Genetic Differences Within and Between Species of Deep-Sea Crabs (Chaceon) From the North Atlantic Ocean

9 Pages·2003·4 MB·English

by  James R Weinberg

Reference: Bio/. Bull 204: 318-326. (June 20(13)
2003 Marine Biological Laboratory
Genetic Differences Within and Between of
Species
Deep-Sea Crabs (Chaceon} From the
North Atlantic Ocean
JAMES R. WEINBERG1-*, THOMAS G. DAHLGREN2, NAN TROWBRIDGE3.
AND KENNETH M. HALANYCH3t
^National Marine Fisheries Serviee, 166 Water Street, Wooilx Hole, Massachusetts 02543; 2Tjamo
Marine Biological Laboratory, 452 96 Stiiiinstad. Sweden; and 3Woods Hole Oceanographic Institution,
Biology Department. Woods Hole, Massachusetts 02543
Abstract. The deep-sea red crab Chaceon quinquedens is stocks. Our results also indicate that the designation of
a commercially important crustacean on the Atlantic conti- morphological species within the commercially important
nental shelf and slope of North America. To assess genetic genus Chaceon is not congruent with evolutionary history.
subdivision in C. quinquedens, we examined the nucleotide The genetic similarity ofC. affinis from the eastern Atlantic
sequence of the mitochondria! 16S rDNA gene and the and C. i/uint/uedeiis from the GulfofMexico suggests these
internal transcribed spacers (ITS) of the nuclear ribosomal trans-Atlantic taxa share a more recent common history than
repeat in samples from southern New England and the Gulf the two populations of"C. i/iiint/i/edens" that we examined.
ofMexico. We compared those data to sequences from two
congeners, a sympatric species from the Florida coast, C. Introduction
fenneri. and an allopatric eastern Atlantic species. C. qffinis.
The 16S rDNA data consisted of 379 aligned nucleotides Many genetic studies of marine populations have been
obtained from 37 individuals. The greatest genetic differ- carried out along the Atlantic coast of North America to
ence among geographical groups or nominal species was examine geographical divergence within and between spe-
between C. quinquedens from southern New England and cies. Range limits of marine species often coincide with
C. quinquedens from the Gulfof Mexico. Haplotypes from major landforms such as Cape Hatteras (Abbott. 1974;
these two groups had a minimum of 10 differences. All I I Briggs. 1974; Grosslein and Azarovitz. 1982; Theroux and
C. fenneri samples matched the most common haplotype Wigley, 1983) and the FloridaPeninsula (Bert, 1986; Avise,
found in C. t/uiiK/uedens from the Gulfof Mexico, and this 1992. 2000; Seyoum et al., 2000). Ocean temperatures in
haplotype was not detected in C. quinquedens from south- the Cape Hatteras region can be stressful to subtropical and
ern New England. The three haplotypes of C. tiffinis were boreal species, and there are distinct current systems north
unique to that recognized species, but those haplotypes and south of this location. In the area that is now Florida,
differed only slightly from those of C. fenneri and C. episodes ofglaciation during the Pleistocene produced ma-
quinquedens from the GulfofMexico. Based on 16S rDNA jor changes in temperature and sea level, which may have
and ITS data, genetic differences between C. t/uint/netlens separated populations in the Atlantic Ocean from those in
from southern New England and the Gulf of Mexico are the Gulf of Mexico. Most of the marine biogcographic and
large enough to conclude that these are different fishery genetic studies have focused on species from the intertidal
zone and inner continental shelf, where terrestrial and at-
mospheric effects have a relatively large impact on the
R*eTcoeivwehdo8mOcctoorbreersp2o0n0d2e;naccecesphtoeudld23bMearcadhdr2e0s0s3e.d. E-mail: James. marine environment. In the deep sea. however, other envi-
Weinbergfs"noaa.gov ronmental factors are likely to control species distributions
tCurrentaddress: Auburn Uimersity, Biological Sciences,Auburn. AL (Haedrich etal., 1980; Blake and Grassle, 1994; Rhoads and
36830. Hecker, 1994; Grassle, 1995).
3IS
GENETIC STRUCTURE OF DEEP-SEA CRABS 319
Geryonids are a commercially important, cosmopolitan the basis of molting frequency (Lux et al.. 1982). adult
family of marine crabs typically found in mud. sand, and females probably do not mate every year. After mating,
gravel habitats at depths of200-1200 m (Hastie, 1995). In females carry fertilized eggs on their pleopods for up to 9
this study we have examined the population genetic struc- months until the larvae are released (Haefner. 1977. 1978).
ture of the deep-sea red crab Chaceon quinquedens Smith Brood sizes range from 160.000 to 270.000 eggs, and fe-
1S79 (Geryonidae). This species occurs on the outer conti- cundity increases with female body size (Hines. 1988).
nental shelf and slope of the western Atlantic Ocean, from Depending on water temperature, C. quinquedens larvae
the Scotian Shelf off Canada, to the Gulf of Mexico may remain planktonic forupto4 months before settlement
(Haefner and Musick, 1974; Williams and Wigley. 1977; (Perkins, 1972; Sulkin and Van Heukelem, 1980; Kelly
Serchuk and Wigley, 1982; Erdman. 1990). C. quinquedens et al.. 1982).
