ebook img

H+ Magazine - Issue 4 PDF

2009·10.9 MB·English
Save to my drive
Quick download
Download
Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.

Preview H+ Magazine - Issue 4

DESIGNER BABY m a g a z i n e CONTROVERSY ISSUE 3 SUMMER 2009 From X PRIZE to Singularity U BIOHACKING ARRIVES Legalize Sports Doping? WAS THAT A BOT OR CHRIS CONTE’S MICROBOTIC ART A HUMAN? TTTTThhhhheeeee LLLLLiiiiifffffeeeee EEEEExxxxxttttteeeeennnnnsssssiiiiiooooonnnnn FFFFFooooouuuuunnnnndddddaaaaatttttiiiiiooooonnnnn iiiiisssss ttttthhhhheeeee nnnnnooooonnnnn-----ppppprrrrrooooofififififittttt ooooorrrrrgggggaaaaannnnniiiiizzzzzaaaaatttttiiiiiooooonnnnn ttttthhhhhaaaaattttt fffffuuuuunnnnndddddsssss aaaaannnnntttttiiiii-----aaaaagggggiiiiinnnnnggggg rrrrreeeeessssseeeeeaaaaarrrrrccccchhhhh Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe Taahnned dL rrieefepp ooErrxtttsse mmnseeiddoiincc aaFllo bburrneedaakkattthihorrnoo uuisgg hhthss eiinn n ddoiinsse-epaassreeo fipptrr eeovvreegnnattniiooiznna..t iIIonnn ff aathcctta,,t ii fff uyynooduus’’rr eea nttaatkik-iianngggin aag ll oorewws-e-ddaroocsshee Tdaily aaahannnesdd dpL irrrireeefienppp oo oEtrrroxttttss se h mmmnesleeepidddo iiinpccc raaaFelllo v bbbuerrrnneeetdaaa kkkaatttt hhihhorrrenoooa uuuritsggg hhhathsstst eiiiannn cn kdddo,iiin sssyee-eopaaausssreeeo’r fieppp trrra eeeolvvvrreeeegnnanadtttniiiyoooi znnnba...et iIInIonnnen fifff aaattthcccitttan,,,t giii fff f ufyyyrnooooduuums’’’rrr eeeau ntttsaaat! kkik-Wiiiannngegggi’rn aaaeg lll tooorhewwwes --e-ddodanrooocssesheees dTdaaiillyy ahaaness dppL iirrirefiiennp oEttrooxt t sehh mneeslleppido inppc rraFeelovv bueernnnettda kaaatt ihhhoreenoaa urrittsg haathttstt eiaan ccn kkdo,,i n syy-eoopauusreo’’rr fieep traa eollvrrreeegaanaddtniyyoi znbba.eet innIoneen fifif attttthciitnan,t ggi f f uffyrrnooodmums’r eauu ntssa!t! ikW-Wiangeegi’’rrn aeeg l ttorhhewees e-oodannroceeshess ddaaiillyy aassppiirriinn ttoo hheellpp pprreevveenntt aa hheeaarrtt aattttaacckk,, yyoouu’’rree aallrreeaaddyy bbeenneefifittttiinngg ffrroomm uuss!! WWee’’rree tthhee oonneess wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees wwdahhioloy arraeensssdpee aairrrreiccnphh o taraotnn sddh m errleeepdpp iopocrrratetl v nnbeeernewwta kaaat nnhhddreo abbureetgt thttaeetsrrt i a nwwc kaad,yyi sssye ottaoous e ’rhh epee rllapeplvr yeyeanooduutiy oll iinbvv.eee nI hnhee efifaaatlltcttithhn,ii geief rr f yrllooooumnn’ggr eeeu rrts,,a ! sskWooin yyego’or aueu ltccohaawenn - odttaanokkeseees wwhhoo rreesseeaarrcchh aanndd rreeppoorrtt nneeww aanndd bbeetttteerr wwaayyss ttoo hheellpp yyoouu lliivvee hheeaalltthhiieerr lloonnggeerr,, ssoo yyoouu ccaann ttaakkee awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees aawdddahvviloaay nn ratteaasspggeaeeir r ioocnhff fftauuontt uudhrr eeerle p mmp poeerrddetii vccneaaenllw tbb rraaee naahdkket tahbhrerrtoo ttauuetggrta hhwcssk..a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees aaddvvaannttaaggee ooff ffuuttuurree mmeeddiiccaall bbrreeaakktthhrroouugghhss.. awdhvoa nrteasgeaer ochf fauntudr ere mpoerdti cnaelw b raenadk tbherottuegr hws.ays to help you live healthier longer, so you can take awdhvoa nrteasgeaer ochfB fauenctudor mere emp oae rdLti icnfaeel w Eb rxaetnaedkn tsbhierootntue gmr hwesm.aybs etro nhoewlp fyooru j ulisvte $ h4e5a lathnide rg leotn aglel rt, hsios !you can take advantage ofBB fueecctuoormme eem aae dLLiiicffaeel EEbrxxettaeeknntsshiioroonnu mgmheesmm. bbeerr nnooww ffoorr jjuusstt $$4455 aanndd ggeett aallll tthhiiss!! BBeeccoommee aa LLiiffee EExxtteennssiioonn mmeemmbbeerr nnooww ffoorr jjuusstt $$4455 aanndd ggeett aallll tthhiiss!! advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this! Become a Life Extension member now for just $45 and get all this! ■■■■■ F F F F FRRRRREEEEEEEEEE 11111-----YYYYYeeeeeaaaaarrrrr BBSSSSSuuuuueebbbbbccsssssoocccccrrrrrmmiiiiipppppeetttttiiiii