MO). After verifying by PCR
that the clones contained the 1.3-kb promoter already
cloned and sequenced in our laboratory, a restriction
map of one of the clones was produced to identify
smaller fragments to be used in expression studies.
Threeconstructs,containing10kb,5kb,and2.5kbof
theT1a5’flankingregiondrivingluciferaseexpression,
were generated and their transcriptional activity was
tested in SV40 TII, MLE-15, and IMR-90 cell lines
(Ramirez et al., 1997) and compared with the 1.3-kb
promoter(Ramirezetal.,1997)(Fig.9).Inlungepithe-
lialcells,activityishigherthaninIMR-90cellsforall
constructs.The10-kbfragmenthasanactivitysimilar
tothe1.3-kbpromoterinMLE15,althoughinSV40TII
cells the 10-kb fragment has half of the activity of the
1.3-kb fragment. In IMR-90 cells, the activity, usually
lowerthaninSV40TIIcells,isstepwisereducedfrom
44-fold to 10-fold over background when promoter
Fig. 4. In situ hybridization for chloramphenicol acetyltransferase
(CAT) and endogenousT1a mRNAs in 11.5-day embryonic brain.The fragments from 1.3 kb to 10 kb were tested. These
1.3-kbpromotercanconferthesamepatternofCATmRNAexpressionas studies show that the 10-kb fragment is more specific
thatoftheendogenousT1aatthisdevelopmentalage.A:Darkfieldimage for epithelial cells than for fibroblasts compared with
of CAT mRNA. B: Phase image. C: Darkfield image of T1a mRNA. 1.3kb,becauseexpressionofthe1.3kbis1.9-foldlower,
Arrowheadsindicateneuroepitheliumoftheformingbrain.Asectionofa
whereasthe10kbis4.5-foldlowerinIMR-90cellsthan
forebrain(diamond)thatwascutthroughtheependymallayerispositive
forthetransgene.Originalmagnification,350. inSV40TII.
324 RAMIREZETAL.
Fig. 5. In situ hybridization for chloramphenicol acetyltransferase epitheliumofthechoroidplexus(opentriangle).Originalmagnification,
(CAT)andendogenousT1amRNAsin15.5-dayembryonicbrain.The 325.C:T1amRNAisexpressedintheforminghairfollicles(arrowhead).
similarity between T1a and CAT expression patterns in the brain is Originalmagnification,340.D:Darkfieldimage.CATisexpressedinthe
maintainedduringgestation.A:CATmRNAisexpressedintheforebrain epitheliumofthechoroidplexus(arrowheadsinD,E).Originalmagnifica-
neuroepithelium(largearrowhead)aswellasforminghairfollicles(small tion,375.E:PhaseimageofD.Originalmagnification,375.F:T1ais
arrowheads).Originalmagnification,325.B:CATmRNAisexpressedin also expressed in the epithelium of the choroid plexus (arrowheads).
theneuroepitheliumoftheformingvesicles(largearrowhead)andinthe Originalmagnification,375.
DISCUSSION Ourlong-termgoalinstudiesoftheT1apromoteris
We show in these studies that the 1.3-kb T1a pro- to determine in detail how this gene is regulated, in
boththeembryoandadult,byusingT1aasaprototype
moter can direct the correct developmental decisions
ofthetypeIcellgenesandphenotype.Wehavepreviously
that result in appropriate patterns of gene expression
shownthatthe1.3-kbT1apromotercandirectpreferen-
inembryosandmid-termfetusesinlungandtheCNS.