is harvested in Canada (Lawton and Duggan, 1998). in New Geryonid growth rates are lowerthan those offamilies of
England (Steimle ft til., 2001). and in the southeastern shallow-water crabs (Hastie, 1995). Complete growth
United States (Waller et al.. 1995). curves are not available for C. quinquedens, although tag-
Little information about population genetic structure in ging studies (Lux et al.. 1982) indicate that the intermolt
C. c/iiint/iietlens is available to guide fishery management period of adults can last as long as 7 years. After studying
(Diehl and Biesiot. 1994; Waller et ai. 1995). To assess the growth ofjuvenile crabs in the laboratory. Van Heuke-
genetic subdivision in C. quinquedens, we examined the lem etal. ( 1983) projected that C. quinquedens could attain
nucleotide sequence of the mitochondria! 16S rDNA gene a carapace width of 1 14 mm by age 6 years.
and the internal transcribed spacers (ITS) of the nuclear Female and male geryonids tend to segregate by depth
ribosomal repeat. Both 16S rDNA (e.g.. 6 Foighil and (Wigley el ai, 1975; Haefner and Musick, 1974; Haefner,
Jozefowicz. 1999: Schubart et al., 2000; Dahlgren et aI.. 1978; Melville-Smith. 1987), but migration patterns during
2001) and ITS (e.g.. Fritz et al.. 1994; Conole et til.. 2001) mating have not been described. Wigley et al. (1975) hy-
have been used to differentiate between closely related pothesizedthat C. quinquedens larvae settle to the bottom in
species and to evaluate intraspecific variation. deepwater and then migrate up the continental slope, where
To provide a broad phylogeographic perspective, we they may obtain more food and grow more rapidly. Tagging
compared sequence data from C. t/uinquedens with data studies by Lux et al. (1982) and Melville-Smith (1987)
from two congeners: C. fenneri Manning and Holthuis showed that adult geryonids travel along and across bathy-
1984. and an eastern Atlantic species, C. affinis Milne- metric lines. Returns oftagged adult C. quinquedens over a
Edwards and Bouvier 1894. C. fenneri, the golden crab, is 7-year period indicate that most recaptures occurred within
distributed from Cape Hatteras to the GulfofMexico (Man- 20 km of the release location. Principal movements were
ning and Holthuis. 1984; Erdman. 1990). C. quinquedens along the slope; shorter movements of about 6 km were
and C.fenneri are the only two Chaceon species described observed up and down the slope, with depth changes of as
from the Atlantic coast of North America. Their ranges much as 500 m (Lux et ai, 1982).
overlap in the southeastern United States (Erdman. 1990:
Diehl and Biesiot. 1994), and in the GulfofMexico they are Materials and Methods
segregated by depth, with C.fenneri occurring at depths of
300-500 m and C. quinquedens at 680 m or greater (Erd- The Chaceon quinquedens and C.fenneri specimens used
man, 1990). C. affinis, which occurs at 500-1200 m from in the 16S genetic study were collected from the Atlantic
the Cape Verde archipelago to Iceland, is allopatric with C. Ocean with traps or otter trawls (Table 1). The 13 C.
quinquedem and C. fenneri (Manning and Holthuis. 1981: quinquedens that were analyzed from southern New En-
Hastie. 1995: Pinho et ai, 2001; Lopez Abellan et al.. gland were collected during a National Marine Fisheries
2002). Service survey in May 2001 and were obtained from eight
tows made in the vicinity of Veatch and Atlantis Canyons,
at depths of465-931 m. The 10 specimens of C. quinque-
Study Organism
dens that were analyzed from the Gulf of Mexico were
Manning and Holthuis (1989) revised the taxonomy of collected in August 1995 from 951 m. The 1 1 specimens of
geryonid crabs and moved most ofthe species in the genus the golden crab (C. fenneri) that were analyzed from the
Ceryon, including G. quinquedens, into a new genus. Cha- Atlantic coast of Florida were collected in January 2002
ceon. C. quinquedens was first described from specimens from 335 m. The I6S rDNA data sets from all three sets of
collected in the Gulf of Maine (Smith. 1879). C. quinque- samples included both males and females. Three sequences
dens reaches a maximum size of about 115-130 mm in of C. affinis, from the eastern Atlantic (Madeira Islands and
carapace width (CW), males grow larger than females, and Canary Islands), were also available in GenBank from anal-
size at maturity for females is about 70 to 80 mm CW yses by J. Bautista and Y. Alvarez. Thus, a total of 37
(Wigley et ai, 1975; Haefner, 1977: Elner et al.. 1987). On individuals were represented in the 16S data (see Appendix
320 J. R. WEINBERG ET AL
Table 1
Chaceon quinquedens, C. aftinis, andC. fennen: ilittrihiition of16S rDNA haploTypes
Sample Locations by Species
Haplotype
GENETIC STRUCTURE OF DEEP-SEA CRABS 321
parsimony informative (Table 2). Each unique combination Discussion
of nucleotides was considered a distinct haplotype. Only
three indels were observed, of which two were associated We detected genetic subdivision between Chaceon quin-