oooooaannnnn LLtttttoooooii ffLLLLLeeiiiii fffffEEeeeee xxEEEEEttxxxxxeettttteeeeennnnnnnsssssssiiiiiiiooooooonnnnnnn mmeemmbbeerr nnooCCCCCwwaaaaa lllfflloolllll rr11111 jj-----uu88888ss66666tt 666$$6644-----5555555 99999aa88888nndd-----66666 gg77777ee44444tt 888aa88ll llttttt ttooooohh iijjjjjssooooo!!iiiiinnnnn tttttooooodddddaaaaayyyyy..... ■ MM FRaaEggaEazz i1inn-Yee,,e ajjaarm mSu--ppbaasccckkrieepddt iwwoniitt hhto cc Luuttittfieinn Egg--xeetddegngees i hhoeneaa lltthh Call 1-866-598-6748 to join today. ■■ MMnnMM F FeeRRaawaawEEggggssaaEEaa wwzzzz ii11iioonnnn--rrYYeeeelldd,,,,ee aawwjjjjaaaarriimm mmddSSeuue----pp pp bb((aaaa$$sscccccc55kkkkrr99iieeeepp..dddd88tt ii88wwwwoo nnniiniitttt eehhhhttwwoo cccc ssLLuuuussttttttiiaattttffiieeiinnnnnn ddEEgggg ----xxvveeeettaaddddeelluuggnnggeeeeeess )ii )hhhhoo..eenneeaaaa lllltttthhhh MMMMMCCeeeeeaannnnnlltttttlliiiiiooooo 11nnnnn --cccccooooo88ddddd66eeeee 66AAAAAVVVVV--55BBBBB9999999000008866666AAAAA--66..... WWWWW77eeeee44’’’’’lllll88lllll uuuuu ssssstteeeeeoo yyyyy ooooojjuuuuuoorrrrr iisssssnnpppppeeeee cccccttiiiiiaaaaaoolllll dd$$$$$44444aa55555yy .. ■■■■■■■■■■ n Fntn Fnt Fntt Fnttn Fntn FntMn FnMn Fn FMn FhhhohohheueuuRRRueueueueueRRRRRRR eee eeewwaaawwwwwrrr1rrrrr1EEEsssEEEEEEEssssssgggssssseee eee ssssssseeeeeeeeaEEEaEEEEEEEaaa sssssssswwHHHwwwww.HHH.zzz ,,, ,,,,,mmPPP 1PPPPPP iiiooooooonnnnnnnneeennneee-.hhh.hhhhhhrrrrrrraaaaaauuuuuuuu,Y,eeelllllll ooooooooolllllldddddddttt,,,tttttfeftttttt rrrorrrrronnnnnnnnnawwwwwwwhhhhhhjjjiiiiiiiiaaarrrttteeettttteeeeee iiiiiii mmmiiiiiiiiAAAAAA dd adddddSaooooooooaaaaaaaaanneeueeeeedddnnnddd---nnnnnccccccccc ppp ssbcccvvviiiccccccvvviiiii(((((((wwssssssssaaa$$eee$$$$$seeeeeeiiiiiittttttttsssccccssssssesssssse55sss55555sssssooooookkkrsssssssss,,,r,,,,,r9999999 i s srrreeerrreeepeeeeettttttttt.. ..... ssssssdddvvvooo88tvvvvvoooooo88888tt oo eeeieeeeetttttt88 88888 wwwoooodddooo ddddddnnn nnnnn yynnnlllooonnnnnllliiioooooo olllollltttpppppppp ---cccee---cccccceeeeehhhtuufffeeefffeeeeetttwwttttttwwwwworrr rrrooorrrroooooorrrrrrccceeeeee sssss ssssssssssrrrrrrrrLruuuheeeheeeooossooooossssssssssssss tt ttttttttiee,,,nnn,,,,,,nnnnnaaaaaaaaaaaaa tttf aannnnnnnnnnnnaaannneiiiaaaaannnnnnnllnnnlll llllltaaayyytaaaaaayyyddddddd E hggghtttttttttttt ttttt ddduuurrrddduuuuuurrrrr---x vv vvvvvaaaqeeeaaaaaqaaarrrtaaarrrrrraaaaaaaiiidddiiiiioooeuoooooouyyyyyylllllllnnnnnnnnuuuuuuun,,,ggg,,,pppppppppee eee eeeeeeeeeeeeeee777s777ssaaaaaaaaarrrrrrrrt))ti )))))ttt:::ssstttttt:::ssssshhhiio.......333333hhhhhhhhh........oo neee000000sssCCCssssssCCCCCnnaaa,,,,,,,,, s slllaaaaaaaaaaaaaa ttt ...lll...lllllhhhmmmlllmmmlllll ...... mryomryomryomryomryoMmryoMmryMmryCMmreeeeeeeeeooooooooffffffsssssssssfffeeefffeeeeeeuuueeeeuuuuuaeeeeeeeeeeeeeeemmmmmmmmmnnnn aaarrr aaaaaarrrlnnnnnnnn rrrttttrrrrrrbbbbbbbbbeeeleeeiiiiccccccccceeeeeeeeooooxxxeeexxx eeeeeehhhhhhhhheeeeeeee1rrrpppnnnnrrrrrrpppdddddddd.........sssssssss iiiiii hhh hhhhhhRRR-RRRRRRrrrccccrrrtttttttteeeeeeiiioooooooiiiiii8oooooeeeeeeeeepppppppppssssss dddd sssssssss hhh hhhhh 6111eee111eeeeeefffeeeeffffffeeeaaaeeeeeeeeaaaaaaeeeeee222 2226AAAAlllrrreeelllllrrrrrreeeeee///ppp///pppppccccccccc VVVV333333-(((((((((hhh hhhhhh rrryyyrrrrrryyyyy1111115BBBB eeeeeeeeeoooooooottt///tttttt///ggggggggg9999hhhhhhhhh0009000uuuuuuuuuuuuuuuuuaaa0000aaaaaa999999 8llleeelllllleeeeettttttttt6666......aaaaaaaaa xxx xxxxxcccrrrccccccrrrrrrAAAA-ttttttttllllllllloooooooooeeeeeeee6yyyyyyyyy....uuunnnuuuuuunnnnn WWWW$$$$$$$$$7lllllllllddddddddddddddddd777777777 eeee4 yyyyyyyy555555555yyyyyyyyy’’’’ooollllooooo)))))))))iii8iiiiiilllleee uuueeeeee uuuuu tttttttttuuuulllllllll rrrrrrrrooooooooodddddddddssss t llleeeelllll fffffffffiiioiiiiittttttttt uuufffuuuuuufffffhhhhhhhhhyyyyeeeeeeeennn nnnnnnooooeeeeeeeee jiiiiiiii ddd dddddduuuunnnnnnnniiiiiiiiionnn nnnnnn rrrrddddddddaaaaaaaaa