Ingeneral,thecorrectexpressionofanygenerequires tialexpressioninvitroinlungepithelialcellscompared
regulation in space, time, and quantity such that the with fibroblasts (Ramirez et al., 1997). By using stan-
transcripts are expressed in appropriate cells and dard promoter deletion, gel retardation, and muta-
specific organs, at the correct developmental and/or tional analyses, we demonstrated that expression of
postnataltimes,andintheproperamount.Inveryfew reporter genes driven by the 1.3-kb promoter is regu-
cases have all of these aspects be studied for a single latedbymeansofSp1/Sp3,TTF-1,andTGT3elements.
gene. There are, however, a number of limitations to in
Anotable exception to this is the analysis of the sea vitro studies of promoter function including questions
urchinendo16geneinwhichcis-actingelementshave abouttherelevanceofstudiesincelllines,thegeneral
been identified that overall regulate where and when cellular milieu in vitro that may lack regulatory mol-
thegeneisexpressedandhowmuchmRNAorprotein eculesofthenormalinvivoenvironment,andothers.In
product is produced (Yuh et al., 1998). This elegant addition, in vitro studies provide little insight into
analysisdemonstratestheconsiderableeffortrequired regulationofthenormalpatternsofexpressionduring
to understand regulation of even a single gene. It also embryonic gene induction at the time of cell specifica-
illustrates the complexity of the network of transcrip- tionandorganogenesis,aparticularlyimportantissue
tionfactorsandcis-elements,bothactivatorsandrepres- forunderstandingregulationofT1aexpression.
sors acting combinatorially, that control synthesis of a TheT1agenehasacomplexpatternofdevelopmen-
geneproduct,inthiscaseendo-16transcripts. talexpression(Rishietal.,1995;Williamsetal.,1996)
TRANSCRIPTIONALCONTROLOFT1aEXPRESSIONINTRANSGENICMICE 325
Fig. 6. Expression of chloramphenicol acetyltransferase (CAT) and image of C; birefringent red blood cells (asterisks in C,D). Original
T1agenesinothertissuesduringdevelopment.A:CATexpressioninthe magnification,395.E:EndogenousT1aisnotdetectedinthepancreatic
epitheliallayerofthe11.5-dayembryonicstomach(arrowhead).Original epithelium. Original magnification, 3100. F: Darkfield image of CAT
magnification,350.B:CATexpressioninthe15.5-dayembryonicgut; expressioninthebranchingepitheliumofthesalivarygland(arrowheads).
epitheliallayer(largearrowheads);primitivesmoothmusclecells(small Originalmagnification,360.G:PhaseimageofF.Originalmagnification,
arrowheads), P, pancreas. Original magnification, 335. C: Darkfield 360.H:EndogenousT1aexpressioninthesalivarygland(arrowheads).
image of CAT expression in the epithelium of the 15.5-day embryonic Originalmagnification,360.
pancreas (arrowheads in C,D). Original magnification, 395. D: Phase
both as to timing of expression and to sites of expres- thechoroidplexusepitheliumandciliaryepitheliumof
sion.Itinvolvesbothhighlevelsofgeneactivationand theeyewhereexpressionissustainedinadults.
repression in several different tissue sites and organs. In the lung the pattern of expression is largely
Wehavepreviouslypublisheddetailedinsituhybridiza- reversedfromthatoftheCNS.Asistruefortheearly
tion and immunohistochemical studies that map out embryonic CNS, T1a transcripts can be detected very
sitesofT1aexpressioninembryonicandadultrats.In early in rodent development at the time the lung bud
summary, T1a mRNA and protein are found at high forms from the foregut. In contrast to the CNS, which
levels throughout the neuroepithelium of the forming containshighlevelsofbothproteinandmRNAinearly
brainandspinalcordinearlyembryos(day10rat).By development,expressionislowinthelunguntilthelast
mid-gestation, expression in the nervous system is 2–3daysofgestationwhenthereisadramaticincrease
greatlydiminished,presumablybyrepressionorlossof inamountofbothmRNAandprotein.Thus,asexpres-
genetranscriptionduetomethylation,resultinginloss sion in the fetal CNS decreases and is extinguished,
of expression in the entire nervous system, excepting expressioninthelungincreases.Thatbothpositiveand
326 RAMIREZETAL.
Fig.7. Chloramphenicolacetyltransferase(CAT)andT1amRNA
expressioninadulttissues.A:TotalRNA(20µg)purifiedfromadult
tissues was analyzed by RNase protection assay by using a CAT
probe. C, control SV40T II cells transfected with 1.3-kb T1a-CAT
construct;H,heart;K,kidney;S,salivarygland;L,lung;B,brain.B:
Thedatashowthemean6SEofthedensitometricanalysisoffour
differentmice.ThelowlevelofCATexpressioninthelungsuggests
thatthe1.3-kbpromoterlackselementscriticalfortranscriptioninthe
adultlung.C:TotalRNA(10µg)fromadulttissueswasanalyzedby
NorthernblotbyusingaT1acDNAprobe.