with extra bases in the Cluiceon affinis sequences. Table 1 quedens from the New England region of the Atlantic
shows the distribution, occurrence, and GenBank accession Ocean and C. quinquedens from the Gulf of Mexico by
number of each 16S haplotype observed in this study. The using sequence data from two genetic loci ( I6S and ITS). In
aligned data set was deposited in TreeBASE (http:// addition, we found little or no genetic difference ( 16S data)
www.treebase.org/treebase/ accession number-SN1246). between C. quinquedens from the Gulf of Mexico, C. fen-
Two 16S haplotypes were detected in the southern New neri from Eastern Florida, and C. affinis from the Eastern
England samples of C. quinquedens, four in the Gull' of Atlantic. These results suggest that the designation of mor-
Mexico samples of C. quinquedens, and only one in the C. phological species within the commercially important genus
fenneri samples from the Atlantic coast of Florida. The C. Chaceon is not congruent with evolutionary history. Fur-
affinis data consisted of three haplotypes (Table 1). The thermore, the genetic similarity of C. affinis and Gulf of
parsimony network (Fig. 1) illustrates the phylogenetic re- Mexico C. quinquedens suggests these trans-Atlantic taxa
lationships among the nine known haplotypes of Chaceon. share a more recent common history than the two popula-
Position 321 is homoplastic, occurring twice on the net- tions of"C. quinquedens" that we examined. This is the first
work. The largest genetic break observed among geograph- examination of large-scale genetic subdivision in C. quin-
ical groups or nominal species was between C. quinquedens quedens, and one of the few to genetically characterize a
from southern New England and C. quinquedens from the deep-sea organism (e.g., Doyle. 1972; France and Kocher,
Gulf of Mexico. Haplotypes from these two groups had a 1996: Quattro er til.. 2001) not at hydrothermal vents. As
minimum of 10 differences. All 11 C. fenneri samples such, it provides an interesting comparison to intertidal
matched the most common haplotype found in the C. quin- organisms upon which most ofourunderstanding ofmarine
quedens samples from the Gulf of Mexico (haplotype D). phylogeography is based.
However, haplotype D was not detected in C. quinquedem Management of the Cluiceon quinquedens fishery began
samples from southern New England. The three haplotypes recently inthe United States (Steimleetal., 2001), andCape
ofC. affiniswere unique to that species, although these were Hatteras was designated as the dividing point between a
very similar to haplotype D, with a maximum of three northern and southern stock. Our genetic results lend sup-
differences. port for managing this fishery as separate stocks. However,
The ITS data also show a genetic difference between the additional research will be required to more accurately
two C. quinquedens populations. Two ITS2 genotypes were determine stock boundaries. The genetic differences we
identified (Fig. 2). distinguished by an indel in a microsat- detected probably reflect genetic drift during long periodsof
ellite region close to the 3' end. The (AAGG)4 allele was isolation. Minimal gene flow between these locations could
shared by all five southern New England specimens, have been caused by low rates of dispersal of adults be-
whereas the (AAGG)5 allele was found among all 10 Gulf tween regions and by retention oflarvae within regions. For
of Mexico specimens. In addition to the repeat, a single intertidal organisms, at least three faunal breakpoints are
nucleotide difference (A-T at position 1239) further distin- known along the east coast of North America: Cape Cod,
guishes the two populations. ITS data can be found under Cape Hatteras. and near Cape Canaveral. These coastal
GenBank accession numbers AY123199-AY123200. features serve as both species-range boundaries and genetic
Table 2
List of17 variablepositions in 9 luip/otvpesfrom samples ofChaceon
322 J. R. WEINBERG ET AL
tributed to the large genetic difference we observed. Alter-
natively, the observed divergence could represent variation
at the two ends ofa cline. We are currently trying to obtain
samples along the North American east coast to address
these issues.
Observing at least 10 nucleotide substitutions between
New England and the Gulf of Mexico in a gene as con-
served as the 16S was surprising. Although no lineage-
specific calibration for substitution rates has been deter-
mined for geryonid crab 16S data, grapsid crabs have been
shown to have a rate of 0.65% per MY (Schubart el al..
1998). Differences in mtDNA sequences between geminate
marine invertebrate taxa on the two sides of the Isthmus of
Panama suggest that sequence divergence is in the range of
l%-4% per MY (Bermingham and Lessios. 1993; Knowl-
ton el al., 1993). If one assumes that the Chaceon rate is
between 0.5% and 2% per MY, then the New England and
GulfofMexico populations have been separated for0.7-2.9
MY
(rate homogeneity test not significantly rejected), plac-
ing their separation during the Pleistocene or Pliocene.