fffiffffffnnnssssnnnnnneeeeeeeeooooooooonppppfifififififififitttttttttrrrrrrrrriiieeeeiiiiiimmmnnnmmmmmmnnnnn ---------ccccaaaaaaaaatiiiiiiiiiiiitttaaatttttaaaaaagggggggggaaaaoeeeeeeeetttttttttiiiiiiiiillllllliiillllliiiiiinnn nnnnnndyyyoooyyyyyoooooo$$$$ggg...gggggg.....nnnnnnnnn4444 a TTT TTTTT 5555yhhhhhhhh .iiiiiiiissssssss to 1 a.m., for answers to your health questions ttaatttnooohhnnu eedd11r1sss ee hheaaa s..eHH.e,mmmll ppnee... aau,,,ii nllntfffttooro hhiccrrrt uu iAAaaaossnnntddtnoosssvviwwwmmsiitsseeesiioorr,rzz sssrriie nnssttvt oogogett oo nyyyyyll ooooollp--uuuuufferrrrrrrree sdhhdheeo iieeenaaeeaaannattlll,,ltttyy hhheet ddrxx qqaqeeaaiuururyyncc,,eee eiiss77sssrtttee::siii33 .oooaa 00Cnnnnn sssddaaa ..l mml .. ooyoffffuee rrn eeexxeppdii rrteeoss h11e22l//p33 y11o//00u99 e..xtend your life indefinitely. This and help in customizing your diet, exercise and aassatttuoohunnn pepddd11spp e hhhaall eeeeH..emmmmlllpppe..ee a,,iiinn nnlnfftttoo h cccrrrr uuuee Aaaggsssnnttdtiioomomssvwwmmmieeseenniiiorrzzz..ssriii nnnstt ggoogt o yyyyyloooool-uuuuufrrrrrre dddhhe iiieeaeeeaantttll,,,tty hheee dxxx qqeeearruuryccc,ee iii7ssssstteee:ii3 ooaaa0nnnnn ssddda . m. SSSoftttfaaaeryyy ehhhxpeeeaiaarlelltttshhh 1iii2eee/rrr3 1fffooo/0rrr9 mmm. aaannnyyy yyyeeeaaarrrsss tttooo cccooommmeee!!! supplement regimen. SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!! ssatuuon ppd1pp hallee.emmmlp.ee ,inn nftto crrruee aggsntiimmoswmeeennirz..si ntog yyoouurr dhieeatl,t hex qeurceisstei oannsd Stay healthier for many years to come! saunpdp hleemlpe innt cruegstiommeniz.ing your diet, exercise and ■■■■■ B B B B Bssauuniiiiippgggggdpp ssssshllaaaaaeeevvvvvmmlpiiiiinnnnnee inngggggnsssttss crroooooueennnnnggst iibbbbbommmllllloooeeoonnioooooz..dddddin tttttgeeeee sssssytttttosssssu fffffrooooo drrrrr ippppperrrrrteeeee, vvvvveeeeeexnnnnnetttrttiiiciioooooisnnnnne wwwwwaniiiiitttttdhhhhh ooooouuuuurrrrr SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!! ■■■■■■■■■■■■■ m 2(sm 2(sm 2(sm 2(sm 2(s Bm 2(s Bm 2(s Bm 2(ss Bm 2(svvvuuuvvvvvvuuuuuuu555555555iiiiiiiiiiiiiaaaaaaaaappppppppppggggttt%%%tttttt%%%%%%iiiiiiiiiaaapppaaaaaappppppp lllllllllssss---mmm------mmmmmmllllllllll–––––––––oooaaaaooooooeeeeeeeeee555555555vvvvmmmrrriiimmmmmmmrrrrrriiiiiinnnnnnnnnddddddddd000iiii000000nnnneeessseeeeeeesssssseeeeeeeee%%%%%%%%%,,,,,,,,,nnnnnnnnnnrrrrrrrrrgggg mmmmmmmmmttttttttttsssslll llllll ssssssss saaaoooaaaaaaoooooo r)))))))))ooooiiiiiiiiibbbbbbbbbfffeffffff nnn nnnnnnnnnnfffdddffffffdddddd.........geee eeeeee eee eeeeeeippppppppprrrrrrrrrbbbbmvvvvvvvvvaaaaaaaaarrrrrrrrr111llll11eeeeeeeeellllllllleeeeeeeeeeoooossssssssslllllllllmmmmmmmmmooo,,,noooooo,,,,,,-----oooo ppphhhpppppphhhhhh.88888ddddiiiiiiiiieeeuuuoooeeeeeeuuuuuuoooooo 66666dddddddddttttrrrrrrrrrmmmmmmmmmeeeemmmmmmmmm 66666tttttttttssss---------hhhhhhhhhttttoooooooooqqqqqqqqq---ssss--rrrrrrrrrnnnnnnnnnuuuuuuuuu ooooooooo55555ffffeeeeeeeeeaaauuuaaaaaaoooouuuuuusssssssss99999lllllllllrrrrggggggggg iiiiiiiii&&& &&&&&&hhhttthhhhhhttttttpppp88888yyyyyyyyy rrrr ooooooooo ---nnneeee--nnnnnnnnnnnnnnnuuuuuuuuuvvvv66666uuuuuuuuuuuuuuuuuurrreeeerrrrrrttttttttt tttnnnn777tttttt77rrrrrrrrrrrrrrrrrrrrrrrrrrriiiiiiiiieeetttteeeeee44444aaatttaaaaaattttttiiiisssssssssiiiiiiiiiooooccccccccceeeeeeeeeooooooooo88888eeennnneeeeeeaaaaaaaaannnnnnnnnuuuuuuuuurrrrrrrrr aaaaaaaaacccwwwwccccccttttttttt lllllllllhhhhhhhhhiiiiiiiii ||| ||iiiiccccccccc ... tttt......aaaaaaaaahhhh lllwwwllllllww sssssssssoooo uuuuwwwwwrrrr wwwww.....LLLLLiiiiifffffSeeeeetEEEEEayxxxxx httttteeeeeeannnnnlsssssthiiiiioooooiennnnnr .....fcccoccrooooo mmmmmma/////nHHHHHy yPPPPPelllllauuuuurssssss to come! 423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus The Life Extension Foundation is the non-profit organization that funds anti-aging research The Life Extension Foundation is the non-profit organization that funds anti-aging research Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe Tdaily ahanes dpL irirefienp oEtroxtt seh mneslepido inpc raFelov buernnetda kaatt ihhorenoa uritsg hathtst eian cn kdo,in sy-eopausreo’r fiep tra eolvrreeganadtniyoi znba.et inIonen fif attthcitan,t gi f f ufyrnoodums’r eau ntsat! ik-Wiangegi’rn aeg l torhewes e-odanroceshes Tdaily ahanes dpL irirefienp oEtroxtt seh mneslepido inpc raFelov buernnetda kaatt ihhorenoa uritsg hathtst eian cn kdo,in sy-eopausreo’r fiep tra eolvrreeganadtniyoi znba.et inIonen fif attthcitan,t gi f f ufyrnoodums’r eau ntsat! ik-Wiangegi’rn aeg l torhewes e-odanroceshes wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees awdhvoa nrteasgeaer ochf fauntudr ere mpoerdti cnaelw b raenadk tbherottuegr hws.ays to help you live healthier longer, so you can take awdhvoa nrteasgeaer ochfB fauenctudor mere emp oae rdLti icnfaeel w Eb rxaetnaedkn tsbhierootntue gmr hwesm.aybs etro nhoewlp fyooru j ulisvte $ h4e5a lathnide rg leotn aglel rt, hsios !you can take advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this! advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this! Become a Life Extension member now for just $45 and get all this! ■ FREE 1-Year BSuebcsocrmipeti oan Ltoi fLei fEe xEtxetennssiioonn member noCwa flol r1 j-u8s6t $64-55 9a8nd-6 g7e4t a8l lt toh ijso!in today. ■ FREE 1-Year BSuebcsocrmipeti oan Ltoi fLei fEe xEtxetennssiioonn member noCwa flol r1 j-u8s6t $64-55 9a8nd-6 g7e4t a8l lt toh ijso!in today. ■ M FRaEgEaz 1in-Ye,e ajar mSu-pbascckriepdt iwonit hto c Lutitfein Eg-xetdengesi honea lth Call 1-866-598-6748 to join today. ■■ nMM F FeRRaawEEggsEEaa wzz 11iionn--rYYeeld,,ee aawjjaarri mmdSSuue--pp bb(aa$sscccc5kkrr9iieepp.dd8tt ii8wwoo nnniitt ehhttwoo cc sLLuustttiiattffeeiinnn dEEgg --xxveettaddeelunnggeeessii )hhoo.nneeaa lltthh MMCCeeaannllttlliioo 11nn --ccoo88dd66ee 66AAVV--55BB9999008866AA--66.. WW77ee44’’ll88ll uu sstteeoo yy oojjuuoorr iissnnppee ccttiiaaooll dd$$44aa55yy .. ■■■■■■ Fntn Fnn FnMn FMn F FMnhueueueeeRRRRRReaaawwwwwrrrEEEEEEsgggsssessssseeeEEEEEEaaa ssswwwwwHzzz ,,,1PPPPP iiiooooonnnnnne-hhhhhrrrrrauuuYeeelllllooooolddddd,,,tttet rrrnnnnnawwwwwhjjjiiiaaarttteeeee iiiii mmmiiiA dddddSoooaaaaaueeeeed---nnncccccppp bcccccviii(((((sssaaa$$$$$seeeeeitttccccssssss55555sssokkkrsssss,,,99999i eeerpeeettttt.....sdddvvvooooo88888t ieeet88888 wwwoodddddnnn nnnnnnliiiooooo ltttppp -ccccceeeeehhhtfeeetttttwwwwwo rooooorrrccce ssssssssrrrrrLuuueooossssssssss tttttttti,,,,,nnnaaaaaatttf nnnnnneiiiaaannnnnnnn lllaaaaaydddddE gggtttttttt duuuuurrr---xvvvvveeeaaatarrrrraaaaadddiiieoooooylllllnnnuuuuunggg,ppppp eeeeeeeeeee7saaaaarrri )))))ttttt:ssshhho.....3hhhhh... neee0sssssCCCaaa,,,,, lllaaaa ttt.lllhhhmlll . mryomryMmryMmrMmrCMmeeeeeooofsssssfeeeeeeeeeeuuuaeeeeeemmmmmmnnnn aaaaarlnnn ttttrrrrrbbbbbbleiiiiccccceeeoooox eeeeeehhhhheee1nnnnrrrrrrpddd.....ssssss i hhhhhh-RRRRRccccrttteooooiiiiii8oooeeeeeppppppsdddd sssss hhh 61eeeeeeeeeffffffeeeaaaaaeeeeee 26AAAAlllrrrrreeeeee/pppccccc VVVV3-((((((hhhhh rrrrrryyy15BBBB eeeeeeooottttt/gggggg9999hhhhh90uuuuuuuuu0000aaaaa9 8lllllleeettttt6666.aaaaaa xxxcccccrrrrrrAAAA-tttlllllloooooeee6yyyyyy....uuuuunnn WWWW$$$$$$7llllldddddddd777777 eeee4 yyy555555yyyyy’’’’llllooo))))))8iiiiilllleeeee uuu ttttttuuuulllll rrroooooodddddsssst eeeelll ffffffoiiittttt uuuuuufffhhhhhyyyyeee nnnnnnooooeeeee jiii dddddduuuunnniiiiionnnnn rrrrdddaaaaaa ifffffssssnnnnnneeeooooonppppfififittttttrrrrreeeeiiiiiimmmmmnnn ------ccccaaaaaatiiiiiiitttaaaaaggggggaaaaoeeetttttiiiiiillllllliiiii nnnnnndyyyooooo$$$$gggggg...nnnnn4444 a TTT 5555yhhh .iiisss ■ tttnn FohhuuR eerr1Essssee eeaE ssHH. ,,mP nnee.haauu, ollttfttrronhhiirtte iiAA aooanddnncscvviiwsseiittsssessoos,,r srreet ssvvot oeett ood nnyllo ollpp--cuffeetrrorrree ssrheeoos e,nnaa annnaallltayy httt ddurr aaqaariiouyynn,,pe ee77sarrtt::ssi33h..o 00sCCn, saaaa ..llmmll .. ooyyreooffsffuueee arrnn reeceexxheeppdd. ii