negative regulation occur simultaneously in the em- patterns in a mouse line carrying a 10-kb promoter-
bryoindifferentorganssuggeststhatthesechangesare CAT transgene.An additional, level of regulation may
not hormonally induced or due to other circulating be provided by mechanisms of gene regulation other
molecularsignals.Inadditiontoexpressioninlungand than direct interaction with DNAof protein transcrip-
brain in normal animals, T1a is also expressed in the tion factors. Preliminary data from our lab indicate
formingstomachandotherforegutderivatives,butitis that the T1a gene is silenced by methylation in some
notexpressedintheseorgansintheadult.T1aexpres- nonexpressing cell lines. Thus, we currently believe
sion in rat fetal kidney was detected by immunostain- thatMLE15cellscontaintranscriptionfactorsthatcan
ing and a very low level of expression was detected by activate transfected promoter constructs; they do not
nestedPCRinadultratkidney(Williamsetal.,1996). express endogenous T1a, probably because the proxi-
Similarly, we detected a very low level of T1a expres- malpromoterofthegeneismethylated.
sion in mouse adult kidney. There is no expression in The perinatal period is a critical one for successful
liverineitherembryosoradults. lungdevelopmentbecauseitmarksthetransitionfrom
By using transgenic technology, we now show that afluid-filledtoanair-breathinglung.Anumberofother
the 1.3-kb promoter carries information that confers lunggenesinducedearlyindevelopment,includingthe
the correct timing of onset of expression and approxi- surfactant-associated proteins (Rooney et al., 1994;
mately normal patterns of expression during develop- McGowan et al., 1997), undergo a dramatic up-
ment. The 1.3-kb promoter lacks, however, regulatory regulationimmediatelybeforebirth.Insomecases,the
activitythatcontrolsperinatalchangesinexpressionin signal for the increased perinatal gene expression
lung and brain, the major sites of expression in the appears to be a rise circulating glucocorticoids (Pierce
adult animal. These observations suggest that ele- etal.,1995;Yeeetal.,1996).Sequenceanalysisshows
mentswedefinedearlierinthe1.3-kbpromoterarenot that the 1.3-kb T1a promoter lacks glucocorticoid re-
fundamentallyinvolvedintheperinatalandpostnatal sponse elements (GREs), although we currently lack
changesinT1aexpression,atleastwithoutinputfrom detailedinformationonmore5’sequences.
regulatory information 5’ to those in the 1.3-kb frag- There are a few minor differences between the pat-
ment.Basedondeletion-expressionstudiesofthe10-kb ternsoftransgeneexpressionweobservedandthoseof
promoter, we can also conclude that there are addi- theendogenousgene.Inparticular,wenotedadelayin
tional important elements yet to be identified in the the down-regulation of transgene expression in the
region5’tothe1.3-kbpromoterandperhapsinintronic proximalairwaysofthedevelopinglungaspartofthe
or 3’ regions. We are currently analyzing expression process that targets the final site of T1a to alveoli.As
TRANSCRIPTIONALCONTROLOFT1aEXPRESSIONINTRANSGENICMICE 327
Fig. 8. Perinatal expression of chloramphenicol acetyltransferase showthatelementsthatup-regulateT1aexpressioninthelungbefore
(CAT)andT1agenesinlungandbrain.A:RNaseprotectionassayoflung birthareabsentinthe1.3-kbpromoterfragment.dpc,dayspostcoitum.C:
RNAisolatedfrom16.5-and19.5-dayembryos,3-day-oldpostnatal,and Same analysis as in A but using brain total RNA. D: Densitometric
adultmice.TenmicrogramsoftotalRNAwerehybridizedwithT1aorCAT analysisoffourdifferentbrainsofeachdevelopmentalage.Endogenous
probesasdescribedintheExperimentalProceduressection.B:Densito- T1a,filledbars;CAT,hatchedbars.CATmRNAmimicsthepatternofT1a
metricanalysisofthreetofourdifferentlungsofeachdevelopmentalage. mRNAin the perinatal period. Both are down-regulated at the end of
Endogenous T1a, filled bars; CAT, hatched bars. These experiments gestationandremainlowintheadultbrain.