Their genetic isolation may have arisen in association with
Figure 1. Parsimony network of 16S haplotypes for Chaceon qiiin- fluctuating sea level due to glaciation events. However,
quedens. C. fenneri. and C. ufftnis. Lines crossing branches represent without additional sampling to understand where genetic
inferred nucleotide substitutions, and thus, theminimumobserved number bieaks occur, determining the exact mechanism or mecha-
ofnucleotide differences between haplotypes. The solid line, dashed line, nisms of genetic isolation is not possible.
raengdionssh:adseoduthaereran NareowunEdngclearntda.inAthlaapnltoitcycpoeasstinodficFaltoeridthar-eGeulgfeoofgrMaepxhiiccoa,l Based on the finding of only a single substitution sepa-
and eastern Atlantic specimens, respectively. Note, 16S position 321 is rating C. affinis from Chaceon in the Gulf of Mexico, we
homoplastic and is represented on the network twice (between A and D, conclude that there has been very recent geneexchange with
and E and F). the Old World at subtropical/tropical latitudes. Although
adult C. t/itiiu/iiedens do not migrateextensively (Lux elal.,
1982). the larvae have the potential to disperse great dis-
barriers to gene flow (Franz and Merrill, I98()a, b; Avise, tances because they can spend up to 4 months in the plank-
1992, 2000; Bert, 1986; Collin 2001; but see McMillen- ton (Perkins, 1972; Sulkin and Van Heukelem, 1980; Kelly
Jackson elai, 1994). A recent study by Collin (2001 ) is the c/ n/.. 1982). Our sample of C. affinis was admittedly
only molecularinvestigation todate with adequate sampling limited, and given the cryptic morphology of Chaceon, we
acrossall threebreakpoints (but see Avise, 1992. 2000). Her do not assume that three individuals from the Canary Is-
results are similar to ours: she found that two traditionally lands are a representative sample ofC. affinis throughout its
recognized species ofthe gastropod Crepidiila show signif- extensive range, reported to extend as far north as Iceland
icant genetic subdivision between New England and the (Manning and Holthuis, 1981; Hastie. 1995; Pinho a al..
Gulf of Mexico. Because our sampling was limited, we 2001; Lopez Abellan a al.. 2002). Nonetheless, our data
cannot distinguish how the three known breakpoints con- provide evidence that this species from the continental shelf
C. quinquedens ITS 2
Southern New England: CAAAACGAAGGAAGGAAGGAAGG-- --GACCGAGACTAAAC
Gulf of Mexico: CAAAACGAAGGAAGGAAGGAAGGAAGGGACCGAGACTAAAC
Figure 2. A partial alignment of ITS2 (positions 1263-1303) in Cluiccnn i/nhn/iicili'iis. showing the fixed
variation in a microsalellile repeat (AAGG)distinguishing between fivesouthern New Englandsamplesand II)
Gull ol Mexico samples. The exact position ofthe indel could be at any ofthe five (AAGG) sites.
GENETIC STRUCTURE OF DEEP-SEA CRABS 323
and slope has experienced transatlantic interchange at lower (Rathbun, 1937) and South Africa, but subsequent taxo-
latitudes, suggesting that North Atlantic biogeography may nomic work determined that those crabs were undescribed
be more complicated than previously assumed (also see Chaceon species (Manning and Holthuis, 1988; Manning
Dahlgren el ai, 2000). This finding is in contrast to the et nl.. 1989). As in some other crab genera (Schubart et ai,
widely studied situation of genetic interchange of North 2001a), phenotypic characters used to distinguish among
Atlantic boreal intertidal organisms at high latitudes (re- Chaceon species are somewhat ambiguous. These charac-
viewed in Cunningham and Collins, 1998). ters, which include carapace shape and color, sizes of
Two recognized Chaceon species around Florida showed spines, and shape of the dactyli of the walking legs (Man-
nogenetic differentiation even though previous studies have ning and Holthuis, 1984, 1989) are mostly morphometric.
reportedvariousecological differencesbetween C. quinque- Definitive apomorphies are lacking.
dens and C. fenneri. In the Gulf of Mexico, these two Given their phenotypic similarity, it is not surprising that
species are segregated by depth, and C. fenneri oviposits 3 C. quinquedens, C. fenneri, and C. affinis have similar
months later in the year (Erdman, 1990). C. quinquedens in genotypes. The present taxonomic classification of these
southern New England produces larger eggs than C.fenneri species, based on phenotypic characters, is not consistent
does in the Gulf of Mexico (Mines, 1988). Given these with our genetic results, because we found greater differ-
interspecific differences, we did not expect to find more ences between populations of one species than between
genetic differences between the two C. quinquedens popu- recognized species. Even though the common names of
lations than between C. quinquedens from the Gulf of these species are based on carapace color (e.g., red crab,
Mexico, C. fenneri, and C. affinis. Several explanations of golden crab), carapace color is not a reliable character for
the genetic similarity between these recognized species are identifying species of Chaceon. For example, one of the
possible, including incomplete lineage sorting, ongoing specimens we genotyped from southern New England had a
gene flow, or recent hybridization followed by a mitochon- rare yellowish-tan carapace, which made us think that it
drial sweep (Skibinski et nl., 1999). If these lineages di- might be a golden crab (C. fenneri); the Chaceon from
verged recently (which would be consistent with morphol- southern New England are typically deep red to orange in
ogy; see below), then the shared haplotype ("D" in C. color. The unusual yellowish-tan crab had haplotype F,
fenneri and Gulf of Mexico C. quinquedens) might reflect which is a common haplotype in the southern New England
incomplete sortingofmitochondrial lineages (Hoelzeret<//., red crab (C. quinquedens) population. We should note that
1999). Alternatively, the slightdifferencesobserved in these the type locality of C. quinquedens is from the Gulf of
three lineages may simply represent within-population vari- Maine, indicating that ifchanges are tobe made, the Gulfof
ationorenvironmentally induced variation. Forexample, C.