Rrrtteeooess s hh11eeea22llr//ppc33h yy11 oot//h00uua99 eet.. xxcttoeeunnlddd yyyooieuulrrd ll iitffheee ii nninddfeeofifirmnniittaeetlliyyo..n TT hhiiss to 1 a.m., for answers to your health questions atttnohhnu eedr1sss ee hea sHH.e,ml pnee. aau,i llntfttro hhicrt u iAAaosnddtnosvviwmsiitssesioo,rz srrie nssvt ogettoo nyyll oollp--uufferrrrree sdheeo ienaaeannatl,ltyy het ddrx aqeaaiuryync,,e ei77ssrte::si33 .oa 00Cnn sdaaa ..l mml .. ooyoffffuee rrn eeexxeppdii rrteeoss h11e22l//p33 y11o//00u99 e..xtend your life indefinitely. This and help in customizing your diet, exercise and satttoohun epd11sp e haal eH..emmmlpe..e a,,in lnffttoo h crrr ue Aaagsnndtiomssvwwmieseeniorrz.ssri nstt oogto yyyloool-uuufrrrre dhhe ieeaeaantll,tty hhe dx qqeauuryc,ee i7ssstte:ii3 ooa0nnn ssda . m. SSofttfaaeryy ehhxpeeiaarellttshh 1ii2ee/rr3 1ffoo/0rr9 mm. aannyy yyeeaarrss ttoo ccoommee!! supplement regimen. aton d1 ha.emlp. ,i nfo cru asntoswmeirzsi ntog yyoouurr dhieeatl,t hex qeurceisstei oannsd Stay healthier for many years to come! saunpdp hleemlpe innt cruegstiommeniz.ing your diet, exercise and ■■ B Bssauuniippggdpp sshllaaeeevvmmlpiinnee innggnttss crrooueennggst iibbommmlleeoonniooz..ddin ttgee ssyttossu ffroo drr ipperrtee, vveeexnnerttciiooisnne wwaniittdhh oouurr SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!! ■■■■■■■■■■ m 2(sm 2(s Bm 2(s Bm 2(s Bm 2(ss Bm 2(svvvvvvuuuuuuu555555iiiiiiiiiiaaaaaapppppppggggtttttt%%%%%%iiiiiiaaaaaappppppp llllllssss------mmmmmmlllllll––––––aaaaooooooeeeeeee555555vvvvmmmmmmmrrrrrriiiiiinnnnnnddddddiiii000000nnnneeeeeeesssssseeeeee%%%%%%,,,,,,nnnnnnnrrrrrrgggg mmmmmmtttttttssssllllll sssss saaaaaaoooooo r))))))ooooiiiiiibbbbbbeffffff nnnnnnnnnnffffffdddddd......geeeeee eeeeeeipppppprrrrrrbbbbmvvvvvvaaaaaarrrrrrllll1eeeeeelllllleeeeeeeoooossssssllllllmmmmmmnoooooo,,,,,,-oooo pppppphhhhhh.8ddddiiiiiieeeeeeuuuuuuoooooo 6ddddddttttrrrrrrmmmmmmeeeemmmmmm 6ttttttssss------hhhhhhttttooooooqqqqqqssss-rrrrrrnnnnnnuuuuuu oooooo5ffffeeeeeeaaaaaaoooouuuuuussssss9llllllrrrrgggggg iiiiii &&&&&&hhhhhhttttttpppp8yyyyyy rrrr oooooo eeee-nnnnnnnnnnnnuuuuuuvvvv6uuuuuuuuuuuueeeerrrrrrtttttt nnnntttttt7rrrrrrrrrrrrrrrrrriiiiiitttteeeeee4aaaaaattttttiiiissssssiiiiiioooocccccceeeeeeoooooo8nnnneeeeeeaaaaaannnnnnuuuuuurrrrrr aaaaaawwwwcccccctttttt llllllhhhhhhiiiiii |iiiicccccc tttt......aaaaaahhhh llllllw ssssssoooo uuuuwrrrr w.LifSetEayx hteeanlsthioienr .focro mma/nHy yPelaurss to come! 423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus 1-866-598-6748 | www.LifeExtension.com/HPlus Table of Contents AI Brain-Computer Interfacing: From Prosthetic Limbs to Telepathy Chips 16 The Great “Designer Baby” Controversy of ‘09 24 10 The Virtual Cocoon 20 BIO “roger Pederson, Won’t You Please Come Home?” 11 Climb Inside a Virtual sphere 22 eNHANCeD: Optogenetics 12 Wearing the Internet 30 Andy miah, sports Doping, and the 13 Oh rosie, Can You Bring me my slippers? enhancement enlightement 4444 13 Live Long and Heavy 34 Biology for the Homebody 14 Fast Blasts 37 Here Come the Neurobots 18 FOreVer YOuNG smart Biology 40 unreal Tournament: Was That a Bot or a Human? ssuummmmeerr 22000099 Life on Mars with Pete Worden: An Interview with the Director of the 48 NASA Ames Research Center What if Travis Bickel was “The Thing”? An Interview with Dennis Detwiller 72 The Man Behind Biosphere 2 50 42 From X PrIze to singularity university: 62 Chris Conte: Cynthetic series An Interview with Peter Diamandis 67 Let A Hundred Futures Bloom 50 The man Behind Biosphere 2: An Interview with John Allen 70 everything of the Dead: The Future of Humanity is zombie 56 real Discrimination Against Digital People 78 recommended Books 5555 58 NANO It’s a Big mistake to Overlook mid-range Dangers 81 HumOr relinquishment, step One 60 NeurO running with the Dopes: Cheating to be a Better Human WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm EXPERIENCE NEURVANA. PILLS THAT MAKE YOU SMARTER, THINNER, MORE SEXUALLY POTENT Publisher Betterhumans LLC . AND ACTIVATE LONGEVITY James Clement - Co-Founder Dan stoicescu - Co-Founder WITH BETA-PHENYLETHYLAMINE editor-in-Chief r.u. sirius managing editor Jay Cornell A Word From Dr.Richard Clark Kaufman Contributing editor surfdaddy Orca NEURVANA Chief Science Officer, Author, Biogerontologist NEURVANA is an advancement in anti-aging Design Infoswell media, Inc science for living a longer life and developing peak mental and physical performance. By Art Director stephanie Fox correcting underlying central metabolic imbal- ances, NEURVANA produces a broad range of desirable effects on improving human functions. From slower aging to protecting against decline and feeling good, NEURVANA delivers benefits that every person of every age can quickly feel, Print Distribution Disticor observe and appreciate. David Latimer NEURVANA™ Products contains... beta-phenylethylamine (PEA), a naturally occur- ring neurohormone / neurotransmitter (chemical signal messenger between nerves) that’s normally Advertising James Clement synthesized in the brain from the amino acid David Latimer phenylalanine. PEA has the unique ability to amplify the activity of the major neurotransmitters and improve your life functions. Patent-Pending Nanosphere Delivery System Contact [email protected] NEURVANA™ is formulated with a patent pending “Self-emulsifying Nanosphere Delivery System.” It uses natural phospholipids and medi- um-chain triglycerides to form a nanoemulsion Letters to the editor [email protected] (covering) in the intestinal tract, enhancing bioavailability (delivery) of PEA. Proofreading Lori selke There are five NEURVANA Products in all.Click this ad to get FREE sample packs. NEURVANA™ Pro NEURVANA™ Tranquil This product embodies the core NEURVANA Everybody experiences occasional bouts of snail mail concept. It features the brain neuro-amplifier anxiety, tension and insomnia. NEURVANA beta-phenylethylamine for slower aging, youth- Tranquil restores calm. Through its combination h+ magazine, 385 Vista roma Way, #115, san Jose, CA ful functioning, and peak body-and-mind per- of neural inhibitors you quickly relax, sleep formance. It works wonders on boosting mood, soundly, block harmful stress, and your mind 95136 mental activity, attention, motivation, alertness, enters a serene, peaceful state. energy, libido, creativity and awareness. NEURVANA™ SexualDesire NEURVANA™ BodySlim This is the best product in the market for How would you like to lose up to 10 pounds in improving sex in men and women. Its combi- unsolicited manuscripts give us hives 10 days? You can do so through NEURVANA nation of research-proven nutraceuticals BodySlim's synergistic combination of thermo- produces a stronger sex drive, faster arousal, genic calorie burners and the BodySlim better orgasms, and longer-lasting on-demand Letters to the edItor Transformation Plan. They re-program your performance. body to convert food and fat calories into NEURVANA™ Synchronicity Please email the editor at [email protected] energy 24 hours a day for losing weight. The team of “chronobiotic” supplements NEURVANA™ MoodBrightener “MoodBrightener & Tranquil” synchronize your Think of it as a powerful biogenic pick-me-up. daily body rhythms for slower aging, mental Its6666 synergistic combination of neurotransmitters wellness, illness prevention, and optimal per- activators will quickly dissolve depressive formance. SYNCHRONICITY combats jet lag, moods. It will also ease away tension, block chronic fatigue, mood swings, depressive All materials © Betterhumans LLC 2009 unless otherwise stressful feelings, increase attention, make you states, tension, mental fogginess, attention feel great and give you pleasure. problems, memory loss, sexual problems, indicated. All copyrights for text revert