suppressionofexpressioninupperairwaysiskeytothe endodermalderivativesotherthanlung,therefore,are
finalpatternofexpressionoftheendogenousgene,we absentfromthe1.3-kbpromoter.
suspectthatthismayrequireatissue-andcell-specific The T1a gene serves as a marker for the molecular
‘‘finetuning’’bymeansofelementsthatareabsentfrom phenotypeofthealveolartypeIcell(Dobbsetal.,1988b).
the1.3-kbpromoter. Little is known about the molecular functions of this
We do not know the molecular mechanisms that celltype,becauseithasprovendifficulttoisolatethecells
silence this gene during late development but they and study them in vitro (Dobbs et al., 1998). These cells
couldincludeactivetranscriptionalrepression,absence are critical to lung function, however, because they form
of the appropriate transcriptional activators and gene the cellular surface for O -CO exchange from blood to
2 2
methylation (Avisar et al., 1999; Walsh and Bestor, inspiredair(Gehretal.,1978)andhaveaveryhighwater
1999). We observed expression of the CAT transgene permeability(Dobbsetal.,1998a).Inhumans,typeIcells
but not the endogenous gene in developing pancreas have a composite surface area of ,65–70m2 an area 35-
and intestinal epithelia. Elements that silence T1a in to55-foldthatoftheskin(Crapoetal.,1982).
328 RAMIREZETAL.
EXPERIMENTAL PROCEDURES
TransgenicMice
1.3-kb T1a-CAT transgene was generated by diges-
tion of 1.3-kbT1a-Luc (Ramirez et al., 1997) with
HindIIIandXhoI.Thispromoterfragmentspans1251
bpoftheT1apromoterand101bpoftheuntranslated
region. It was inserted in the HindIII-SalI sites of the
basicpCATvector(Promega,Madison,WI).The1.3-kb
T1a-CATplasmidwaspurifiedbyCsClmethod,andits
transcriptionalactivitywastestedbytransienttransfec-
tionintheSV40TIIcellline(usingpCATbasicvector
as control). The 1.3-kb T1a-CAT fusion gene was ex-
cised by HindIII and BamHI digestion, isolated by
agarose gel electrophoresis and electroelution, and
furtherpurifiedandconcentratedonElutipDminicol-
umns (Schleicher & Schuell Inc., Keene, NH) and
ethanol precipitation. Two to four picoliters of DNA(3
Fig. 9. Deletion studies of the 10-kb T1a promoter. The indicated
deletionfragmentsofthe10-kbT1apromoterdrivingexpressionofthe µg/ml) dissolved in injection buffer (10 mM Tris-HCl,
luciferase reporter gene were transiently transfected in SV40T II cells pH7.4,0.1mMEDTA,pH8)wereinjectedinfertilized
(filledbars),MLE-15cells(hatchedbars),andIMR-90cells(openbars). donor eggs obtained from superovulated FVB mice at
Activity of the luciferase reporter gene, normalized for b-galactosidase Boston University Transgenic Mice Facility. The eggs
activity,isexpressedrelativetothepromoterlessplasmid0-bpLuc(pGL3)
were reimplanted into pseudopregnant Swiss-Webster
in each cell line. Data are expressed as the mean of three or more
transfectionswithduplicateassays6SE.Thedatashowthatthe10-kb females. Experiments were performed with heterozy-
fragmentconfersadditionalepithelialspecificitytothepromoter.Theratio gousmicefromtheF2andF3generations.