Mexico individuals should be renamed. Before this can be
fenneri and C. quinquedens from the Gulf of Mexico are done, we need a more complete understanding of the mor-
gwehoigcrhapmhaicyalelxypossyemptahterimctboudtififnehraebnittednivfiferroennmtendteaplthfazcotnoerss,. phological and genetic variation along the North American
coast.
To assess the level of ongoing gene flow between these
nominal species, it would be necessary to examine more Similar discrepancies between morphological and molec-
rapidly evolving molecularmarkers, such as microsatellites. ular genetic data have been noted in other crab species
Lastly, the similarity in the 16S gene ofthese taxa could be (Schubart et ai, 2001a, 2001b). In a study of Callinectes
due to hybridization followed by a mitochondrial gene spp. in Venezuela, Schubart et ai (200la) found that C.
bocourti Milne Edwards 1879 and C. maracaiboensis Tais-
sweep (Skibinski et ai, 1999). Studies of hybridization
between Chaceon species have not been conducted, but soun 1969 had no diagnostic molecular characters to distin-
hybridization occurs in xanthidcrabs in the GulfofMexico- guish their 16S mtDNA sequences. After considering the
Florida region (Bert, 1986; Bert and Harrison, 1988). genetic and morphological data on those species, Schubart
Chaceon morphology is consistent with a hypothesis of el ai (2001a) concluded that one of the species should be
recent speciation. Due to their similar phenotypes. C. quin- reclassified as a junior synonym of the other, rather than
quedens, C.fenneri. C. affinis, andeven acommercial South considering them as different species. Another study found
African species, C inaritae Manning and Holthuis 1981, a lack ofgenetic variation between twoBrachynotus species
have been confused in the literature. For example. C. imiri- (Schubart et /., 2001b), andconcluded that additional work
tae was called C. quinquedens until 1981 (Manning and on reproductive isolation, genetic sequences, and morphol-
Holthuis, 1981; Melville-Smith, 1989). C.fenneri was iden- ogy is needed to assess whether these are distinct species.
tified as C. quinquedens by Rathbun (1937), and later as C. Such examples emphasize the need for more information
affinis by Chace (1940). Manning and Holthuis (1984) about the morphological and genetic variations that delimit
eventually described C. fenneri as a new species. C. quin- the boundaries between many marine taxa, including
quedens was reported from the coasts of South America Chaceon.
324 J. R. WEINBERG ET AL
Acknowledgments Sundherg. 2001. Molecular phytogeny of the model annelid
Ol'hryotrochii. Biol. Bull. 201: 193-203.
We are very grateful to P. Biesiot, H. Perry, P. Brown- Diehl,\V.J..andP.M.Biesiot. 1994. Relationshipsbetweenmultilocus
Eyo. R. Nielson. D. Harper, C. Keith, and Captain H. hetero/ygosity and morphometric indices in a population ofthe deep-
Franco and the crew of the F/V Maty K for their valuable sea red crab Chaceon i/tiinuitcilcns (SmithI. J. Exp. Mai: Biol. Ecol.
182: 237-250.
oalsdsiesrtcaonlcleecitnioncso.llWecetianpgprneecwiatseacmopnltersibuotriofnosr fsrhoamriAn.g Gtohevi-r Doyldee,rmRa.ta\)V.po1p9u7l2a.tioGnseneintitchevadreieaptiosena.inDOepehp-iSoemausRieus.m 1l9y:ma6n6i1-(6Ec6h4i.no-
indarajan and F. Serchuk related to manuscript preparation Finer, R. W., S. Koshio, and G. V. Hurley. 1987. Mating behaviorof
or data collection. The 16S sequences of Chaceon affinis the deep-sea red crab. Geryon quinquedens Smith (Decapoda.
were deposited in GenBank by J. Bautista and Y. Alvarez. Brachyura, Geryonidae). Cmstaceana 52: 194-201.
This research was supported in part by funds from C. Erdman. R. B. 1990. Reproductiveecologyanddistributionofdeep-sea
Tryggers Stiftelse to TGD, and from NSF and the Ocean crabs(FamilyGeryonidae)fromsoutheast FloridaandtheeasternGulf
Life Institute at WHOI to KMH. This work is WHOI FranocfeM,exS.icCo..,Pahn.dD.Td.isDs.ertKaoticohne.r.Uni1v9e9r6s.ityGoefogSroaupthhicFloarnidda.bat1h4y7meppt.ric
contribution number 10865. patternsofmitochondria! 16SrRNAsequencedivergenceamongdeep-
sea amphipods, Eiirythenex gryllus. Mar. Biol. 126: 633-645.
Franz,D. R.,and A. S. Merrill. 1980a. Molluscandistribution patterns
Literature Cited
on the continental shelf of the Middle Atlantic Bight (Northwest
Abhott, R. T. 1974. American Seashells. Van Nostrand Reinhold, New Atlantic). MtiUicoloKui 19: 209-225.