to writers 90 days addictions and low immunity. NEURVANA after publication. Date of publication February 2009. TRANSFORM YOUR LIFE TODAY... CLICK HEREFORFREE SAMPLEPACKS. © NEURVANA Products 2009 • 13470 Washington Blvd., Third Floor • Marina Del Rey, CA 90292 USA These statements hssavuue mmnotmm beeeenrr e v22al00ua00te99d by the Food and Drug Administration. These products are not intended to diagnose, treat, cure, or prevent any disease. Futurist Heroes We are privileged to know and to work with many Futurist Heroes. However, we want to see this league of advocates for a positive future in which poverty, scarcity, disease, and ignorance are erased from humanity, grow much larger. Watching the news as we do, we witness incredible breakthroughs nearly every week. These are stories that would have been the “story of the year” if they had happened just a decade ago. But these days, they are quickly swept aside by the next breaking science story. They seem to come at ever increasing speeds. In this sense, we are becoming ever more aware of the implications of moore’s Law being played out in the “NBIC” (Nano, Bio, Info & Cogno) “Information science” fields. James Clement Co-Founder Here at h+ magazine, we hope that (among other things) we can inspire young people to study and get involved in the emerging “NBIC” sciences and technologies so as to help us transcend our genetic/ biological limitations. We’re hoping that future generations will be able to live incredibly long and healthy lifespans without disease, enjoy higher intelligences (perhaps augmented by computers through brain- computer interfaces), and generally be more productive and happy. Join our h+ Community and help bring about this future – become a Futurist Hero too. Best wishes, Dan stoicescu Co-Founder James Clement and Dan stoicescu Co-Publishers 7777 resOurCes Visit the h+ Community http://www.hpluscommunity.com WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm PrePare Ih ave tended to be a little less impressed with the rate of change than perhaps some other techno-progressives have been. Technology’s best promises – for curing cancer, ending scarcity, insuring mental health – not to mention the more radical hopes for amplifying neurological function, expanding biological lifespan, and creating strong problem-solving AI… what have you – have at times seemed like chimera – the horizons recede just out of reach whenever we seem to get close. We’ve all heard those predictions from the optimists in various fields: “We will have (insert favorite breakthrough here) in five years.” Five years later what do they say? “We will have this in five years.” But I’ve been getting substantially more impressed lately. I’m not sure if it’s just because I have the privilege of editing h+ (the magazine and the website), or if the rate of acceleration is really starting to get interesting, but I suspect that it’s the latter. scanning through the news items we’ve covered on our website over the last couple of months we find (among many other astonishing items) that: Professor Nadrian seeman has created two-armed worker robots made of DNA. An international team has cracked the editor in Chief mammalian gene control code. scientists have used embryonic stem cells to make synthetic blood. 8888 British scientists have developed the world’s first stem cell therapy to cure the most common cause of blindness. ssuummmmeerr 22000099 PrePare for acceleration ru sIrIus so when I scan the evidence provided by my own magazine and website, I am, in fact, convinced that fantastic breakthroughs in NBIC (Nano-Bio-Info-Cogno) are happening all the time and they are starting to influence our lives. The promises and potentials for a radically different and (hopefully) far brighter And scanning this issue of h+ magazine, we find that: future implicit in these sciences are moving quickly from