ofactivityinSV40TIIcellsvs.fibroblastsofthe10-kbfragment(4.5-fold)
ishigherthantheratioobservedwiththe1.3-kbfragment(1.9-fold). IdentificationofTransgenicAnimalsand
EstimationofTransgeneCopyNumber
Afewgenes,namelyT1a(Dobbsetal.,1988;Rishiet WeidentifiedtransgenicanimalswithSouthernblots.
al., 1995), aquaporin 5 (AQP-5) (Nielsen et al., 1997), DNA (10 µg), isolated from tails of 3- to 4-week-old
carboxypeptidaseM(Nagaeetal.,1993),andcaveolin1 pups, was digested with ScaI, electrophoresed on a
(Newmanetal.,1999)havebeenidentifiedthatdistin- 0.8% agarose gel, and blotted. Hybridization was per-
guishthetypeIcellphenotypefromthatofotherlung formedwitha679-bp32P-labeledCATprobe,labeledby
cells. Because caveolin-1 and carboxypeptidase M are hexamerrandomprimemethod(Sambrooketal.,1989),
also expressed in endothelial and airway cells respec- spanning the CAT sequence from XbaI to ScaI sites.
tively, T1a andAQP-5 appear to be the markers most PCR was also used to identify transgenic mice by
useful for exploration of the type I cell phenotype. In amplification of a 427-bp fragment from the CAT gene
vitro T1a andAQP-5 show strong similarities in their (oligonucleotide Y1, 5’ TTCTTGCCCGCCTGATGAAT-
patternsofexpression.FGF-7(fibroblastgrowthfactor GCTC 3’ and Y2, 5’ TTCTGCCGACATGGAAGCCATC
7,keratinocytegrowthfactor),homologousserum,and 3’) and a 331-bp fragment from b-actin as an internal
cuboidalcellshaperepressexpressionofbothgenesin control (oligonucleotide Y3, 5’ TCTACAATGAGCTGC-
primaryculturesoftypeIIcells(Boroketal.,1998a,b). GTGTGGCC 3’, and Y4, 5’ CAGGATCTTCATGAGG-
In contrast, heterologous serum and squamous cell TAGTCCG 3’). Transgenic embryos were identified by
shapedramaticallyup-regulateT1aandAQP-5.These PCR analysis of DNA purified from a paw. Each paw
similarities led us to suspect that groups of type I cell was incubated in 20 µl of digestion buffer (PCR buffer
genesmayberegulatedbysimilarmolecularsignalsas [Perkin Elmer, Foster City, CA], 0.5% Tween 20, 100
expressionofthenewcellularphenotypeisinitiated. µg/mlproteinaseK[BoehringerMannheim,Indianapo-
Inbothhumansandexperimentalanimals,viraland lis,IN])at55°Cfor2hr.ProteinaseKwasinactivated
bacterialinfections(BachofenandWeibel,1977;McEl- at 95°C and 1–2 µl of the digested samples were
royetal.,1995),inhalationoftoxicgases(Evansetal., amplified (30 cycles, 94°C 1 min, 58°C 1 min, 72°C 2
1975; McElroy et al., 1997), high concentrations of O min, 2.5 mM Mg21). The number of copies of the
2
(Harrisetal.,1991),andotherinsultscausetypeIcell transgeneinsertedpergenomewasestimatedbySouth-
deathanddesquamation.Thekeyeventsinlungrepair ern blot analysis of tail DNA by using a calibration
aftertheseinjuriesareformationofnew,highlyattenu- curveof1.3-kbT1a-CATconstructdigestedinthesame
ated type I cells and restoration of the type I cell conditionsasthegenomicDNA.
molecular phenotype. The importance of the repair
InSituHybridizationAnalysisofMouse
process in humans with respiratory failure and in
EmbryosandAdultTissues
alveolar biology supports continued efforts to define
precisely what regulates expression of T1a and other Heterozygoustransgenicmales(F2generation)were
typeIcellgenes. crossedwithnormalFVBfemalestogenerateembryos