York. Franz,D. R.,andA.S.Merrill. 1980b. Theoriginsanddeterminantsof
Avise,J.C. 1992. Molecularpopulation structureandthe biogeographic distributionofmolluscanfauna!groupsontheshallowcontinentalshelf
historyofaregional fauna: acasehistory withlessonsforconservation ofthe northwest Atlantic. Multicitlogui 19: 227-248.
biology. Oikos 63: 62-76. Fritz,G.N.,J.Conn,A.Cockburn,andJ.Seawright. 1994. Sequence
Avise, J. C. 2000. Phylogeography, the Mixture andFormation ofSpe- analysis of the nhosomal DNA internal transcribed spacer 2 from
cies. Harvard Univ. Press. Cambridge. MA. populationsotAnophelesenuneztovari(Diptera: Culicidae).Mol. Biol.
Avise, J. C., R. A. Lansman, and R. O. Shade. 1979. The use of Evol. 11: 406-416.
restriction endonucleases to measure mitochondria! DNA sequence Grassle,J. F. 1995. Deep-seabiodiversity. Bull. Mar. Sci. 57: 281-285.
relatednessinnaturalpopulations. I. Populationstructureandevolution Grosslein,M. D.,andT. R. Azarovitz. 1982. Fish Distribution. MESA
in the genus Peromysciis. Genetics 92: 279-295. New York Bight Atlas Monograph 15. Marine Ecosystems Analysis
Bermingham, K., and H. Lessios. 1993. Rate variation ofprotein and [MESA] Program. New York Sea Grant Institute. Albany. NY.
mtDNA evolution as revealed by seaurchins separated by the Isthmus Haedrich,R.L..G.T.Rowe,andP.T.Polloni. 198(1. Themegabenthic
ofPanama. Pmc. Natl. Acud. Sci. USA 90: 2734-2738. fauna in the deep-seasouthofNew England. Mai: Biol. 57: 165-179.
Bert, T. M. 1986. Speciation in western Atlantic stone crabs (genus Haefner. P. A.. Jr. 1977. Reproductive biology ofthe female deep-sea
MenippeY. the role ofgeological processes and climatic events in the redcrab, Geryonquinquedens, fromChesapeake Bight. Fish. Bull. 75:
formation and distribution ofspecies. Mm: Bio/. 93: 157-170. 91-102.
Bert, T. M.. and R. G. Harrison. 1988. Hybridization in western Haefner. P. A., Jr. 1978. Seasonal aspects of the biology, distribution
Atlantic stone crabs (genus MenippeY. evolutionary history and eco- and relative abundance ofthe deep-sea red crab Geryon quinquedens
logical context influence species interactions. Evolution 42: 528-544. Smith, in the vicinity ofthe Norfolk Canyon, western North Atlantic.
Blake, J. A., and J. F. Grassle. 1994. Benthic community structure on Pmc. Nail. Shellfish. Axsoc. 68: 49-62.
the U.S. Atlantic slope off the Carolinas: spatial heterogeneity in a Haefner. P. A., and J. A. Musitk. 1974. Observations on the distribu-
CBrhiagccguesr,,reFJn..tACd..o,m1Ji9rn7.a4t.1e9d40M.sayrsitTnehmee.ZDboeroaexcpch-oySguerraaapnRhevcs.r.abM4s1.c:GRr8ep3ao5wr-t8Hs7il4ol.,nNtheewscYioenrtki.fic tcioonntianenndtaalbusnlodpaen.ceMaorf.rFeidshc.raRbesv.in36N:or3f1o-l3k4.Canyon and the adjacent
results ofthe Atlantis expeditions to the West Indies, under thejoint Hastriees,our1,c.e.C.Oce1a9n9u5g.r.DMeaeip:-wBaitoel.rAgnenrny.onRiedv.cr3a3b:s:56a1-5coSn4t.inental slope
auspicesofthe University ofHavanaand Harvard University. Torreia Hillis, 1). M., and M. T. Dixon. 1991. Ribosomal DNA: molecular
4: 1-67.
Collin, R., 2001. The effects ofmode ofdevelopment on phylogeogra- evolution and phylogenetic inference. Q. Rev. Biol. 66: 41 1-453.
phyandpopulation structureofNorth Atlantic Crepidnla(Gastropoda: Hines, A. H. 1988. Fecundity and reproductive output in two species of
Calyptraeidae). Mol. Ecol. 10: 2249-2262. deep-sea crabs. Geryon fenneri and G. quinquedens (Decapoda:
Conole,J.,N. B.Chilton,T.Jarvis.and R. B.Gasser.2001. Mutation Brachyura). ./. Cmstac. Biol. 8: 557-562.
scanning analysis of microsatellite variability in the second intern.il Hoelzer. G. A., J. VVallman, and D. J. Melnick. 1999. The effects of
transcribed spacer (precursor ribosomal RNA) for three species of social structure, geographical structure, and population size on the
Metastrongylus (Strongylida: Metastrongyloidea). Parasitolo^v 122: evolution ofmitochondria! DNA: II. Molecularclocks and the lineage
195-206. sorting period. ./. Mol. Evol. 47: 21-31.
Cunningham, C. W., and T. M. Collins. 1998. Beyond area relation- Kelly, P.. S. D. Sulkin, and W. F. Van Heukelem. 1982. A dispersal
ships:extinctionandrecolonizationinmolecularmarinehiogeography. model torlarvaeofthedeepsearedcrabGeryoniiuinquedensbasedon
Pp. 297-321 in Molecular Approaches to Ecology c/nJ Evolution. R. behavioral regulation ofvertical migration in the hatching stage. Mar.