theoretical possibility to laboratory breakthrough to hands-on Nanotech researchers have achieved practice. real-time atom manipulation Of course, promises are made to be broken. These hopeful breakthroughs are running neck and neck with any number Neurobots are manifesting individual of disaster scenarios. There are two wild cards in this race behaviors and “are just about at the between resource/environmental collapse and a new dawn of edge of the amount of size and health, prosperity, and novelty. One of them is plain dumb luck. complexity found in real brains.” The only thing we can predict about the unpredictable is that it will surprise us. The other is us. It’s going to take a lot of Genescient expects to soon be intelligence and wisdom and social-navigational skill to bring able to make designer supplements this accelerating mess of contradictions broadly describable containing nutrients made using as the human (or transhuman) condition to a reasonably soft 9999 detailed genomic information. landing with over 6 billion humans (and many other less crazy species) on board. … All this and gamebots are threatening to pass the Turing Test. I hope h+ is contributing to that effort. WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm Virtual Reality ...Finally? Virtual Cocoon CLImB InSIDe a VIrTUaL SPHere Tristan Guillford researchers from several universities in the For those of you who are tired of uK have teamed up to develop an immersive button-mashing and are looking virtual reality headset that stimulates all to take your gaming experience fi ve senses. Designed for maximum realism, the to a whole new level, or merely looking to Vr helmet will be THeY’re CALLING IT add a little spice to your typical workout, equipped with high “reAL VIrTuALITY.” welcome Virtusphere, Inc. defi nition video, After 45 man-years, they have surround sound audio, special tubes that spray simulated tastes and scents into waiting mouths developed a functional, easy-to-assemble and noses, a fan that blows air to create hot or cold plastic sphere and base platform that fi ts temperatures; and tactile devices for simulating inside a large living room. Just put on touch. goggles and climb into the sphere, and A mock up of the Virtual Cocoon was you’re interacting in the virtual world. showcased at Pioneers ’09 on march 4th, a Because you’re in a movable sphere, technology conference put on by the engineering yyoouu ccaann jjuummpp,, rruunn,, ccrroouucchh,, llooookk aarroouunndd,, aanndd PPhhyyssiiccaall sscciieenncceess rreesseeaarrcchh CCoouunncciill aatt LLoonnddoonn’’ss aanndd wwaallkk wwiitthhoouutt hhaavviinngg OOllyymmppiiaa CCoonnffeerreennccee CCeennttrree.. IInn aa pprreessss rreelleeaassee bbyy tthhee eePPssrrCC,, pprroojjeecctt lleeaadd DDaavviidd HHoowwaarrdd ooff tthhee uunniivveerrssiittyy ooff YYoorrkk ssaayyss:: ““VViirrttuuaall rreeaalliittyy pprroojjeeccttss hhaavvee ttyyppiiccaallllyy oonnllyy ffooccuusseedd oonn oonnee oorr ttwwoo ooff tthhee fifi vvee sseennsseess —— uussuuaallllyy ssiigghhtt aanndd hheeaarriinngg.. WWee’’rree nnoott aawwaarree ooff aannyy ootthheerr rreesseeaarrcchh ggrroouupp aannyywwhheerree eellssee iinn tthhee wwoorrlldd ddooiinngg what we plan to do.” TThhee rreesseeaarrcchheerrss eessttiimmaattee tthhaatt iitt wwiillll 11110000 ttaakkee aatt lleeaasstt fifi vvee yyeeaarrss bbeeffoorree aa ccoommmmeerrcciiaall mmooddeell ooff tthhee VViirrttuuaall CCooccoooonn iiss aavvaaiillaabbllee ffoorr ppuurrcchhaassee.. TThheeyy hhooppee ttoo hhaavvee iitt oonn tthhee mmaarrkkeett ffoorr aabboouutt 11,,550000 ppoouunnddss,, aa lliittttllee mmoorree than $2,500 usD. PPhhoottoo ccoouurrtteessyy ooff VViirrttuusspphheerree,, IInncc.. ssuummmmeerr 22000099

See more

The list of books you might like

Most books are stored in the elastic cloud where traffic is expensive. For this reason, we have a limit on daily download.