DeSalle and B. Schierwater. eds. Birkhauser Verlag, Basel. Biol. 72: 35-43.
Oahlgren, T. G., J. R. Weinherg, and K. M. Halanych. 2000. Phylo- Kiiiivtiinii. N., L. A. Weight, L. A. Solorzano, D. K. Mills, and E.
geography of the ocean quahog (Arctica islandicaY. inlluences ol Bermingham. 1993. Divergence of proteins, mitochondria! DNA.
paleoclnnate on genetic diversity aiul species range, Mtn. l-liol 137: and reproductive compatibility across the Isthmus ofPanama. Science
487-495 260: 1629 -1632.
Dahlgren, T. G.. B. Akesson, C. Schander, K. M. Halanych, and P. Lawton, P.. and 1). Duggan. 1998. Scotian Shelf Red Crah. DFO
GENETIC STRUCTURE OF DEEP-SEA CRABS 325
Science Stuck Status Report C3-11. Dept. of Fisheries and Oceans, Schubart,C.D,J. E.Conde,C.t'armona-Suare/,, R. Robles.and 1).L.
Dartmouth. Nova Scotia. Canada. Felder. 2001a. Lack ofdivergence between I6S mtDNA sequences
Lopez Abellan, L. J., E. Balguerias. and V. Fernandez-Vergaz. 20(12. of the swimming crabs Cullinectes bocourti and C. maracaiboensis
Life history characteristics ofthe deep-sea crab Chaceon af/mis pop- (Brachyura: Portunidae) from Venezuela. Fislt. Bull. 99: 475-4SI.
ulation offTenerife (Canary Islands). Fish. Res. 58: 231-234. Schubart. C. D., J. A. Cuesta, and A. Kodrigue/. 2001b. Molecular
Lux, F. E.,A. R.Ganz.and W. F. Rathjen. 1982. Marking studieson phylogeny of the crab genus Brachynotuf (Brachyura: Varunidae)
the redcrab Genon i/iiiihiuedens Smith offsouthern New England. J. based on the 16S rRNA gene. HnbobioloKia 449: 41-46.
Shellfish Rex. 2: 71-80. Serchuk, F. M., and R. L. Wigley. 1982. Deep-sea red crab. Geryon
Maddison, W. P., and D. R. Maddison. 2000. MacCladc: Analysis <>/ uninqiicdciis. Pp. 125-129 m Fish Distribution. M. D. Grosslein and
Phvlof;eii\ and Character Evolution version 4.0. Sinauer Associates. T. R. Azarovitz. eds. MESA New York Bight Atlas Monograph 15.
Sunderland. MA. N. Y. Sea Grant Institute, Albany, NY.
Manning. R. B., and L. B. Hnlthuis. 1981. West African hraclmiran Seyoum, S., M. D. Tringali, T. M. Bert, D. McElroy, and R. Stokes.
Mancnrianbgs.(CRr.usBt.a.ceaan:dDeL.caBp.odHao)l.thSumiist.hs1o9n8.4.ContTrwiho.nZeoowl.ge3n0e6r:a3a7n9d. nine 2ne0i0i0o.ps Aocnclladniatilsy.sisbaosfedpoopnulamttioDnNAgenceotnitcrosltrurcetguiroenisneqruedendcersu.m,FiSschi.-
new species of geryonid crabs (Crustacea. Decapoda. Geryonidael. Bull. 98: 127-138.
Pi-oc. Biol. Soc. Wash. 97: 666-673. Skibinski,D.O. F.,C.Gallagher,and H.Quesada. 1999. On theroles
Manning.R. B.,and L.B. IlollInns. 1988. South African speciesofthe ofselection, mutation anddrift intheevolutionot mitochondria] DNA
genus Gervnn (Crustacea. Decapoda. Geryonidael. Ann. S. Afr. Mus.
98: 77-92. diversity in British Mvtilus edii/is (Mytilidae: Mollusca) populations.
Manning. R. B.. and L. B. Holthuis. 1989. Gcnun tenneri. a new Biol. J. Linn. Soc. 68: 195-213.
deep-water crab from Florida (Crustacea: Decapoda: Geryonidae). Smith, S. I. 1879. The stalk-eyed crustaceans of the Atlantic coast of
Proc. Biol. Soc. Wash. 102: 50-77. North America north ofCapeCod. Trans. ConnecticutAcad. ArtsSci.
Manning. R. B., M. S. Tavares, and E. F. Albuquerque. 1989. Cha- 5: 27-138.
ceon ramosae. a new deep-water crab from Brazil (Crustacea: Deca- Steimle, F. W.. C. A. Zetlin, and S. Chang. 2001. Red deepsea crab,
MtMipoldlae:n-GJearcykonsiodna.e)A..PLr.o.cT..BMio.l.BeSrotc.,aWnadshP..1S0te2e:le6.461-96945.0. Population NChOaAcAeoTnec(hG.eMneoma)o.uiNiiMnFqiSt-eiNlEen-s1.6l3if.ehUi.sSt.orDyepatn.dohtabCiotamtmechracraec,teNriOstAiAcs..
geneticsofthebluecrab Callinectessapiilus: modestpopulation struc- NMFS. Woods Hole. MA.
turing in a background ofhigh gene flow. Mar. Biol. 118: 53-65. Sulkin, S. D., and W. F. Van Heukelem. 1980. Ecological and evolu-
Melville-Smith, R. 1987. Movements of deep-sea red crab (Geryon tionary significanceofnutritional flexibility inplanktotrophiclarvaeof
maritae)offSouth West Africa/Namibia. S.Afr. ./. Zool. 22: 143-152. thedeepsearedcrabGeryon quinquedensand the stonecrabMenippe
Melville-Smith, R. 1989. A growth model for the deep-sea red crab mercenaria. Mar. Ecol. Prog. Ser. 2: 91-95.
(Gen'on maritae) off South West Africa/Namibia (Decapoda. Swofford, D. L. 2002. PAUP* 4.0 Phylof>cnctic Analysis Using Parsi-
Brachyura). Cruslaceana 56: 279-292. mom: Sinauer, Sunderland. MA.
6 Foighil, I).,and C.J.Jozefowicz, 1999. Amphi-Atlantic phylogeog- Theroux,R.B..and R. L.\\igley. 1983. Distributionandabundanceof
raphy of direct-developing lineages of Lasea. a genus of brooding eastcoastbivalvemollusksbasedonspecimensintheNationalMarine
bivalves. Mar. Biol. 135: 115-122. Fisheries Service Woods Hole Collection. NOAA Tech. Kept. NMFS
Palumhi.S.R. 1996. NucleicacidsII:thepolymerasechainreaction.Pp. SSRF-768. U.S. Dept. ofCommerce. NOAA, NMFS, Seattle. WA.
205-24S in MolecularSystematic*. D. M. Hillis. C. Mortiz. and B. K. Thompson.J..T.Gibson.F.Plewniak, F.Jeanmougin,andD.Higgins.
Mable, eds. Sinauer Associates. Sunderland. MA. 1997. The CLUSTAL_X windows interface: flexible strategies for
Perkins, H. C. 1972. The larval stages ofthedeepseared crab. Geryon multiple sequence alignment aided by quality analysis tools. Nucleic
qiiinqiieden.s Smith, reared under laboratory conditions (Decapoda: Acids Res. 22: 4876-4X82.
Brachyrhyncha). Fish. Bull. 71: 69-82. M VanHeukelem,W.,M.C.Christman,C.E.Epifanio,andS.D.Sulkin.
Pinho, M. R., J. M. Goncalves, H. R. Martins, and G. Menezes. 1983. Growth of Geryon quinquedens (Brachyura: Geryonidae) ju-
2001. Some aspects ofthe biology ofthe deep-watercrab. Clnucon veniles in the laboratory. Fish. Bull. 81: 903-905.
affinix (Milne-Edwards and Bouvier, 1894) offthe Azores. Fish. Rc.\. Waller. R., H. Perry. C. Trigg, J. McBee, R. Erdman, and N. Blake.
51: 283-295.
Quat2t0r0o1,.J.EMx.t,reMm.eRm.itCohcahsoend,riMa.!AD.NRAexd,ivT.erWge.ncGerewiigt,hiannpdopRu.laJt.iEotntserol. r1e9d95c.rab,EsCthimaacteeosnofquhianrqvueesdtenpsot,enitniatlheanndordtihstcreinbturtailonGuoflfthoefdMeeexpicsoe.a
(he deep-sea gastropod Frigidalvania hrychia. Mar. Biol. 139: I 107- WhitGeu,lfT.ReJs...RT.epB.u9r:ns7,5-S.84L.ee,andJ. Taylor. 1990. Amplification and
RathU1.h11uS3n..,NaMi.l.JM.ns1.937B.ull.Th16e6:ox1y-s2t7o8m.atous and allied crabs of America. dPipr.ec3t15s-eq3u2e2ncininPgCoRfPfruontgoaclol!r,i:boAsoGmuaildeRtNoAMegtehnoedssfaonrdphAyplpolgiecnaetitoincss..
Rhoads,D.C.,and B.Hecker. 1994. Processesonthecontinental slope M. A. Innis. D. H. Gelfand. J. J. Snmsky. and T. J. White, eds.
offNorth Carolina with special reference to the Cape Hatteras region. Academic Press. New York.
Deep-Sen Res. 41: 965-980. Wigley, R. L.. R. B. Theroux, and H. E. Murray. 1975. The deep sea
Schubart,C. D.,R.Diesel,and S. B. Hedges. 1998. Rapidevolution to red crab. Mar. Fish. Rev. 37: 1-21.
terrestrial life in Jamaican crabs. Nature 393: 363-365. Williams, A. B., and R. L. Wigley. 1977. Distribution of decapod
Schubart. C. 1).. J. E. Neigel. and D. L. Felder. 2000. Use ol milo- Crustacea off northeastern United States based on specimens at the
chondrial 16S rRNA gene for phylogenetic and population studies ot Northeast Fisheries Science Center. Woods Hole. Massachusetts.
Crustacea. Crustac. Issues 12: 817-830. NOAA Tech. Report NMFS Circular407. NOAA. Woods Hole. MA.
326 J. R. WEINBERG ET AL.
Appendix
Summary ofcollection data tor specimens ofChaceon (deep-sea red crab) used in the 16S genetic study
Southern New England. C/uit